Starting /dee2/code/volunteer_pipeline.sh SRR12919364 current disk space = 3050893533184 free memory = 1417185504 SRR12919364 SRAfilesize a005769ceebc6f0d3f8bb0d33fc338f5 SRR12919364.sra SRR12919364.sra file validated SRR12919364 is paired end SRR12919364 is conventional basespace SRR12919364 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919364_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.539 37.0 37.0 37.0 37.0 37.0 2 36.2995 37.0 37.0 37.0 37.0 37.0 3 36.5435 37.0 37.0 37.0 37.0 37.0 4 36.6435 37.0 37.0 37.0 37.0 37.0 5 36.6455 37.0 37.0 37.0 37.0 37.0 6 36.7205 37.0 37.0 37.0 37.0 37.0 7 36.5965 37.0 37.0 37.0 37.0 37.0 8 36.655 37.0 37.0 37.0 37.0 37.0 9 36.6945 37.0 37.0 37.0 37.0 37.0 10-14 36.6306 37.0 37.0 37.0 37.0 37.0 15-19 36.63249999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.6298 37.0 37.0 37.0 37.0 37.0 25-29 36.573 37.0 37.0 37.0 37.0 37.0 30-34 36.5974 37.0 37.0 37.0 37.0 37.0 35-39 36.5697 37.0 37.0 37.0 37.0 37.0 40-44 36.525600000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.5346 37.0 37.0 37.0 37.0 37.0 50-54 36.4948 37.0 37.0 37.0 37.0 37.0 55-59 36.477 37.0 37.0 37.0 37.0 37.0 60-64 36.4333 37.0 37.0 37.0 37.0 37.0 65-69 36.370799999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.337900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.354 37.0 37.0 37.0 37.0 37.0 80-84 36.3332 37.0 37.0 37.0 37.0 37.0 85-89 36.2525 37.0 37.0 37.0 37.0 37.0 90-94 36.2589 37.0 37.0 37.0 37.0 37.0 95-99 36.2169 37.0 37.0 37.0 37.0 37.0 100-104 36.1738 37.0 37.0 37.0 37.0 37.0 105-109 36.1656 37.0 37.0 37.0 37.0 37.0 110-114 36.12650000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.092200000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0486 37.0 37.0 37.0 37.0 37.0 125-129 35.968399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.8906 37.0 37.0 37.0 37.0 37.0 135-139 35.8652 37.0 37.0 37.0 37.0 37.0 140-144 35.7592 37.0 37.0 37.0 37.0 37.0 145-149 35.76389999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.68925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 0.0 26 4.0 27 9.0 28 6.0 29 21.0 30 20.0 31 33.0 32 41.0 33 55.0 34 113.0 35 311.0 36 3020.0 37 363.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.175000000000004 11.875 7.475 43.475 2 20.236299648064353 12.493715434891906 36.27450980392157 30.995475113122172 3 17.599999999999998 17.875 27.35 37.175000000000004 4 20.825 24.349999999999998 24.75 30.075000000000003 5 21.95 31.85 25.650000000000002 20.549999999999997 6 19.925 34.425 23.7 21.95 7 14.975 26.525 42.85 15.65 8 17.325 27.075 30.4 25.2 9 16.3 24.825 35.075 23.799999999999997 10-14 19.15 30.3 27.560000000000002 22.99 15-19 19.515 28.494999999999997 28.005000000000003 23.985 20-24 19.825 28.970000000000002 28.215 22.99 25-29 19.41 28.675 28.01 23.905 30-34 19.34 29.509999999999998 27.965 23.185 35-39 19.275000000000002 29.535 27.79 23.400000000000002 40-44 19.580000000000002 28.849999999999998 28.194999999999997 23.375 45-49 20.135 29.13 27.29 23.445 50-54 19.485 28.7 28.13 23.685000000000002 55-59 19.855 28.410000000000004 27.925 23.810000000000002 60-64 19.89 28.43 27.85 23.830000000000002 65-69 19.525000000000002 28.78 28.199999999999996 23.494999999999997 70-74 20.02 28.67 27.779999999999998 23.53 75-79 20.405 28.22 27.62 23.755000000000003 80-84 19.650000000000002 28.235 28.000000000000004 24.115000000000002 85-89 20.19 27.99 28.52 23.3 90-94 20.365 28.615000000000002 27.42 23.599999999999998 95-99 20.015 28.52 27.800000000000004 23.665 100-104 20.205000000000002 28.854999999999997 28.07 22.869999999999997 105-109 20.155 28.315 27.6 23.93 110-114 20.474999999999998 29.175 27.395000000000003 22.955000000000002 115-119 20.29 28.544999999999998 27.71 23.455000000000002 120-124 20.27 28.275 27.87 23.585 125-129 20.155 28.595 27.85 23.400000000000002 130-134 20.355 28.155 27.900000000000002 23.59 135-139 20.445 28.105000000000004 28.01 23.44 140-144 20.815 28.59 26.915 23.68 145-149 20.635 28.349999999999998 27.529999999999998 23.485 150-151 20.5875 28.1875 27.8625 23.