Starting /dee2/code/volunteer_pipeline.sh SRR12919369 current disk space = 3050846576640 free memory = 1512930328 SRR12919369 SRAfilesize 9b2255c5ad6f6f825f69f5871b7148ad SRR12919369.sra SRR12919369.sra file validated SRR12919369 is paired end SRR12919369 is conventional basespace SRR12919369 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5155 37.0 37.0 37.0 37.0 37.0 2 36.23175 37.0 37.0 37.0 37.0 37.0 3 36.625 37.0 37.0 37.0 37.0 37.0 4 36.6605 37.0 37.0 37.0 37.0 37.0 5 36.639 37.0 37.0 37.0 37.0 37.0 6 36.5925 37.0 37.0 37.0 37.0 37.0 7 36.6165 37.0 37.0 37.0 37.0 37.0 8 36.7215 37.0 37.0 37.0 37.0 37.0 9 36.655 37.0 37.0 37.0 37.0 37.0 10-14 36.6498 37.0 37.0 37.0 37.0 37.0 15-19 36.6767 37.0 37.0 37.0 37.0 37.0 20-24 36.626400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5856 37.0 37.0 37.0 37.0 37.0 30-34 36.5508 37.0 37.0 37.0 37.0 37.0 35-39 36.545 37.0 37.0 37.0 37.0 37.0 40-44 36.508599999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.49720000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.482600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.492599999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4353 37.0 37.0 37.0 37.0 37.0 65-69 36.3986 37.0 37.0 37.0 37.0 37.0 70-74 36.3938 37.0 37.0 37.0 37.0 37.0 75-79 36.3728 37.0 37.0 37.0 37.0 37.0 80-84 36.376099999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.2783 37.0 37.0 37.0 37.0 37.0 90-94 36.271300000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2667 37.0 37.0 37.0 37.0 37.0 100-104 36.2352 37.0 37.0 37.0 37.0 37.0 105-109 36.1826 37.0 37.0 37.0 37.0 37.0 110-114 36.19539999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.1416 37.0 37.0 37.0 37.0 37.0 120-124 36.122 37.0 37.0 37.0 37.0 37.0 125-129 35.9885 37.0 37.0 37.0 37.0 37.0 130-134 35.9572 37.0 37.0 37.0 37.0 37.0 135-139 35.875699999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.7536 37.0 37.0 37.0 37.0 37.0 145-149 35.771300000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.62675 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 3.0 25 2.0 26 4.0 27 4.0 28 10.0 29 16.0 30 22.0 31 28.0 32 29.0 33 63.0 34 117.0 35 309.0 36 2987.0 37 405.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.225 13.725000000000001 6.4750000000000005 42.575 2 18.90259249937075 13.9441228290964 37.981374276365464 29.171910395167377 3 18.35 18.0 31.775 31.874999999999996 4 21.425 26.35 24.45 27.775 5 21.425 33.5 24.85 20.225 6 19.5 34.949999999999996 25.1 20.45 7 14.475 26.75 41.9 16.875 8 16.8 26.200000000000003 31.324999999999996 25.674999999999997 9 16.275000000000002 25.124999999999996 34.8 23.799999999999997 10-14 19.705000000000002 29.409999999999997 27.595 23.29 15-19 19.41 28.335 27.534999999999997 24.72 20-24 19.89 28.225 28.155 23.73 25-29 19.225 29.615000000000002 28.22 22.939999999999998 30-34 19.465 28.67 27.91 23.955000000000002 35-39 19.82 28.415000000000003 27.925 23.84 40-44 19.259999999999998 29.375 27.76 23.605 45-49 19.689999999999998 28.860000000000003 27.800000000000004 23.65 50-54 19.59 28.73 27.705000000000002 23.974999999999998 55-59 19.765 28.88 27.99 23.365 60-64 19.919999999999998 28.349999999999998 27.68 24.05 65-69 20.035 28.78 27.13 24.055 70-74 19.96 28.465 27.79 23.785 