Starting /dee2/code/volunteer_pipeline.sh SRR12919365 current disk space = 3050884333568 free memory = 1041897892 SRR12919365 SRAfilesize 3d2c214c3e9fc0a7de16c4c4721da565 SRR12919365.sra SRR12919365.sra file validated SRR12919365 is paired end SRR12919365 is conventional basespace SRR12919365 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6415 37.0 37.0 37.0 37.0 37.0 2 36.314 37.0 37.0 37.0 37.0 37.0 3 36.6815 37.0 37.0 37.0 37.0 37.0 4 36.6 37.0 37.0 37.0 37.0 37.0 5 36.713 37.0 37.0 37.0 37.0 37.0 6 36.688 37.0 37.0 37.0 37.0 37.0 7 36.6185 37.0 37.0 37.0 37.0 37.0 8 36.636 37.0 37.0 37.0 37.0 37.0 9 36.703 37.0 37.0 37.0 37.0 37.0 10-14 36.6518 37.0 37.0 37.0 37.0 37.0 15-19 36.686800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5927 37.0 37.0 37.0 37.0 37.0 25-29 36.549600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5301 37.0 37.0 37.0 37.0 37.0 35-39 36.5156 37.0 37.0 37.0 37.0 37.0 40-44 36.5106 37.0 37.0 37.0 37.0 37.0 45-49 36.4362 37.0 37.0 37.0 37.0 37.0 50-54 36.4302 37.0 37.0 37.0 37.0 37.0 55-59 36.451299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.375600000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.3954 37.0 37.0 37.0 37.0 37.0 70-74 36.3471 37.0 37.0 37.0 37.0 37.0 75-79 36.3052 37.0 37.0 37.0 37.0 37.0 80-84 36.27759999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.1931 37.0 37.0 37.0 37.0 37.0 90-94 36.207100000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2354 37.0 37.0 37.0 37.0 37.0 100-104 36.2256 37.0 37.0 37.0 37.0 37.0 105-109 36.1553 37.0 37.0 37.0 37.0 37.0 110-114 36.0924 37.0 37.0 37.0 37.0 37.0 115-119 36.0849 37.0 37.0 37.0 37.0 37.0 120-124 36.074200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.956 37.0 37.0 37.0 37.0 37.0 130-134 35.9258 37.0 37.0 37.0 37.0 37.0 135-139 35.833600000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.744099999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.7881 37.0 37.0 37.0 37.0 37.0 150-151 35.668499999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 3.0 22 0.0 23 1.0 24 1.0 25 3.0 26 5.0 27 9.0 28 11.0 29 14.0 30 23.0 31 35.0 32 38.0 33 57.0 34 116.0 35 314.0 36 2971.0 37 397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.5 13.25 4.475 37.775 2 18.115577889447238 12.864321608040202 37.78894472361809 31.231155778894472 3 16.2 16.575 30.65 36.575 4 21.575 23.375 25.25 29.799999999999997 5 22.825 31.65 25.0 20.525 6 21.2 34.175 23.3 21.325 7 14.924999999999999 26.275 40.400000000000006 18.4 8 17.075000000000003 25.474999999999998 33.425 24.025 9 16.325 23.375 36.825 23.474999999999998 10-14 19.505 30.14 28.055000000000003 22.3 15-19 19.705000000000002 28.7 27.700000000000003 23.895 20-24 19.91 28.549999999999997 27.615000000000002 23.925 25-29 19.325 28.825 28.095 23.755000000000003 30-34 19.314999999999998 28.685 27.71 24.29 35-39 19.455 28.744999999999997 27.450000000000003 24.349999999999998 40-44 19.805 28.42 28.549999999999997 23.225 45-49 19.56 28.744999999999997 27.884999999999998 23.810000000000002 50-54 20.13 27.99 28.095 23.785 55-59 20.06 28.050000000000004 27.450000000000003 24.44 60-64 19.34 28.744999999999997 27.615000000000002 24.3 65-69 19.605 28.59 28.08 23.724999999999998 70-74 19.73 28.17 28.465 23.635 75-79 20.21 