Starting /dee2/code/volunteer_pipeline.sh SRR12919366 current disk space = 3050631839744 free memory = 1573195800 SRR12919366 SRAfilesize 245c9b92532b6d1319844e984c67ff7e SRR12919366.sra SRR12919366.sra file validated SRR12919366 is paired end SRR12919366 is conventional basespace SRR12919366 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5555 37.0 37.0 37.0 37.0 37.0 2 36.28575 37.0 37.0 37.0 37.0 37.0 3 36.6225 37.0 37.0 37.0 37.0 37.0 4 36.64 37.0 37.0 37.0 37.0 37.0 5 36.666 37.0 37.0 37.0 37.0 37.0 6 36.656 37.0 37.0 37.0 37.0 37.0 7 36.648 37.0 37.0 37.0 37.0 37.0 8 36.586 37.0 37.0 37.0 37.0 37.0 9 36.623 37.0 37.0 37.0 37.0 37.0 10-14 36.6475 37.0 37.0 37.0 37.0 37.0 15-19 36.6555 37.0 37.0 37.0 37.0 37.0 20-24 36.6138 37.0 37.0 37.0 37.0 37.0 25-29 36.5796 37.0 37.0 37.0 37.0 37.0 30-34 36.5908 37.0 37.0 37.0 37.0 37.0 35-39 36.548700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.5125 37.0 37.0 37.0 37.0 37.0 45-49 36.5115 37.0 37.0 37.0 37.0 37.0 50-54 36.515100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.450100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.418899999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.408699999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3557 37.0 37.0 37.0 37.0 37.0 75-79 36.2826 37.0 37.0 37.0 37.0 37.0 80-84 36.3471 37.0 37.0 37.0 37.0 37.0 85-89 36.2605 37.0 37.0 37.0 37.0 37.0 90-94 36.27879999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.231500000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1791 37.0 37.0 37.0 37.0 37.0 105-109 36.143299999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.0586 37.0 37.0 37.0 37.0 37.0 115-119 36.0839 37.0 37.0 37.0 37.0 37.0 120-124 36.0187 37.0 37.0 37.0 37.0 37.0 125-129 35.9546 37.0 37.0 37.0 37.0 37.0 130-134 35.9203 37.0 37.0 37.0 37.0 37.0 135-139 35.8266 37.0 37.0 37.0 37.0 37.0 140-144 35.7646 37.0 37.0 37.0 37.0 37.0 145-149 35.6614 37.0 37.0 37.0 37.0 37.0 150-151 35.454750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 5.0 26 1.0 27 10.0 28 11.0 29 15.0 30 21.0 31 24.0 32 39.0 33 62.0 34 137.0 35 316.0 36 2908.0 37 448.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.099999999999994 13.175 5.55 40.175 2 18.026613105699223 13.53251318101933 38.187296008034146 30.253577705247302 3 17.1 18.825 30.349999999999998 33.725 4 22.400000000000002 24.7 24.575 28.325 5 22.375 31.125000000000004 24.85 21.65 6 20.599999999999998 35.3 23.674999999999997 20.424999999999997 7 14.399999999999999 26.674999999999997 42.6 16.325 8 17.4 25.275 32.2 25.124999999999996 9 17.05 23.9 34.575 24.474999999999998 10-14 19.34 30.095 27.544999999999998 23.02 15-19 19.505 28.46 27.62 24.415 20-24 20.055 28.84 28.115000000000002 22.99 25-29 19.485 28.935 28.175 23.405 30-34 20.19 28.235 28.189999999999998 23.385 35-39 19.655 28.15 28.155 24.04 40-44 19.384999999999998 29.07 28.255000000000003 23.29 45-49 20.145 28.395 27.63 23.830000000000002 50-54 19.67 28.57 27.865000000000002 23.895 55-59 20.125 28.725 27.485 23.665 60-64 20.200000000000003 28.21 27.755000000000003 23.835 65-69 19.725 27.91 28.465 23.9 70-74 20.285 28.105000000000004 27.794999999999998 23.815 75-79 19.675 28.744999999999997 27.855 23.724999999999998 80-84 20.145 