Starting /dee2/code/volunteer_pipeline.sh SRR12919368 current disk space = 3050746425344 free memory = 1581998680 SRR12919368 SRAfilesize bfef151f670490b691f6896c8c8ff733 SRR12919368.sra SRR12919368.sra file validated SRR12919368 is paired end SRR12919368 is conventional basespace SRR12919368 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.615 37.0 37.0 37.0 37.0 37.0 2 36.30125 37.0 37.0 37.0 37.0 37.0 3 36.666 37.0 37.0 37.0 37.0 37.0 4 36.6175 37.0 37.0 37.0 37.0 37.0 5 36.717 37.0 37.0 37.0 37.0 37.0 6 36.653 37.0 37.0 37.0 37.0 37.0 7 36.59 37.0 37.0 37.0 37.0 37.0 8 36.668 37.0 37.0 37.0 37.0 37.0 9 36.614 37.0 37.0 37.0 37.0 37.0 10-14 36.63440000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6297 37.0 37.0 37.0 37.0 37.0 20-24 36.5821 37.0 37.0 37.0 37.0 37.0 25-29 36.512800000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4926 37.0 37.0 37.0 37.0 37.0 35-39 36.518299999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.502700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4523 37.0 37.0 37.0 37.0 37.0 50-54 36.46509999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.445800000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3856 37.0 37.0 37.0 37.0 37.0 65-69 36.3793 37.0 37.0 37.0 37.0 37.0 70-74 36.3384 37.0 37.0 37.0 37.0 37.0 75-79 36.3318 37.0 37.0 37.0 37.0 37.0 80-84 36.3077 37.0 37.0 37.0 37.0 37.0 85-89 36.283300000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2817 37.0 37.0 37.0 37.0 37.0 95-99 36.205799999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.217499999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.1833 37.0 37.0 37.0 37.0 37.0 110-114 36.10379999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.130300000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0655 37.0 37.0 37.0 37.0 37.0 125-129 36.008900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9734 37.0 37.0 37.0 37.0 37.0 135-139 35.8614 37.0 37.0 37.0 37.0 37.0 140-144 35.793 37.0 37.0 37.0 37.0 37.0 145-149 35.7573 37.0 37.0 37.0 37.0 37.0 150-151 35.44625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 5.0 25 8.0 26 5.0 27 11.0 28 6.0 29 13.0 30 18.0 31 32.0 32 44.0 33 76.0 34 105.0 35 282.0 36 2954.0 37 439.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.375 13.65 6.075 40.9 2 18.827082808960483 13.591744273848477 35.79159325446766 31.789579662723384 3 18.35 18.224999999999998 27.725 35.699999999999996 4 22.1 23.549999999999997 25.0 29.349999999999998 5 22.650000000000002 29.7 23.724999999999998 23.925 6 20.0 35.699999999999996 23.325000000000003 20.974999999999998 7 15.45 27.250000000000004 40.6 16.7 8 16.6 26.55 32.550000000000004 24.3 9 18.2 24.825 34.949999999999996 22.025 10-14 19.64 30.7 26.97 22.689999999999998 15-19 19.625 28.815 27.71 23.849999999999998 20-24 19.759999999999998 28.845 27.91 23.485 25-29 19.54 29.23 27.88 23.35 30-34 19.275000000000002 29.075 27.665 23.985 35-39 19.595000000000002 29.365000000000002 27.49 23.549999999999997 40-44 19.814999999999998 29.110000000000003 27.529999999999998 23.544999999999998 45-49 19.975 28.87 28.005000000000003 23.150000000000002 50-54 19.400000000000002 28.46 28.34 23.799999999999997 55-59 19.605 28.675 27.450000000000003 24.27 60-64 20.169999999999998 28.999999999999996 26.915 23.915 65-69 20.11 29.310000000000002 26.875 23.705000000000002 70-74 19.96 28.305000000000003 27.42 24.315 75-79 19.685 28.915000000000003 27.3 24.099999999999998 