28.04 28.115000000000002 23.635 80-84 20.080000000000002 28.32 28.26 23.34 85-89 19.48 28.815 27.445000000000004 24.26 90-94 19.72 28.084999999999997 28.415000000000003 23.78 95-99 19.7 28.185 28.249999999999996 23.865 100-104 19.74 28.375 28.625 23.26 105-109 20.03 28.494999999999997 27.74 23.735 110-114 20.62 29.125 27.165 23.09 115-119 20.495 28.904999999999998 27.555000000000003 23.044999999999998 120-124 19.805 29.065 27.05 24.08 125-129 20.385 28.599999999999998 27.365000000000002 23.65 130-134 20.655 28.705000000000002 27.025 23.615 135-139 19.759999999999998 28.665000000000003 27.49 24.085 140-144 20.549999999999997 28.38 26.919999999999998 24.15 145-149 20.64 28.610000000000003 26.68 24.07 150-151 20.1875 28.925 27.487499999999997 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 2.0 26 4.5 27 7.0 28 7.0 29 16.5 30 19.5 31 24.5 32 37.0 33 37.0 34 47.5 35 75.0 36 95.0 37 108.5 38 133.5 39 161.5 40 194.0 41 230.0 42 254.0 43 270.5 44 281.5 45 268.0 46 255.5 47 263.5 48 243.0 49 201.5 50 176.0 51 141.0 52 99.5 53 85.5 54 74.5 55 52.5 56 34.0 57 24.5 58 19.0 59 16.0 60 14.5 61 7.0 62 5.5 63 3.5 64 1.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.1274856987197 84.55 2 6.91909561427404 12.7 3 0.8172160174339418 2.25 4 0.1362026695723236 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.4125 0.0 0.0 0.0 0.0 110-111 2.85 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.699999999999999 0.0 0.0 0.0 0.0 120-121 5.1625 0.0 0.0 0.0 0.0 122-123 5.5 0.0 0.0 0.0 0.0 124-125 6.0375 0.0 0.0 0.0 0.0 126-127 6.525 0.0 0.0 0.0 0.0 128-129 6.9875 0.0 0.0 0.0 0.0 130-131 7.324999999999999 0.0 0.0 0.0 0.0 132-133 7.7875 0.0 0.0 0.0 0.0 134-135 8.375 0.0 0.0 0.0 0.0 136-137 8.9875 0.0 0.0 0.0 0.0 138-139 9.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTG 10 0.006830828 145.0 5 >>END_MODULE SRR12919365 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919365_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.379 37.0 37.0 37.0 37.0 37.0 2 36.221 37.0 37.0 37.0 37.0 37.0 3 36.399 37.0 37.0 37.0 37.0 37.0 4 36.265 37.0 37.0 37.0 37.0 37.0 5 36.4 37.0 37.0 37.0 37.0 37.0 6 36.375 37.0 37.0 37.0 37.0 37.0 7 36.446 37.0 37.0 37.0 37.0 37.0 8 36.422 37.0 37.0 37.0 37.0 37.0 9 36.419 37.0 37.0 37.0 37.0 37.0 10-14 36.4143 37.0 37.0 37.0 37.0 37.0 15-19 36.3698 37.0 37.0 37.0 37.0 37.0 20-24 36.359500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.356399999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.3055 37.0 37.0 37.0 37.0 37.0 35-39 36.2924 37.0 37.0 37.0 37.0 37.0 40-44 36.2568 37.0 37.0 37.0 37.0 37.0 45-49 36.1748 37.0 37.0 37.0 37.0 37.0 50-54 36.1948 37.0 37.0 37.0 37.0 37.0 55-59 36.1863 37.0 37.0 37.0 37.0 37.0 60-64 36.1636 37.0 37.0 37.0 37.0 37.0 65-69 36.124 37.0 37.0 37.0 37.0 37.0 70-74 36.1259 37.0 37.0 37.0 37.0 37.0 75-79 36.0691 37.0 37.0 37.0 37.0 37.0 80-84 36.055099999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.0812 37.0 37.0 37.0 37.0 37.0 90-94 36.0383 37.0 37.0 37.0 37.0 37.0 95-99 35.9913 37.0 37.0 37.0 37.0 37.0 100-104 35.9844 37.0 37.0 37.0 37.0 37.0 105-109 35.9303 37.0 37.0 37.0 37.0 37.0 110-114 35.8877 37.0 37.0 37.0 37.0 37.0 115-119 35.8212 37.0 37.0 37.0 37.0 37.0 120-124 35.7873 37.0 37.0 37.0 37.0 37.0 125-129 35.7489 37.0 37.0 37.0 37.0 37.0 130-134 35.6801 37.0 37.0 37.0 37.0 37.0 135-139 35.5757 37.0 37.0 37.0 37.0 37.0 140-144 35.516799999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.4879 37.0 37.0 37.0 37.0 37.0 150-151 35.22025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 0.0 20 1.0 21 2.0 22 5.0 23 5.0 24 3.0 25 5.0 26 7.0 27 8.0 28 15.0 29 14.0 30 20.0 31 33.0 32 44.0 33 96.0 34 150.0 35 455.0 36 2759.0 37 365.