28.904999999999998 27.485 23.465 85-89 20.205000000000002 28.110000000000003 28.435 23.25 90-94 20.095 28.720000000000002 27.41 23.775 95-99 20.25 28.645 27.71 23.395 100-104 20.175 28.849999999999998 27.815 23.16 105-109 20.085 28.52 28.050000000000004 23.345 110-114 20.45 29.01 26.96 23.580000000000002 115-119 20.985 28.299999999999997 27.694999999999997 23.02 120-124 19.895 28.53 27.700000000000003 23.875 125-129 20.265 28.465 27.82 23.45 130-134 21.255 27.98 27.825 22.939999999999998 135-139 20.835 28.12 27.200000000000003 23.845 140-144 20.89 27.91 27.22 23.98 145-149 20.855 28.475 27.229999999999997 23.44 150-151 20.0125 28.175 27.9375 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 2.0 23 3.5 24 2.5 25 2.5 26 5.0 27 9.0 28 11.0 29 20.0 30 29.0 31 30.0 32 33.5 33 41.5 34 49.5 35 56.0 36 78.0 37 113.5 38 143.5 39 175.0 40 192.0 41 222.0 42 244.0 43 244.0 44 282.5 45 289.5 46 259.5 47 250.5 48 229.5 49 196.5 50 159.0 51 141.5 52 128.0 53 90.0 54 69.0 55 58.0 56 40.0 57 26.5 58 18.0 59 9.5 60 7.5 61 8.0 62 6.0 63 3.5 64 3.5 65 4.0 66 4.0 67 2.5 68 0.5 69 0.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.89410480349345 84.175 2 7.20524017467249 13.200000000000001 3 0.7641921397379913 2.1 4 0.10917030567685589 0.4 5 0.02729257641921397 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTGTTTCTAACACTTGATTTTGCCATTGGAGAGTATTGAGACTTGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.8625 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.4125 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 3.2625 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.6500000000000004 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.2875 0.0 0.0 0.0 0.0 122-123 4.6375 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.300000000000001 0.0 0.0 0.0 0.0 130-131 6.7 0.0 0.0 0.0 0.0 132-133 7.0 0.0 0.0 0.0 0.0 134-135 7.55 0.0 0.0 0.0 0.0 136-137 8.075 0.0 0.0 0.0 0.0 138-139 8.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGAGT 10 0.006830828 145.0 2 GCCGGAG 10 0.006830828 145.0 1 >>END_MODULE SRR12919366 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919366_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.314 37.0 37.0 37.0 37.0 37.0 2 36.1865 37.0 37.0 37.0 37.0 37.0 3 36.277 37.0 37.0 37.0 37.0 37.0 4 36.2485 37.0 37.0 37.0 37.0 37.0 5 36.4075 37.0 37.0 37.0 37.0 37.0 6 36.355 37.0 37.0 37.0 37.0 37.0 7 36.337 37.0 37.0 37.0 37.0 37.0 8 36.4675 37.0 37.0 37.0 37.0 37.0 9 36.3775 37.0 37.0 37.0 37.0 37.0 10-14 36.3919 37.0 37.0 37.0 37.0 37.0 15-19 36.3524 37.0 37.0 37.0 37.0 37.0 20-24 36.3856 37.0 37.0 37.0 37.0 37.0 25-29 36.3408 37.0 37.0 37.0 37.0 37.0 30-34 36.2966 37.0 37.0 37.0 37.0 37.0 35-39 36.2963 37.0 37.0 37.0 37.0 37.0 40-44 36.218 37.0 37.0 37.0 37.0 37.0 45-49 36.2128 37.0 37.0 37.0 37.0 37.0 50-54 36.198699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.2106 37.0 37.0 37.0 37.0 37.0 60-64 36.146300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.1371 37.0 37.0 37.0 37.0 37.0 70-74 36.1197 37.0 37.0 37.0 37.0 37.0 75-79 36.040499999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.0156 37.0 37.0 37.0 37.0 37.0 85-89 35.9876 37.0 37.0 37.0 37.0 37.0 90-94 35.9907 37.0 37.0 37.0 37.0 37.0 95-99 