80-84 19.994999999999997 28.575 27.27 24.16 85-89 20.06 29.695 27.224999999999998 23.02 90-94 20.275000000000002 28.389999999999997 27.625 23.71 95-99 20.674999999999997 28.544999999999998 27.095000000000002 23.685000000000002 100-104 20.215 28.465 27.544999999999998 23.775 105-109 20.03 28.455000000000002 27.435 24.08 110-114 20.405 27.810000000000002 27.900000000000002 23.885 115-119 20.95 28.744999999999997 27.42 22.884999999999998 120-124 20.375 28.785 26.8 24.04 125-129 20.555 28.27 27.095000000000002 24.08 130-134 20.595 28.82 26.8 23.785 135-139 20.375 29.104999999999997 27.115000000000002 23.405 140-144 20.674999999999997 28.439999999999998 26.979999999999997 23.905 145-149 21.5 28.199999999999996 26.13 24.169999999999998 150-151 21.125 28.6375 26.2625 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 3.5 25 3.5 26 1.5 27 4.0 28 9.0 29 11.5 30 16.5 31 30.0 32 36.5 33 39.0 34 60.0 35 77.0 36 97.5 37 124.5 38 138.5 39 170.0 40 201.0 41 234.0 42 246.0 43 236.5 44 275.0 45 284.5 46 257.0 47 254.5 48 229.0 49 178.5 50 152.0 51 138.5 52 110.0 53 85.5 54 58.0 55 38.5 56 37.5 57 30.5 58 27.0 59 25.0 60 15.0 61 10.0 62 11.0 63 11.5 64 7.0 65 3.0 66 2.5 67 2.5 68 2.5 69 2.5 70 2.5 71 2.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.21844127332601 83.1 2 7.985729967069155 14.549999999999999 3 0.6860592755214051 1.875 4 0.0823271130625686 0.3 5 0.0 0.0 6 0.0 0.0 7 0.027442371020856202 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.2 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.5250000000000004 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.725 0.0 0.0 0.0 0.0 126-127 5.1875 0.0 0.0 0.0 0.0 128-129 5.7 0.0 0.0 0.0 0.0 130-131 6.275 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.449999999999999 0.0 0.0 0.0 0.0 136-137 8.175 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919368 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919368_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3205 37.0 37.0 37.0 37.0 37.0 2 36.415 37.0 37.0 37.0 37.0 37.0 3 36.4405 37.0 37.0 37.0 37.0 37.0 4 36.436 37.0 37.0 37.0 37.0 37.0 5 36.427 37.0 37.0 37.0 37.0 37.0 6 36.363 37.0 37.0 37.0 37.0 37.0 7 36.412 37.0 37.0 37.0 37.0 37.0 8 36.382 37.0 37.0 37.0 37.0 37.0 9 36.4775 37.0 37.0 37.0 37.0 37.0 10-14 36.427299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.420399999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.3971 37.0 37.0 37.0 37.0 37.0 25-29 36.341300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.2673 37.0 37.0 37.0 37.0 37.0 35-39 36.3036 37.0 37.0 37.0 37.0 37.0 40-44 36.261900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.2204 37.0 37.0 37.0 37.0 37.0 50-54 36.262299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.189099999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.173 37.0 37.0 37.0 37.0 37.0 65-69 36.128099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.1023 37.0 37.0 37.0 37.0 37.0 75-79 36.1062 37.0 37.0 37.0 37.0 37.0 80-84 36.069100000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.035900000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.0798 37.0 37.0 37.0 37.0 37.0 95-99 36.0382 37.0 37.0 37.0 37.0 37.0 100-104 35.971500000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.9683 37.0 37.0 37.0 37.0 37.0 110-114 35.923500000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.9209 37.0 37.0 37.0 37.0 37.0 120-124 35.865899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.8669 37.0 37.0 37.0 37.0 37.0 130-134 35.7311 37.0 37.0 37.0 37.0 37.0 135-139 35.5794 37.0 37.0 37.0 37.0 37.0 140-144 35.5518 37.0 37.0 37.0 37.0 37.0 145-149 35.35 37.0 37.0 37.0 37.0 37.0 150-151 35.245000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 2.0 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 0.0 21 0.0 22 8.0 23 2.0 24 3.0 25 5.0 26 10.0 27 5.0 28 15.0 29 9.0 30 13.0 31 20.0 32 57.0 33 73.0 34 171.0 35 461.0 36 2842.0 37 293.