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.349999999999994 27.224999999999998 8.275 23.150000000000002 2 25.825 26.775 32.75 14.649999999999999 3 21.099999999999998 27.450000000000003 33.925 17.525 4 22.625 35.75 23.625 18.0 5 24.625 36.95 21.65 16.775000000000002 6 21.349999999999998 39.35 22.925 16.375 7 19.825 23.45 38.175 18.55 8 21.325 25.7 29.849999999999998 23.125 9 23.125 24.95 29.849999999999998 22.075 10-14 23.965 29.13 26.400000000000002 20.505000000000003 15-19 23.175 28.475 28.325 20.025000000000002 20-24 23.645 27.66 27.73 20.965 25-29 22.75 28.235 28.345 20.669999999999998 30-34 22.485 28.775000000000002 28.535 20.205000000000002 35-39 22.335 28.815 28.375 20.474999999999998 40-44 22.925 27.905 28.360000000000003 20.810000000000002 45-49 22.85 27.889999999999997 28.685 20.575 50-54 23.505000000000003 28.365000000000002 28.48 19.650000000000002 55-59 23.69 28.68 27.725 19.905 60-64 23.31 28.63 27.72 20.34 65-69 23.385 28.475 27.389999999999997 20.75 70-74 23.28 28.405 27.82 20.495 75-79 23.47 28.12 28.175 20.235 80-84 23.13 28.194999999999997 28.345 20.330000000000002 85-89 23.419999999999998 28.28 28.050000000000004 20.25 90-94 23.62 27.63 28.575 20.175 95-99 23.735 27.49 28.565 20.21 100-104 23.66 28.625 27.894999999999996 19.82 105-109 24.240000000000002 27.700000000000003 28.455000000000002 19.605 110-114 23.66 28.64 27.98 19.72 115-119 24.305 28.439999999999998 26.97 20.285 120-124 24.709999999999997 28.050000000000004 27.08 20.16 125-129 24.38 28.375 28.02 19.225 130-134 24.7 28.32 27.705000000000002 19.275000000000002 135-139 25.7 27.839999999999996 26.985 19.475 140-144 25.729999999999997 28.38 26.529999999999998 19.36 145-149 26.435 28.060000000000002 26.119999999999997 19.384999999999998 150-151 27.025 28.1875 25.937500000000004 18.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 1.0 13 1.0 14 0.5 15 0.0 16 0.5 17 2.0 18 1.5 19 2.5 20 2.5 21 0.0 22 0.5 23 3.5 24 6.0 25 6.0 26 4.5 27 7.0 28 13.5 29 15.5 30 20.0 31 27.5 32 31.0 33 39.5 34 51.0 35 72.5 36 87.5 37 105.5 38 146.0 39 170.5 40 207.0 41 251.0 42 256.0 43 258.5 44 296.5 45 296.5 46 259.0 47 248.0 48 224.5 49 191.5 50 161.0 51 126.5 52 97.5 53 71.5 54 50.5 55 36.0 56 35.5 57 30.5 58 17.0 59 11.0 60 9.0 61 7.0 62 7.0 63 7.0 64 3.5 65 3.0 66 2.0 67 0.5 68 0.0 69 1.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.40816326530611 84.89999999999999 2 6.557823129251701 12.049999999999999 3 0.8435374149659863 2.325 4 0.163265306122449 0.6 5 0.027210884353741496 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.875 0.0 0.0 0.0 0.0 112-113 3.2125000000000004 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.725 0.0 0.0 0.0 0.0 120-121 5.2 0.0 0.0 0.0 0.0 122-123 5.574999999999999 0.0 0.0 0.0 0.0 124-125 6.1125 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.0625 0.0 0.0 0.0 0.0 130-131 7.4 0.0 0.0 0.0 0.0 132-133 7.8625 0.0 0.0 0.0 0.0 134-135 8.4625 0.0 0.0 0.0 0.0 136-137 9.0875 0.0 0.0 0.0 0.0 138-139 9.