Starting /dee2/code/volunteer_pipeline.sh SRR12919367 current disk space = 3050701565952 free memory = 1580435180 SRR12919367 SRAfilesize 58dc3620d2e4cffc322b5ccf2f750176 SRR12919367.sra SRR12919367.sra file validated SRR12919367 is paired end SRR12919367 is conventional basespace SRR12919367 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919367_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5185 37.0 37.0 37.0 37.0 37.0 2 36.26575 37.0 37.0 37.0 37.0 37.0 3 36.5185 37.0 37.0 37.0 37.0 37.0 4 36.6535 37.0 37.0 37.0 37.0 37.0 5 36.651 37.0 37.0 37.0 37.0 37.0 6 36.5685 37.0 37.0 37.0 37.0 37.0 7 36.5845 37.0 37.0 37.0 37.0 37.0 8 36.7045 37.0 37.0 37.0 37.0 37.0 9 36.606 37.0 37.0 37.0 37.0 37.0 10-14 36.641799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6275 37.0 37.0 37.0 37.0 37.0 20-24 36.6144 37.0 37.0 37.0 37.0 37.0 25-29 36.587199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5178 37.0 37.0 37.0 37.0 37.0 35-39 36.5272 37.0 37.0 37.0 37.0 37.0 40-44 36.504599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.5035 37.0 37.0 37.0 37.0 37.0 50-54 36.469800000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.466699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.385400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.4086 37.0 37.0 37.0 37.0 37.0 70-74 36.398199999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3411 37.0 37.0 37.0 37.0 37.0 80-84 36.338 37.0 37.0 37.0 37.0 37.0 85-89 36.2518 37.0 37.0 37.0 37.0 37.0 90-94 36.2967 37.0 37.0 37.0 37.0 37.0 95-99 36.2013 37.0 37.0 37.0 37.0 37.0 100-104 36.220600000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1788 37.0 37.0 37.0 37.0 37.0 110-114 36.0837 37.0 37.0 37.0 37.0 37.0 115-119 36.1581 37.0 37.0 37.0 37.0 37.0 120-124 36.0097 37.0 37.0 37.0 37.0 37.0 125-129 35.967499999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.924800000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.8577 37.0 37.0 37.0 37.0 37.0 140-144 35.7976 37.0 37.0 37.0 37.0 37.0 145-149 35.7759 37.0 37.0 37.0 37.0 37.0 150-151 35.546 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 0.0 25 2.0 26 2.0 27 5.0 28 10.0 29 25.0 30 19.0 31 33.0 32 43.0 33 64.0 34 102.0 35 318.0 36 2994.0 37 381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.8 12.975 6.625 39.6 2 20.095693779904305 12.717199697809118 35.507428859229414 31.679677663057166 3 16.575 18.224999999999998 30.425 34.775 4 20.375 26.325 24.349999999999998 28.95 5 21.425 31.2 25.474999999999998 21.9 6 20.150000000000002 35.0 23.875 20.974999999999998 7 14.025000000000002 26.825 42.325 16.825000000000003 8 16.925 25.900000000000002 31.95 25.224999999999998 9 17.675 23.974999999999998 34.275 24.075 10-14 18.94 30.564999999999998 27.08 23.415 15-19 19.134999999999998 28.915000000000003 27.82 24.13 20-24 19.88 28.655 27.905 23.56 25-29 18.955 28.71 27.905 24.43 30-34 19.994999999999997 28.799999999999997 27.389999999999997 23.815 35-39 19.145 28.465 28.310000000000002 24.08 40-44 19.545 28.96 27.42 24.075 45-49 19.3 29.154999999999998 27.455000000000002 24.09 50-54 19.975 28.804999999999996 27.534999999999997 23.685000000000002 55-59 19.515 28.945 27.095000000000002 24.445 60-64 19.345000000000002 28.720000000000002 27.894999999999996 24.04 65-69 19.605 28.64 27.860000000000003 23.895 70-74 19.82 29.125 27.865000000000002 23.189999999999998 75-79 19.68 27.87 28.46 23.990000000000002 80-84 20.005 28.51 27.785 23.7 85-89 19.335 28.660000000000004 28.025 23.98 90-94 19.634999999999998 28.535 27.779999999999998 24.05 95-99 20.28 28.285 28.09 23.345 100-104 20.185 28.735 27.605 23.474999999999998 105-109 20.72 28.515 27.744999999999997 23.02 110-114 20.21 28.294999999999998 27.845 23.65 115-119 20.32 28.544999999999998 27.51 23.625 120-124 20.505000000000003 28.405 27.224999999999998 23.865 125-129 20.49 27.92 27.605 23.985 130-134 20.285 28.860000000000003 26.950000000000003 23.905 135-139 20.724999999999998 28.199999999999996 27.779999999999998 23.294999999999998 140-144 20.65 27.93 27.150000000000002 24.27 145-149 20.995 28.95 26.51 23.544999999999998 150-151 20.474999999999998 29.0875 26.787499999999998 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 3.5 25 4.0 26 3.5 27 8.0 28 8.5 29 12.5 30 19.5 31 26.5 32 42.5 33 52.5 34 57.0 35 64.5 36 80.0 37 111.5 38 148.0 39 178.5 40 199.0 41 233.5 42 258.5 43 247.5 44 246.5 45 262.0 46 260.0 47 250.0 48 241.0 49 210.5 50 163.5 51 140.5 52 127.0 53 91.0 54 63.5 55 44.5 56 31.0 57 24.5 58 22.5 59 19.5 60 11.5 61 7.0 62 3.5 63 3.0 64 5.5 65 4.