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.925 26.3 10.375 25.4 2 28.625 28.325 27.950000000000003 15.1 3 20.9 28.525 31.974999999999998 18.6 4 24.45 33.725 24.474999999999998 17.349999999999998 5 25.75 34.425 22.3 17.525 6 21.775 37.85 21.85 18.525 7 22.675 21.75 38.15 17.424999999999997 8 21.9 24.875 29.599999999999998 23.625 9 21.675 24.4 30.15 23.775 10-14 23.68 28.99 26.064999999999998 21.265 15-19 24.015 27.515 27.894999999999996 20.575 20-24 24.125 27.815 27.560000000000002 20.5 25-29 22.89 28.244999999999997 27.77 21.095 30-34 23.535 28.470000000000002 27.54 20.455000000000002 35-39 23.395 28.42 27.275 20.91 40-44 24.245 27.794999999999998 27.744999999999997 20.215 45-49 23.54 27.675 28.225 20.560000000000002 50-54 23.385 28.275 27.73 20.61 55-59 23.25 28.439999999999998 27.395000000000003 20.915 60-64 23.215 28.16 28.185 20.44 65-69 23.985 28.035 27.58 20.4 70-74 23.669999999999998 28.29 27.68 20.36 75-79 23.935000000000002 28.115000000000002 27.77 20.18 80-84 23.57 27.62 27.915 20.895 85-89 23.405 28.51 27.925 20.16 90-94 23.575 28.4 28.285 19.74 95-99 23.62 28.139999999999997 27.689999999999998 20.549999999999997 100-104 24.21 28.349999999999998 27.450000000000003 19.99 105-109 24.37 27.88 27.845 19.905 110-114 23.655 28.605000000000004 27.589999999999996 20.150000000000002 115-119 24.455 27.950000000000003 27.685 19.91 120-124 24.52 28.475 27.465 19.54 125-129 24.905 28.16 27.665 19.27 130-134 24.81 27.96 27.675 19.555 135-139 25.345000000000002 28.249999999999996 27.355 19.05 140-144 25.895000000000003 27.839999999999996 26.97 19.295 145-149 26.625 27.975 26.295 19.105 150-151 26.5 27.462500000000002 27.037499999999998 19.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.5 18 1.5 19 0.5 20 1.0 21 2.0 22 1.0 23 0.5 24 1.0 25 1.5 26 3.0 27 3.5 28 4.5 29 8.0 30 11.0 31 13.0 32 15.0 33 29.0 34 43.5 35 62.0 36 92.0 37 115.5 38 149.5 39 192.5 40 217.5 41 240.0 42 263.0 43 276.5 44 280.0 45 269.0 46 258.5 47 231.0 48 203.5 49 186.0 50 161.0 51 132.0 52 102.5 53 84.5 54 66.5 55 57.0 56 49.0 57 33.0 58 26.0 59 22.0 60 16.5 61 11.5 62 8.5 63 9.5 64 8.0 65 3.5 66 3.5 67 4.5 68 3.5 69 2.5 70 1.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.22566493007952 83.175 2 7.979160954208939 14.549999999999999 3 0.6854949273375377 1.875 4 0.10967918837400603 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.037500000000000006 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.1 0.0 0.0 0.025 0.0 82-83 0.1375 0.0 0.0 0.025 0.0 84-85 0.2125 0.0 0.0 0.025 0.0 86-87 0.3375 0.0 0.0 0.025 0.0 88-89 0.4375 0.0 0.0 0.025 0.0 90-91 0.475 0.0 0.0 0.025 0.0 92-93 0.55 0.0 0.0 0.025 0.0 94-95 0.6375 0.0 0.0 0.025 0.0 96-97 0.7625 0.0 0.0 0.025 0.0 98-99 0.975 0.0 0.0 0.025 0.0 100-101 1.1875 0.0 0.0 0.025 0.0 102-103 1.3624999999999998 0.0 0.0 0.025 0.0 104-105 1.55 0.0 0.0 0.025 0.0 106-107 1.725 0.0 0.0 0.025 0.0 108-109 1.9249999999999998 0.0 0.0 0.025 