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 65-69 TTTTTTT 85 2.0147776E-4 13.6470585 35-39 >>END_MODULE Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793723 spots for SRR12919365.sra Written 793723 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra Read 793704 spots for SRR12919365.sra Written 793704 spots for SRR12919365.sra SRR ids: ['SRR12919365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_luay1oia SRR12919365.sra spots: 15874099 blocks: [[1, 793704], [793705, 1587408], [1587409, 2381112], [2381113, 3174816], [3174817, 3968520], [3968521, 4762224], [4762225, 5555928], [5555929, 6349632], [6349633, 7143336], [7143337, 7937040], [7937041, 8730744], [8730745, 9524448], [9524449, 10318152], [10318153, 11111856], [11111857, 11905560], [11905561, 12699264], [12699265, 13492968], [13492969, 14286672], [14286673, 15080376], [15080377, 15874099]] SRR12919365 file size 5373012 SRR12919365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919365 SRR12919365_1.fastq SRR12919365_2.fastq Input file: SRR12919365_1.fastq Paired file: SRR12919365_2.fastq trimmed: SRR12919365-trimmed-pair1.fastq, SRR12919365-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:36:42 2025 >> started Wed Feb 12 20:37:02 2025 >> done (20.860s) 15874099 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 195 ( 0.00%) empty read pairs filtered out after trimming by size control 15873882 (100.00%) read pairs available; of these: 2223019 (14.00%) trimmed read pairs available after processing 13650863 (86.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 3 0.00% 21 6 0.00% 22 5 0.00% 23 7 0.00% 24 1 0.00% 25 7 0.00% 26 6 0.00% 27 6 0.00% 28 7 0.00% 29 12 0.00% 30 9 0.00% 31 12 0.00% 32 11 0.00% 33 12 0.00% 34 13 0.00% 35 12 0.00% 36 19 0.00% 37 19 0.00% 38 21 0.00% 39 15 0.00% 40 20 0.00% 41 14 0.00% 42 17 0.00% 43 17 0.00% 44 27 0.00% 45 25 0.00% 46 29 0.00% 47 33 0.00% 48 34 0.00% 49 46 0.00% 50 48 0.00% 51 47 0.00% 52 77 0.00% 53 67 0.00% 54 78 0.00% 55 77 0.00% 56 117 0.00% 57 113 0.00% 58 147 0.00% 59 147 0.00% 60 182 0.00% 61 211 0.00% 62 271 0.00% 63 294 0.00% 64 338 0.00% 65 359 0.00% 66 436 0.00% 67 487 0.00% 68 546 0.00% 69 631 0.00% 70 829 0.01% 71 939 0.01% 72 1117 0.01% 73 1298 0.01% 74 1465 0.01% 75 1697 0.01% 76 1863 0.01% 77 2128 0.01% 78 2299 0.01% 79 2586 0.02% 80 2985 0.02% 81 3526 0.02% 82 3988 0.03% 83 4681 0.03% 84 5109 0.03% 85 5708 0.04% 86 6095 0.04% 87 6479 0.04% 88 7204 0.05% 89 7619 0.05% 90 8286 0.05% 91 9146 0.06% 92 10168 0.06% 93 11304 0.07% 94 12199 0.08% 95 13573 0.09% 96 13977 0.09% 97 14782 0.09% 98 15400 0.10% 99 16030 0.10% 100 17257 0.11% 101 17811 0.11% 102 19479 0.12% 103 20554 0.13% 104 21918 0.14% 105 23375 0.15% 106 24113 0.15% 107 24841 0.16% 108 25464 0.16% 109 26054 0.16% 110 26655 0.17% 111 27662 0.17% 112 28927 0.18% 113 30193 0.19% 114 31806 0.20% 115 33019 0.21% 116 33698 0.21% 117 34637 0.22% 118 35114 0.22% 119 35611 0.22% 120 36162 0.23% 121 37290 0.23% 122 37498 0.24% 123 38969 0.25% 124 40443 0.25% 125 41650 0.26% 126 42474 0.27% 127 42849 0.27% 128 43490 0.27% 