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 90.7079646017699 82.0 2 8.102876106194689 14.649999999999999 3 1.0785398230088494 2.9250000000000003 4 0.08296460176991151 0.3 5 0.02765486725663717 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAGGAACAGATAAAGAAAAAAAGAAAGTTATAGGGAAATGTACACATT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.2 0.0 0.0 0.0 0.0 132-133 5.699999999999999 0.0 0.0 0.0 0.0 134-135 6.075 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 6.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGATAC 10 0.006830828 145.0 3 CTGTAAC 10 0.006830828 145.0 6 >>END_MODULE SRR12919367 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919367_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.255 37.0 37.0 37.0 37.0 37.0 2 36.2195 37.0 37.0 37.0 37.0 37.0 3 36.3275 37.0 37.0 37.0 37.0 37.0 4 36.3965 37.0 37.0 37.0 37.0 37.0 5 36.303 37.0 37.0 37.0 37.0 37.0 6 36.4115 37.0 37.0 37.0 37.0 37.0 7 36.277 37.0 37.0 37.0 37.0 37.0 8 36.389 37.0 37.0 37.0 37.0 37.0 9 36.216 37.0 37.0 37.0 37.0 37.0 10-14 36.3512 37.0 37.0 37.0 37.0 37.0 15-19 36.2955 37.0 37.0 37.0 37.0 37.0 20-24 36.2944 37.0 37.0 37.0 37.0 37.0 25-29 36.2153 37.0 37.0 37.0 37.0 37.0 30-34 36.2355 37.0 37.0 37.0 37.0 37.0 35-39 36.222699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.134699999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1443 37.0 37.0 37.0 37.0 37.0 50-54 36.0763 37.0 37.0 37.0 37.0 37.0 55-59 36.0945 37.0 37.0 37.0 37.0 37.0 60-64 36.0832 37.0 37.0 37.0 37.0 37.0 65-69 36.03359999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.0606 37.0 37.0 37.0 37.0 37.0 75-79 35.9801 37.0 37.0 37.0 37.0 37.0 80-84 35.939099999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.89960000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.9166 37.0 37.0 37.0 37.0 37.0 95-99 35.932500000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8257 37.0 37.0 37.0 37.0 37.0 105-109 35.7975 37.0 37.0 37.0 37.0 37.0 110-114 35.8127 37.0 37.0 37.0 37.0 37.0 115-119 35.759 37.0 37.0 37.0 37.0 37.0 120-124 35.690900000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.701899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.581199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4125 37.0 37.0 37.0 37.0 37.0 140-144 35.3961 37.0 37.0 37.0 34.6 37.0 145-149 35.28679999999999 37.0 37.0 37.0 32.2 37.0 150-151 35.0945 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 4.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 5.0 23 3.0 24 12.0 25 3.0 26 5.0 27 15.0 28 17.0 29 22.0 30 22.0 31 28.0 32 51.0 33 94.0 34 204.0 35 517.0 36 2687.0 37 304.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.425 23.5 10.925 27.150000000000002 2 28.249999999999996 26.8 29.349999999999998 15.6 3 21.15 28.225 31.900000000000002 18.725 4 24.85 33.25 24.05 17.849999999999998 5 25.35 35.625 22.575 16.45 6 22.025 36.975 22.900000000000002 18.099999999999998 7 19.675 21.7 38.425 20.200000000000003 8 21.3 25.874999999999996 29.349999999999998 23.474999999999998 9 21.875 25.575 29.5 23.05 10-14 23.025000000000002 29.509999999999998 26.86 20.605 15-19 22.52 28.46 28.02 21.0 20-24 22.875 28.74 27.975 20.41 25-29 22.98 28.42 28.46 20.14 30-34 22.375 28.655 28.305000000000003 20.665 35-39 21.91 28.93 28.125 21.035 40-44 22.8 28.87 27.47 20.86 45-49 23.025000000000002 28.38 28.144999999999996 20.45 50-54 23.47 27.55 28.455000000000002 20.525 55-59 22.57 28.415000000000003 28.499999999999996 20.515 60-64 23.275000000000002 28.335 28.125 20.265 65-69 23.53 27.3 29.044999999999998 20.125 70-74 