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.5 22 1.5 23 3.5 24 4.5 25 4.5 26 7.5 27 9.5 28 12.0 29 22.0 30 25.0 31 28.5 32 38.0 33 38.5 34 55.0 35 74.0 36 86.5 37 110.0 38 135.5 39 153.5 40 187.0 41 232.5 42 262.5 43 273.0 44 265.5 45 268.0 46 274.5 47 253.5 48 220.5 49 197.5 50 159.5 51 130.5 52 117.0 53 87.0 54 54.5 55 45.5 56 44.0 57 30.0 58 18.5 59 15.0 60 14.0 61 11.0 62 10.0 63 7.0 64 3.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.35843289802723 81.3 2 8.363434287302027 15.049999999999999 3 1.1392053348152265 3.075 4 0.11114198388441232 0.4 5 0.0 0.0 6 0.0 0.0 7 0.02778549597110308 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAGTGTCCCGCTATGGAACCTTCTGCCCGCAATGTCAACAGAAGAGT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.3375000000000004 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 3.8499999999999996 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.7625 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGATC 10 0.006830828 145.0 2 CTTATTT 10 0.006830828 145.0 3 AAGGTTG 10 0.006830828 145.0 4 GGAGTTT 10 0.006830828 145.0 5 >>END_MODULE SRR12919364 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919364_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.239 37.0 37.0 37.0 37.0 37.0 2 35.9775 37.0 37.0 37.0 37.0 37.0 3 36.0475 37.0 37.0 37.0 37.0 37.0 4 36.153 37.0 37.0 37.0 37.0 37.0 5 36.159 37.0 37.0 37.0 37.0 37.0 6 36.136 37.0 37.0 37.0 37.0 37.0 7 36.064 37.0 37.0 37.0 37.0 37.0 8 36.2655 37.0 37.0 37.0 37.0 37.0 9 36.2365 37.0 37.0 37.0 37.0 37.0 10-14 36.2906 37.0 37.0 37.0 37.0 37.0 15-19 36.257600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2572 37.0 37.0 37.0 37.0 37.0 25-29 36.1632 37.0 37.0 37.0 37.0 37.0 30-34 36.1288 37.0 37.0 37.0 37.0 37.0 35-39 36.1565 37.0 37.0 37.0 37.0 37.0 40-44 36.066700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0787 37.0 37.0 37.0 37.0 37.0 50-54 36.1105 37.0 37.0 37.0 37.0 37.0 55-59 36.067299999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9864 37.0 37.0 37.0 37.0 37.0 65-69 35.9948 37.0 37.0 37.0 37.0 37.0 70-74 35.9543 37.0 37.0 37.0 37.0 37.0 75-79 35.9285 37.0 37.0 37.0 37.0 37.0 80-84 35.9086 37.0 37.0 37.0 37.0 37.0 85-89 35.88570000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.817099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8587 37.0 37.0 37.0 37.0 37.0 100-104 35.822799999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.7033 37.0 37.0 37.0 37.0 37.0 110-114 35.728100000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6584 37.0 37.0 37.0 37.0 37.0 120-124 35.66759999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.5815 37.0 37.0 37.0 37.0 37.0 130-134 35.51379999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.331399999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.2947 37.0 37.0 37.0 32.2 37.0 145-149 35.2272 37.0 37.0 37.0 32.2 37.0 150-151 35.056 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 2.0 21 1.0 22 3.0 23 2.0 24 7.0 25 6.0 26 12.0 27 20.0 28 10.0 29 24.0 30 30.0 31 40.0 32 63.0 33 102.0 34 208.0 35 602.0 36 2638.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.425000000000004 24.45 11.25 27.875 2 26.474999999999998 27.1 30.8 15.625 3 19.125 29.349999999999998 33.5 18.025 4 23.150000000000002 34.125 24.85 17.875 5 25.25 35.65 21.875 17.224999999999998 6 20.525 37.824999999999996 23.75 17.9 7 20.75 23.45 37.525 18.275 8 22.25 25.575 28.999999999999996 23.175 9 21.075 24.55 30.525000000000002 23.849999999999998 10-14 22.884999999999998 29.84 26.515 20.76 15-19 22.875 28.34 28.225 20.560000000000002 20-24 22.705000000000002 28.605000000000004 27.77 20.919999999999998 25-29 23.125 28.625 27.97 20.28 30-34 22.814999999999998 28.544999999999998 28.035 20.605 35-39 23.0 28.110000000000003 28.23 20.66 40-44 23.23 28.475 28.13 20.165 45-49 23.02 28.38 27.715 20.885 50-54 22.96 28.58 28.005000000000003 20.455000000000002 55-59 22.75 28.720000000000002 28.365000000000002 20.165 60-64 22.965 27.85 28.365000000000002 