35.9559 37.0 37.0 37.0 37.0 37.0 100-104 35.9286 37.0 37.0 37.0 37.0 37.0 105-109 35.8756 37.0 37.0 37.0 37.0 37.0 110-114 35.785000000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.759 37.0 37.0 37.0 37.0 37.0 120-124 35.7203 37.0 37.0 37.0 37.0 37.0 125-129 35.6456 37.0 37.0 37.0 37.0 37.0 130-134 35.58 37.0 37.0 37.0 37.0 37.0 135-139 35.4213 37.0 37.0 37.0 37.0 37.0 140-144 35.4136 37.0 37.0 37.0 37.0 37.0 145-149 35.1825 37.0 37.0 37.0 27.4 37.0 150-151 35.0165 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 2.0 17 2.0 18 0.0 19 1.0 20 0.0 21 6.0 22 0.0 23 5.0 24 6.0 25 4.0 26 6.0 27 11.0 28 6.0 29 12.0 30 26.0 31 40.0 32 58.0 33 95.0 34 210.0 35 499.0 36 2709.0 37 298.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.699999999999996 24.175 9.6 25.525 2 27.474999999999998 27.500000000000004 29.525000000000002 15.5 3 19.275000000000002 29.525000000000002 33.125 18.075 4 24.0 33.2 24.55 18.25 5 24.6 37.05 21.05 17.299999999999997 6 20.424999999999997 38.1 23.75 17.724999999999998 7 20.200000000000003 21.7 38.5 19.6 8 20.849999999999998 26.525 27.825 24.8 9 21.9 24.05 29.9 24.15 10-14 22.634999999999998 29.515 26.705000000000002 21.145 15-19 23.44 27.74 28.125 20.695 20-24 22.66 28.215 28.375 20.75 25-29 22.43 28.044999999999998 28.105000000000004 21.42 30-34 22.38 28.34 28.53 20.75 35-39 22.564999999999998 28.849999999999998 28.065 20.52 40-44 22.97 28.115000000000002 28.144999999999996 20.77 45-49 23.36 28.199999999999996 28.095 20.345 50-54 23.380000000000003 27.794999999999998 28.444999999999997 20.380000000000003 55-59 23.53 28.005000000000003 28.044999999999998 20.419999999999998 60-64 23.165 28.46 28.33 20.044999999999998 65-69 23.48 28.15 28.389999999999997 19.98 70-74 23.48 27.800000000000004 28.49 20.23 75-79 23.09 28.389999999999997 28.185 20.335 80-84 23.575 28.12 28.16 20.145 85-89 23.405 28.335 27.875 20.385 90-94 23.375 28.470000000000002 27.715 20.44 95-99 24.02 28.38 27.455000000000002 20.145 100-104 24.32 28.335 27.52 19.825 105-109 24.240000000000002 27.99 27.785 19.985 110-114 24.195 28.655 27.08 20.07 115-119 23.97 28.4 27.755000000000003 19.875 120-124 24.83 28.18 27.42 19.57 125-129 24.985 28.275 27.38 19.36 130-134 25.605 27.905 27.275 19.215 135-139 25.46 28.375 26.595000000000002 19.57 140-144 25.645 28.884999999999998 26.419999999999998 19.05 145-149 26.229999999999997 28.144999999999996 26.32 19.305 150-151 25.75 27.8625 26.825 19.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.5 16 1.5 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.0 24 5.0 25 6.0 26 5.5 27 7.5 28 12.0 29 13.5 30 14.0 31 21.5 32 34.0 33 37.0 34 47.5 35 77.5 36 96.0 37 108.0 38 149.0 39 171.5 40 187.0 41 236.5 42 273.0 43 288.5 44 307.0 45 295.5 46 263.0 47 228.5 48 198.5 49 175.0 50 143.5 51 129.0 52 101.5 53 82.5 54 63.5 55 46.0 56 46.5 57 31.0 58 19.5 59 14.5 60 10.0 61 8.0 62 8.0 63 7.5 64 3.5 65 2.