22.955000000000002 28.645 27.665 20.735 75-79 23.064999999999998 28.335 28.395 20.205000000000002 80-84 22.935 28.345 28.49 20.23 85-89 23.49 28.155 27.950000000000003 20.405 90-94 23.125 28.525 27.689999999999998 20.66 95-99 23.23 28.299999999999997 27.815 20.655 100-104 24.095 27.834999999999997 28.000000000000004 20.07 105-109 23.655 28.705000000000002 27.750000000000004 19.89 110-114 23.655 28.415000000000003 27.98 19.950000000000003 115-119 24.205 28.49 27.58 19.725 120-124 24.645 27.839999999999996 27.605 19.91 125-129 24.845 27.685 27.474999999999998 19.994999999999997 130-134 24.83 28.335 27.615000000000002 19.220000000000002 135-139 25.595000000000002 28.835 26.56 19.009999999999998 140-144 24.925 28.09 26.82 20.165 145-149 25.575 27.800000000000004 27.189999999999998 19.435 150-151 26.575 27.650000000000002 26.75 19.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 2.5 19 1.5 20 0.5 21 1.0 22 1.0 23 3.0 24 5.5 25 6.5 26 6.0 27 6.5 28 10.0 29 16.0 30 19.0 31 18.5 32 27.0 33 37.0 34 51.5 35 73.5 36 99.0 37 117.5 38 142.0 39 196.5 40 213.5 41 225.5 42 259.5 43 277.5 44 272.5 45 259.5 46 259.0 47 253.0 48 246.0 49 200.5 50 146.0 51 123.5 52 99.0 53 73.5 54 58.0 55 45.0 56 37.5 57 29.0 58 18.0 59 12.5 60 10.0 61 6.5 62 3.5 63 4.5 64 4.5 65 3.5 66 3.5 67 2.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.2242090784044 82.89999999999999 2 7.647867950481431 13.900000000000002 3 1.0178817056396148 2.775 4 0.08253094910591473 0.3 5 0.027510316368638238 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACCTTTGACCTGCTTCTTCTTCACTTTCCTCACAACAGGTTGCACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.3499999999999996 0.0 0.0 0.0 0.0 116-117 2.5875000000000004 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 3.975 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.7375 0.0 0.0 0.0 0.0 130-131 5.175 0.0 0.0 0.0 0.0 132-133 5.675000000000001 0.0 0.0 0.0 0.0 134-135 6.05 0.0 0.0 0.0 0.0 136-137 6.387499999999999 0.0 0.0 0.0 0.0 138-139 6.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCGAT 10 0.006830828 145.0 5 ATTCCTC 10 0.006830828 145.0 8 GACTATG 10 0.006830828 145.0 9 >>END_MODULE Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928659 spots for SRR12919367.sra Written 928659 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra Read 928641 spots for SRR12919367.sra Written 928641 spots for SRR12919367.sra SRR ids: ['SRR12919367.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gak64kmb SRR12919367.sra spots: 18572838 blocks: [[1, 928641], [928642, 1857282], [1857283, 2785923], [2785924, 3714564], [3714565, 4643205], [4643206, 5571846], [5571847, 6500487], [6500488, 7429128], [7429129, 8357769], [8357770, 9286410], [9286411, 10215051], [10215052, 11143692], [11143693, 12072333], [12072334, 13000974], [13000975, 13929615], [13929616, 14858256], [14858257, 15786897], [15786898, 16715538], [16715539, 17644179], [17644180, 18572838]] SRR12919367 file size 6290162 SRR12919367 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919367 SRR12919367_1.fastq SRR12919367_2.fastq Input file: SRR12919367_1.fastq Paired file: SRR12919367_2.fastq trimmed: SRR12919367-trimmed-pair1.fastq, SRR12919367-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:38:19 2025 >> started Wed Feb 12 21:38:40 2025 >> done (20.320s) 18572838 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 178 ( 0.00%) empty read pairs filtered out after trimming by size control 18572625 (100.00%) read pairs available; of these: 1760518 ( 9.48%) trimmed read pairs available after processing 16812107 (90.