129 44421 0.28% 130 44548 0.28% 131 45047 0.28% 132 45946 0.29% 133 46794 0.29% 134 47539 0.30% 135 48604 0.31% 136 50218 0.32% 137 50204 0.32% 138 50952 0.32% 139 51576 0.32% 140 51460 0.32% 141 51943 0.33% 142 52666 0.33% 143 52851 0.33% 144 54651 0.34% 145 54915 0.35% 146 55156 0.35% 147 56090 0.35% 148 55924 0.35% 149 56227 0.35% 150 56653 0.36% 151 13650863 86.00% 15873882 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.47 prefix-fanout=2.0 sequence=TACAGTCCCCAACAAGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTTTCTCCGATCCGAATTTCTTCCAGTTCCAAACTCCTGTGAAGGCAACAGCCTGCGGCACAGAAACATCACCTGGAACCATTGTTTTCTTATCCAAGCTTCCAGCATTCCCAAAATAGATGACTCCGTGAATGCTGAATCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=51.73 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.0 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=32 prefix-density=0.62 prefix-fanout=2.3 sequence=AGTATGAGAAAATTAACATGTTCTCTCCAAGTGAAGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=31.87 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12919365 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:37:57 Started mapping on | Feb 12 20:37:57 Finished on | Feb 12 20:40:04 Mapping speed, Million of reads per hour | 449.97 Number of input reads | 15873882 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14833575 Uniquely mapped reads % | 93.45% Average mapped length | 293.57 Number of splices: Total | 13868718 Number of splices: Annotated (sjdb) | 13531253 Number of splices: GT/AG | 13611390 Number of splices: GC/AG | 199577 Number of splices: AT/AC | 13787 Number of splices: Non-canonical | 43964 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.95 Insertion rate per base | 0.03% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399299 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 60886 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 641008 641008 641008 N_multimapping 399299 399299 399299 N_noFeature 621391 14658538 702928 N_ambiguous 199637 755 105796 UnstrandedReadsAssigned:14012547 PositiveStrandReadsAssigned:174282 NegativeStrandReadsAssigned:14024851 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919365 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919365-trimmed-pair1.fastq SRR12919365-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,873,882 reads, 14,023,161 reads pseudoaligned [quant] estimated average fragment length: 249.53 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52401 SRR12919365.ke.tsv 34699 SRR12919365.se.tsv 87100 total ==> SRR12919365.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.47 1096 51.3242 Potri.005G024800.1.v4.1 1035 786.47 247 26.0238 Potri.004G059700.1.v4.1 961 712.597 32 3.72101 Potri.007G009000.2.v4.1 1416 1167.47 1 0.0709757 Potri.003G141000.2.v4.1 2943 2694.47 766.238 23.5638 Potri.016G087400.1.v4.1 270 91.3481 1113.3 1009.88 Potri.015G069301.1.v4.1 564 329.415 0 0 Potri.010G195200.1.v4.1 1773 1524.47 132 7.17481 Potri.012G127500.1.v4.1 977 728.532 2367 269.219 ==> SRR12919365.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 119 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 114 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 22 SRR12919365 completed mapping pipeline successfully