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.27631221104161 84.82499999999999 2 6.826217024748436 12.55 3 0.7614903453902638 2.1 4 0.10878433505575197 0.4 5 0.027196083763937992 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAACACATCTTTCACTCTCACTAGTCACTACTACTAGCCAAAAGAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.7 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.6500000000000004 0.0 0.0 0.0 0.0 118-119 4.0125 0.0 0.0 0.0 0.0 120-121 4.325 0.0 0.0 0.0 0.0 122-123 4.6875 0.0 0.0 0.0 0.0 124-125 5.1625 0.0 0.0 0.0 0.0 126-127 5.9125 0.0 0.0 0.0 0.0 128-129 6.375 0.0 0.0 0.0 0.0 130-131 6.7875 0.0 0.0 0.0 0.0 132-133 7.1 0.0 0.0 0.0 0.0 134-135 7.65 0.0 0.0 0.0 0.0 136-137 8.162500000000001 0.0 0.0 0.0 0.0 138-139 8.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAGCT 10 0.006830828 145.0 1 >>END_MODULE Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806733 spots for SRR12919366.sra Written 806733 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra Read 806717 spots for SRR12919366.sra Written 806717 spots for SRR12919366.sra SRR ids: ['SRR12919366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p0woq2qa SRR12919366.sra spots: 16134356 blocks: [[1, 806717], [806718, 1613434], [1613435, 2420151], [2420152, 3226868], [3226869, 4033585], [4033586, 4840302], [4840303, 5647019], [5647020, 6453736], [6453737, 7260453], [7260454, 8067170], [8067171, 8873887], [8873888, 9680604], [9680605, 10487321], [10487322, 11294038], [11294039, 12100755], [12100756, 12907472], [12907473, 13714189], [13714190, 14520906], [14520907, 15327623], [15327624, 16134356]] SRR12919366 file size 5461459 SRR12919366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919366 SRR12919366_1.fastq SRR12919366_2.fastq Input file: SRR12919366_1.fastq Paired file: SRR12919366_2.fastq trimmed: SRR12919366-trimmed-pair1.fastq, SRR12919366-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:41:54 2025 >> started Wed Feb 12 21:42:12 2025 >> done (17.586s) 16134356 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 586 ( 0.00%) empty read pairs filtered out after trimming by size control 16133745 (100.00%) read pairs available; of these: 2082661 (12.91%) trimmed read pairs available after processing 14051084 (87.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 7 0.00% 25 6 0.00% 26 5 0.00% 27 7 0.00% 28 7 0.00% 29 16 0.00% 30 13 0.00% 31 9 0.00% 32 9 0.00% 33 11 0.00% 34 5 0.00% 35 12 0.00% 36 8 0.00% 37 13 0.00% 38 20 0.00% 39 17 0.00% 40 21 0.00% 41 27 0.00% 42 24 0.00% 43 22 0.00% 44 30 0.00% 45 20 0.00% 46 26 0.00% 47 47 0.00% 48 45 0.00% 49 54 0.00% 50 48 0.00% 51 64 0.00% 52 79 0.00% 53 68 0.00% 54 82 0.00% 55 99 0.00% 56 103 0.00% 57 127 0.00% 58 148 0.00% 59 170 0.00% 60 199 0.00% 61 217 0.00% 62 261 0.00% 63 333 0.00% 64 338 0.00% 65 322 0.00% 66 431 0.00% 67 479 0.00% 68 532 0.00% 69 583 0.00% 70 679 0.00% 71 882 0.01% 72 987 0.01% 73 1141 0.01% 74 1249 0.01% 75 1369 0.01% 76 1459 0.01% 77 1638 0.01% 78 1787 0.01% 79 2089 0.01% 80 2413 0.01% 81 2817 0.02% 82 3299 0.02% 83 3696 0.02% 84 4106 0.03% 85 4421 0.03% 86 4933 0.03% 87 5293 0.03% 88 5726 0.04% 89 6209 0.04% 90 6837 0.04% 91 7582 0.05% 92 8715 0.05% 93 9450 0.06% 94 10437 0.06% 95 11060 0.07% 96 11740 0.07% 97 12237 0.08% 98 12922 0.08% 99 13849 0.09% 100 14838 0.09% 101 15622 0.10% 102 16775 0.10% 103 18115 0.11% 104 19326 0.12% 105 20408 0.13% 106 21337 0.13% 107 21832 0.14% 108 22356 0.14% 109 23114 0.14% 110 23640 0.15% 111 24997 0.15% 112 26271 0.16% 113 28015 0.17% 114 29041 0.18% 115 30162 0.19% 116 30970 