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 8 0.00% 21 1 0.00% 22 3 0.00% 23 2 0.00% 24 7 0.00% 25 11 0.00% 26 11 0.00% 27 8 0.00% 28 8 0.00% 29 8 0.00% 30 10 0.00% 31 9 0.00% 32 7 0.00% 33 15 0.00% 34 11 0.00% 35 13 0.00% 36 21 0.00% 37 12 0.00% 38 23 0.00% 39 18 0.00% 40 14 0.00% 41 26 0.00% 42 22 0.00% 43 20 0.00% 44 26 0.00% 45 26 0.00% 46 44 0.00% 47 35 0.00% 48 43 0.00% 49 39 0.00% 50 52 0.00% 51 35 0.00% 52 55 0.00% 53 54 0.00% 54 49 0.00% 55 66 0.00% 56 59 0.00% 57 76 0.00% 58 93 0.00% 59 103 0.00% 60 119 0.00% 61 160 0.00% 62 148 0.00% 63 165 0.00% 64 193 0.00% 65 227 0.00% 66 213 0.00% 67 273 0.00% 68 305 0.00% 69 351 0.00% 70 445 0.00% 71 520 0.00% 72 600 0.00% 73 699 0.00% 74 774 0.00% 75 843 0.00% 76 918 0.00% 77 1028 0.01% 78 1225 0.01% 79 1411 0.01% 80 1557 0.01% 81 1851 0.01% 82 2170 0.01% 83 2379 0.01% 84 2703 0.01% 85 3071 0.02% 86 3211 0.02% 87 3500 0.02% 88 3933 0.02% 89 4188 0.02% 90 4590 0.02% 91 5283 0.03% 92 6065 0.03% 93 6746 0.04% 94 7521 0.04% 95 7910 0.04% 96 8446 0.05% 97 8891 0.05% 98 9357 0.05% 99 10037 0.05% 100 10680 0.06% 101 11430 0.06% 102 12568 0.07% 103 13912 0.07% 104 14823 0.08% 105 15613 0.08% 106 16336 0.09% 107 16785 0.09% 108 17412 0.09% 109 17879 0.10% 110 18996 0.10% 111 20062 0.11% 112 20947 0.11% 113 22156 0.12% 114 23469 0.13% 115 24437 0.13% 116 25357 0.14% 117 25437 0.14% 118 26505 0.14% 119 26431 0.14% 120 27462 0.15% 121 28542 0.15% 122 29304 0.16% 123 30951 0.17% 124 32229 0.17% 125 33118 0.18% 126 34341 0.18% 127 35535 0.19% 128 34937 0.19% 129 35388 0.19% 130 35961 0.19% 131 36590 0.20% 132 38630 0.21% 133 39336 0.21% 134 40441 0.22% 135 41825 0.23% 136 43081 0.23% 137 43248 0.23% 138 43928 0.24% 139 43562 0.23% 140 44238 0.24% 141 44642 0.24% 142 46146 0.25% 143 46682 0.25% 144 48653 0.26% 145 49514 0.27% 146 50247 0.27% 147 50734 0.27% 148 51321 0.28% 149 51538 0.28% 150 51983 0.28% 151 16812107 90.52% 18572625 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=8.26 fanout-score-rank=20 prefix-density=0.32 prefix-fanout=4.3 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=446.83 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=33.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.14 prefix-fanout=2.0 sequence=TACAACATCCAGAAGGAGTCCACCCTCCACTTGGTGCTTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=653.23 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.5 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGAT SRR12919367 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:39:22 Started mapping on | Feb 12 21:39:22 Finished on | Feb 12 21:41:34 Mapping speed, Million of reads per hour | 506.53 Number of input reads | 18572625 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17282923 Uniquely mapped reads % | 93.06% Average mapped length | 296.29 Number of splices: Total | 16230095 Number of splices: Annotated (sjdb) | 15871002 Number of splices: GT/AG | 15933834 Number of splices: GC/AG | 235502 Number of splices: AT/AC | 14678 Number of splices: Non-canonical | 46081 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.03% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442795 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 39162 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 846907 846907 846907 N_multimapping 442795 442795 442795 N_noFeature 635914 17081813 723353 N_ambiguous 223118 819 109070 UnstrandedReadsAssigned:16423891 PositiveStrandReadsAssigned:200291 NegativeStrandReadsAssigned:16450500 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919367 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919367-trimmed-pair1.fastq SRR12919367-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,572,625 reads, 16,506,981 reads pseudoaligned [quant] estimated average fragment length: 271.241 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR12919367.ke.tsv 34699 SRR12919367.se.tsv 87100 total ==> SRR12919367.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.76 463 17.6555 Potri.005G024800.1.v4.1 1035 764.759 173 15.0766 Potri.004G059700.1.v4.1 961 691.001 5 0.48225 Potri.007G009000.2.v4.1 1416 1145.76 0 0 Potri.003G141000.2.v4.1 2943 2672.76 950.441 23.6999 Potri.016G087400.1.v4.1 270 83.3956 1254 1002.16 Potri.015G069301.1.v4.1 564 312.13 0 0 Potri.010G195200.1.v4.1 1773 1502.76 155 6.87422 Potri.012G127500.1.v4.1 977 706.857 9147 862.438 ==> SRR12919367.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 63 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR12919367 completed mapping pipeline successfully