0.0 110-111 2.2249999999999996 0.0 0.0 0.025 0.0 112-113 2.5375 0.0 0.0 0.025 0.0 114-115 2.8375 0.0 0.0 0.025 0.0 116-117 3.25 0.0 0.0 0.025 0.0 118-119 3.5375 0.0 0.0 0.025 0.0 120-121 3.9125 0.0 0.0 0.025 0.0 122-123 4.2375 0.0 0.0 0.025 0.0 124-125 4.65 0.0 0.0 0.025 0.0 126-127 5.137499999999999 0.0 0.0 0.025 0.0 128-129 5.65 0.0 0.0 0.025 0.0 130-131 6.225 0.0 0.0 0.025 0.0 132-133 6.65 0.0 0.0 0.025 0.0 134-135 7.425000000000001 0.0 0.0 0.025 0.0 136-137 8.162500000000001 0.0 0.0 0.025 0.0 138-139 8.8125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTTGT 10 0.006830828 145.0 145 GGGGGGG 40 0.0076550315 18.125 140-144 >>END_MODULE Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883209 spots for SRR12919368.sra Written 883209 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra Read 883205 spots for SRR12919368.sra Written 883205 spots for SRR12919368.sra SRR ids: ['SRR12919368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_12vu_0l0 SRR12919368.sra spots: 17664104 blocks: [[1, 883205], [883206, 1766410], [1766411, 2649615], [2649616, 3532820], [3532821, 4416025], [4416026, 5299230], [5299231, 6182435], [6182436, 7065640], [7065641, 7948845], [7948846, 8832050], [8832051, 9715255], [9715256, 10598460], [10598461, 11481665], [11481666, 12364870], [12364871, 13248075], [13248076, 14131280], [14131281, 15014485], [15014486, 15897690], [15897691, 16780895], [16780896, 17664104]] SRR12919368 file size 5981334 SRR12919368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919368 SRR12919368_1.fastq SRR12919368_2.fastq Input file: SRR12919368_1.fastq Paired file: SRR12919368_2.fastq trimmed: SRR12919368-trimmed-pair1.fastq, SRR12919368-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:36:37 2025 >> started Wed Feb 12 21:36:57 2025 >> done (19.334s) 17664104 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 3585 ( 0.02%) empty read pairs filtered out after trimming by size control 17660484 (99.98%) read pairs available; of these: 2322336 (13.15%) trimmed read pairs available after processing 15338148 (86.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 8 0.00% 20 2 0.00% 21 4 0.00% 22 7 0.00% 23 2 0.00% 24 7 0.00% 25 8 0.00% 26 3 0.00% 27 1 0.00% 28 4 0.00% 29 6 0.00% 30 8 0.00% 31 10 0.00% 32 12 0.00% 33 7 0.00% 34 15 0.00% 35 15 0.00% 36 16 0.00% 37 16 0.00% 38 24 0.00% 39 20 0.00% 40 18 0.00% 41 25 0.00% 42 20 0.00% 43 29 0.00% 44 26 0.00% 45 22 0.00% 46 38 0.00% 47 412 0.00% 48 34 0.00% 49 66 0.00% 50 56 0.00% 51 67 0.00% 52 81 0.00% 53 74 0.00% 54 84 0.00% 55 114 0.00% 56 125 0.00% 57 134 0.00% 58 152 0.00% 59 195 0.00% 60 203 0.00% 61 256 0.00% 62 297 0.00% 63 345 0.00% 64 381 0.00% 65 411 0.00% 66 455 0.00% 67 484 0.00% 68 567 0.00% 69 710 0.00% 70 785 0.00% 71 876 0.00% 72 1114 0.01% 73 1354 0.01% 74 1366 0.01% 75 1576 0.01% 76 1702 0.01% 77 1864 0.01% 78 2029 0.01% 79 2433 0.01% 80 2831 0.02% 81 3029 0.02% 82 3746 0.02% 83 4144 0.02% 84 4710 0.03% 85 5254 0.03% 86 5465 0.03% 87 6024 0.03% 88 6431 0.04% 89 6975 0.04% 90 7863 0.04% 91 8764 0.05% 92 9358 0.05% 93 10551 0.06% 94 11561 0.07% 95 12341 0.07% 96 13122 0.07% 97 14065 0.08% 98 14515 0.08% 99 15545 0.09% 100 16050 0.09% 101 17374 0.10% 102 18903 0.11% 103 20047 0.11% 104 21489 0.12% 105 22954 0.13% 106 23897 0.14% 107 24295 0.14% 108 25189 0.14% 109 26116 0.15% 110 26207 0.15% 111 27673 0.16% 112 29492 0.17% 113 30501 0.17% 114 32832 0.19% 115 34152 0.19% 