20.82 65-69 23.5 27.85 28.060000000000002 20.59 70-74 24.09 27.755000000000003 28.144999999999996 20.01 75-79 22.99 28.084999999999997 28.005000000000003 20.919999999999998 80-84 22.71 28.22 28.455000000000002 20.615 85-89 23.400000000000002 27.555000000000003 28.7 20.345 90-94 24.055 27.55 28.1 20.294999999999998 95-99 23.425 27.985 28.199999999999996 20.39 100-104 23.94 28.205000000000002 27.725 20.13 105-109 23.69 28.035 28.09 20.185 110-114 23.805 27.839999999999996 28.189999999999998 20.165 115-119 24.37 27.52 27.96 20.150000000000002 120-124 24.87 27.6 27.235 20.294999999999998 125-129 24.02 28.12 27.800000000000004 20.06 130-134 25.019999999999996 28.005000000000003 27.495000000000005 19.48 135-139 24.775 27.54 27.755000000000003 19.93 140-144 24.59 27.76 27.405 20.244999999999997 145-149 25.47 28.325 26.375 19.830000000000002 150-151 25.374999999999996 27.425 27.450000000000003 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.0 24 2.0 25 3.0 26 3.5 27 4.0 28 8.0 29 14.0 30 17.5 31 25.0 32 28.5 33 35.0 34 52.5 35 64.0 36 80.5 37 120.0 38 161.5 39 203.0 40 252.0 41 259.5 42 243.5 43 271.5 44 282.5 45 261.0 46 260.0 47 247.0 48 215.5 49 188.0 50 159.0 51 116.0 52 89.0 53 87.5 54 65.5 55 41.0 56 33.0 57 24.0 58 17.5 59 14.5 60 9.5 61 6.0 62 8.5 63 5.5 64 1.5 65 0.5 66 0.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 1.0 98 1.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.06699751861042 82.575 2 7.802591673559416 14.149999999999999 3 0.9925558312655087 2.7 4 0.0827129859387924 0.3 5 0.027570995312930797 0.125 6 0.027570995312930797 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTACATAGAATGT 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 3.0250000000000004 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 3.9000000000000004 0.0 0.0 0.0 0.0 132-133 4.375 0.0 0.0 0.0 0.0 134-135 4.7875 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGACA 10 0.006830828 145.0 6 >>END_MODULE Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914710 spots for SRR12919364.sra Written 914710 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra Read 914707 spots for SRR12919364.sra Written 914707 spots for SRR12919364.sra SRR ids: ['SRR12919364.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vsyr438b SRR12919364.sra spots: 18294143 blocks: [[1, 914707], [914708, 1829414], [1829415, 2744121], [2744122, 3658828], [3658829, 4573535], [4573536, 5488242], [5488243, 6402949], [6402950, 7317656], [7317657, 8232363], [8232364, 9147070], [9147071, 10061777], [10061778, 10976484], [10976485, 11891191], [11891192, 12805898], [12805899, 13720605], [13720606, 14635312], [14635313, 15550019], [15550020, 16464726], [16464727, 17379433], [17379434, 18294143]] SRR12919364 file size 6195449 SRR12919364 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919364 SRR12919364_1.fastq SRR12919364_2.fastq Input file: SRR12919364_1.fastq Paired file: SRR12919364_2.fastq trimmed: SRR12919364-trimmed-pair1.fastq, SRR12919364-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:37:36 2025 >> started Wed Feb 12 20:38:09 2025 >> done (33.008s) 18294143 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 205 ( 0.00%) empty read pairs filtered out after trimming by size control 18293909 (100.00%) read pairs available; of these: 1597978 ( 8.74%) trimmed read pairs available after processing 16695931 (91.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 6 0.00% 24 6 0.00% 25 12 0.00% 26 5 0.00% 27 11 0.00% 28 10 0.00% 29 5 0.00% 30 6 0.00% 31 9 0.00% 32 10 0.00% 33 9 0.00% 34 15 0.00% 35 9 0.00% 36 12 0.00% 37 21 0.00% 38 20 0.00% 39 15 0.00% 40 19 0.00% 41 22 0.00% 42 27 0.00% 43 20 0.00% 44 16 0.00% 45 18 0.00% 46 26 0.00% 47 18 0.00% 48 26 0.00% 49 31 0.00% 50 40 0.00% 51 45 0.00% 52 41 0.00% 53 70 0.00% 54 50 0.00% 55 74 0.00% 56 78 0.00% 57 69 0.00% 58 71 0.00% 59 105 0.00% 60 102 0.00% 61 133 0.00% 62 156 0.00% 63 185 0.00% 64 227 0.00% 65 215 0.00% 66 213 0.00% 67 282 0.00% 68 301 0.00% 69 350 0.00% 70 452 0.00% 71 481 0.00% 