0.19% 117 31605 0.20% 118 32343 0.20% 119 32650 0.20% 120 33362 0.21% 121 34041 0.21% 122 35248 0.22% 123 36597 0.23% 124 38176 0.24% 125 39764 0.25% 126 40556 0.25% 127 40871 0.25% 128 41022 0.25% 129 41509 0.26% 130 42114 0.26% 131 42862 0.27% 132 44136 0.27% 133 45803 0.28% 134 46520 0.29% 135 47746 0.30% 136 48289 0.30% 137 48845 0.30% 138 49214 0.31% 139 49276 0.31% 140 49506 0.31% 141 49954 0.31% 142 51072 0.32% 143 51360 0.32% 144 53425 0.33% 145 54142 0.34% 146 54744 0.34% 147 55347 0.34% 148 55741 0.35% 149 55961 0.35% 150 55843 0.35% 151 14051084 87.09% 16133745 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=8.24 fanout-score-rank=19 prefix-density=0.31 prefix-fanout=4.2 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=434.50 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=33.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=32 prefix-density=0.20 prefix-fanout=2.3 sequence=CCAGAGATGCTTAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=478.22 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=33.8 sequence=AAGAAGAAGAAG SRR12919366 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:43:05 Started mapping on | Feb 12 21:43:05 Finished on | Feb 12 21:44:40 Mapping speed, Million of reads per hour | 611.38 Number of input reads | 16133745 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14991391 Uniquely mapped reads % | 92.92% Average mapped length | 294.20 Number of splices: Total | 14098208 Number of splices: Annotated (sjdb) | 13762692 Number of splices: GT/AG | 13827565 Number of splices: GC/AG | 210499 Number of splices: AT/AC | 13610 Number of splices: Non-canonical | 46534 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 3.12 Insertion rate per base | 0.03% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376934 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 72128 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 765420 765420 765420 N_multimapping 376934 376934 376934 N_noFeature 605485 14802527 689861 N_ambiguous 191891 782 87110 UnstrandedReadsAssigned:14194015 PositiveStrandReadsAssigned:188082 NegativeStrandReadsAssigned:14214420 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919366 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919366-trimmed-pair1.fastq SRR12919366-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,133,745 reads, 14,277,283 reads pseudoaligned [quant] estimated average fragment length: 251.79 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR12919366.ke.tsv 34699 SRR12919366.se.tsv 87100 total ==> SRR12919366.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.21 476 21.1863 Potri.005G024800.1.v4.1 1035 784.21 145 14.5436 Potri.004G059700.1.v4.1 961 710.405 89 9.85418 Potri.007G009000.2.v4.1 1416 1165.21 0 0 Potri.003G141000.2.v4.1 2943 2692.21 579.534 16.9319 Potri.016G087400.1.v4.1 270 89.5019 822.622 722.945 Potri.015G069301.1.v4.1 564 328.095 0 0 Potri.010G195200.1.v4.1 1773 1522.21 59 3.0487 Potri.012G127500.1.v4.1 977 726.315 5872 635.913 ==> SRR12919366.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 184 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 19 Potri.001G452600.v4.1 1 SRR12919366 completed mapping pipeline successfully