116 34858 0.20% 117 35129 0.20% 118 36383 0.21% 119 36472 0.21% 120 37102 0.21% 121 38697 0.22% 122 39744 0.23% 123 40878 0.23% 124 42657 0.24% 125 43448 0.25% 126 45179 0.26% 127 45550 0.26% 128 45392 0.26% 129 46518 0.26% 130 47269 0.27% 131 47558 0.27% 132 48569 0.28% 133 49683 0.28% 134 51169 0.29% 135 52868 0.30% 136 52873 0.30% 137 53533 0.30% 138 54211 0.31% 139 55522 0.31% 140 54577 0.31% 141 55937 0.32% 142 57775 0.33% 143 57430 0.33% 144 60038 0.34% 145 60810 0.34% 146 61800 0.35% 147 61720 0.35% 148 62228 0.35% 149 61940 0.35% 150 62179 0.35% 151 15338148 86.85% 17660484 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=27 prefix-density=1.00 prefix-fanout=2.0 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=16.12 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=GTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAAGTTA criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=22 prefix-density=0.66 prefix-fanout=2.0 sequence=TGTCAAATGAAAAGCTCTTCGTGGTGTTCCAAGGTGTTTCAAATGTAGCTGGTGAAACAAGTTCAGACTCTGGAGTTAGCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=39.30 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.0 sequence=CACAAAGCAGTTGCATTTATCTAAAGTATTGTCACTTTACTTAACACTTGAGCT SRR12919368 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:37:43 Started mapping on | Feb 12 21:37:44 Finished on | Feb 12 21:41:04 Mapping speed, Million of reads per hour | 317.89 Number of input reads | 17660484 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15594303 Uniquely mapped reads % | 88.30% Average mapped length | 294.50 Number of splices: Total | 13750045 Number of splices: Annotated (sjdb) | 13393890 Number of splices: GT/AG | 13495837 Number of splices: GC/AG | 196906 Number of splices: AT/AC | 14255 Number of splices: Non-canonical | 43047 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.03% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 479895 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 217498 % of reads mapped to too many loci | 1.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.47% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1586286 1586286 1586286 N_multimapping 479895 479895 479895 N_noFeature 488247 15372264 574170 N_ambiguous 240215 1063 103623 UnstrandedReadsAssigned:14865841 PositiveStrandReadsAssigned:220976 NegativeStrandReadsAssigned:14916510 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919368 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919368-trimmed-pair1.fastq SRR12919368-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,660,484 reads, 15,062,374 reads pseudoaligned [quant] estimated average fragment length: 245.06 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR12919368.ke.tsv 34699 SRR12919368.se.tsv 87100 total ==> SRR12919368.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.94 549 21.1179 Potri.005G024800.1.v4.1 1035 790.94 246 21.2231 Potri.004G059700.1.v4.1 961 717.04 15 1.42746 Potri.007G009000.2.v4.1 1416 1171.94 0 0 Potri.003G141000.2.v4.1 2943 2698.94 611.304 15.4554 Potri.016G087400.1.v4.1 270 87.5028 1510 1177.53 Potri.015G069301.1.v4.1 564 329.235 0 0 Potri.010G195200.1.v4.1 1773 1528.94 188 8.39043 Potri.012G127500.1.v4.1 977 733.013 1664 154.902 ==> SRR12919368.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 91 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 137 SRR12919368 completed mapping pipeline successfully