72 615 0.00% 73 701 0.00% 74 744 0.00% 75 856 0.00% 76 947 0.01% 77 1013 0.01% 78 1190 0.01% 79 1341 0.01% 80 1486 0.01% 81 1790 0.01% 82 2203 0.01% 83 2386 0.01% 84 2756 0.02% 85 2929 0.02% 86 3185 0.02% 87 3422 0.02% 88 3748 0.02% 89 4129 0.02% 90 4561 0.02% 91 4835 0.03% 92 5579 0.03% 93 6290 0.03% 94 6974 0.04% 95 7503 0.04% 96 7745 0.04% 97 8363 0.05% 98 8730 0.05% 99 9618 0.05% 100 10057 0.05% 101 10627 0.06% 102 11636 0.06% 103 12622 0.07% 104 13480 0.07% 105 14441 0.08% 106 15023 0.08% 107 15356 0.08% 108 16102 0.09% 109 16648 0.09% 110 16992 0.09% 111 17712 0.10% 112 18940 0.10% 113 20086 0.11% 114 21273 0.12% 115 22258 0.12% 116 22258 0.12% 117 23085 0.13% 118 24009 0.13% 119 24156 0.13% 120 25066 0.14% 121 25660 0.14% 122 26630 0.15% 123 27884 0.15% 124 28997 0.16% 125 29961 0.16% 126 31182 0.17% 127 31178 0.17% 128 31390 0.17% 129 32221 0.18% 130 32768 0.18% 131 33302 0.18% 132 34378 0.19% 133 35569 0.19% 134 35759 0.20% 135 38084 0.21% 136 38245 0.21% 137 38888 0.21% 138 39379 0.22% 139 39547 0.22% 140 40031 0.22% 141 41083 0.22% 142 41794 0.23% 143 42430 0.23% 144 44033 0.24% 145 45286 0.25% 146 46133 0.25% 147 45921 0.25% 148 46187 0.25% 149 45637 0.25% 150 46800 0.26% 151 16695931 91.26% 18293909 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=21 prefix-density=0.89 prefix-fanout=2.1 sequence=ATCAGAATAGCATTTTCTTAACTTCATATCCTTGAGCGCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=29.86 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=9.9 sequence=CATCTTCTCATCA criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=17 prefix-density=0.90 prefix-fanout=2.2 sequence=AGTATGAGAAAATTAACATGTTCTCTCCAAGTGAAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=83.41 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=12.2 sequence=GTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTG SRR12919364 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:39:20 Started mapping on | Feb 12 20:39:26 Finished on | Feb 12 20:43:13 Mapping speed, Million of reads per hour | 290.12 Number of input reads | 18293909 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16895680 Uniquely mapped reads % | 92.36% Average mapped length | 296.61 Number of splices: Total | 16159484 Number of splices: Annotated (sjdb) | 15798857 Number of splices: GT/AG | 15866277 Number of splices: GC/AG | 229563 Number of splices: AT/AC | 16193 Number of splices: Non-canonical | 47451 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 506825 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 74625 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.30% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 891404 891404 891404 N_multimapping 506825 506825 506825 N_noFeature 660477 16694451 751300 N_ambiguous 253877 1023 142865 UnstrandedReadsAssigned:15981326 PositiveStrandReadsAssigned:200206 NegativeStrandReadsAssigned:16001515 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919364 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919364-trimmed-pair1.fastq SRR12919364-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,293,909 reads, 15,900,859 reads pseudoaligned [quant] estimated average fragment length: 272.703 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52401 SRR12919364.ke.tsv 34699 SRR12919364.se.tsv 87100 total ==> SRR12919364.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.3 476 19.052 Potri.005G024800.1.v4.1 1035 763.297 204 18.6805 Potri.004G059700.1.v4.1 961 689.439 42 4.25799 Potri.007G009000.2.v4.1 1416 1144.3 1 0.0610819 Potri.003G141000.2.v4.1 2943 2671.3 683.007 17.8712 Potri.016G087400.1.v4.1 270 82.0422 943.901 804.156 Potri.015G069301.1.v4.1 564 308.613 0 0 Potri.010G195200.1.v4.1 1773 1501.3 169 7.86813 Potri.012G127500.1.v4.1 977 705.392 3215 318.567 ==> SRR12919364.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 186 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 164 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 49 SRR12919364 completed mapping pipeline successfully