75-79 19.965 28.044999999999998 27.88 24.11 80-84 20.16 28.89 27.639999999999997 23.31 85-89 20.055 29.04 27.3 23.605 90-94 20.555 28.48 27.41 23.555 95-99 20.645 28.835 27.32 23.200000000000003 100-104 20.075000000000003 28.825 27.67 23.43 105-109 20.415 27.82 27.794999999999998 23.97 110-114 20.560000000000002 28.405 27.794999999999998 23.24 115-119 20.29 28.395 27.950000000000003 23.365 120-124 20.415 28.050000000000004 27.62 23.915 125-129 21.26 28.044999999999998 27.465 23.23 130-134 20.91 28.715000000000003 27.0 23.375 135-139 20.825 28.225 26.955000000000002 23.995 140-144 21.015 28.09 26.875 24.02 145-149 20.635 28.925 26.745 23.695 150-151 21.175 27.8375 27.0125 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 0.5 25 2.5 26 6.0 27 8.5 28 10.0 29 12.5 30 16.5 31 28.5 32 40.5 33 53.5 34 66.5 35 75.5 36 81.5 37 99.0 38 126.5 39 156.0 40 200.5 41 245.0 42 257.5 43 265.0 44 270.0 45 281.5 46 284.5 47 240.0 48 215.5 49 201.5 50 173.0 51 134.0 52 97.5 53 75.5 54 62.0 55 52.5 56 37.0 57 30.5 58 23.0 59 15.5 60 12.5 61 11.5 62 11.0 63 5.0 64 3.5 65 2.5 66 1.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.96185737976784 82.27499999999999 2 7.822001105583196 14.149999999999999 3 0.9397457158651189 2.55 4 0.24875621890547264 0.8999999999999999 5 0.027639579878385848 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTGAGAATCAAGAGTGACAACATAGAGAGACAAGCATAGTAATTCATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.2750000000000004 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.824999999999999 0.0 0.0 0.0 0.0 130-131 5.324999999999999 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.2375 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCATT 10 0.006830828 145.0 7 >>END_MODULE SRR12919369 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919369_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1445 37.0 37.0 37.0 37.0 37.0 2 36.1385 37.0 37.0 37.0 37.0 37.0 3 36.2365 37.0 37.0 37.0 37.0 37.0 4 36.243 37.0 37.0 37.0 37.0 37.0 5 36.195 37.0 37.0 37.0 37.0 37.0 6 36.2525 37.0 37.0 37.0 37.0 37.0 7 36.2255 37.0 37.0 37.0 37.0 37.0 8 36.2735 37.0 37.0 37.0 37.0 37.0 9 36.369 37.0 37.0 37.0 37.0 37.0 10-14 36.2906 37.0 37.0 37.0 37.0 37.0 15-19 36.25619999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2103 37.0 37.0 37.0 37.0 37.0 25-29 36.2029 37.0 37.0 37.0 37.0 37.0 30-34 36.1483 37.0 37.0 37.0 37.0 37.0 35-39 36.2025 37.0 37.0 37.0 37.0 37.0 40-44 36.129799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0484 37.0 37.0 37.0 37.0 37.0 50-54 36.0991 37.0 37.0 37.0 37.0 37.0 55-59 36.0509 37.0 37.0 37.0 37.0 37.0 60-64 36.012299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.0287 37.0 37.0 37.0 37.0 37.0 70-74 35.9892 37.0 37.0 37.0 37.0 37.0 75-79 35.9307 37.0 37.0 37.0 37.0 37.0 80-84 35.915600000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8885 37.0 37.0 37.0 37.0 37.0 90-94 35.8326 37.0 37.0 37.0 37.0 37.0 95-99 35.8312 37.0 37.0 37.0 37.0 37.0 100-104 35.75860000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.746300000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.760000000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.7089 37.0 37.0 37.0 37.0 37.0 120-124 35.6571 37.0 37.0 37.0 37.0 37.0 125-129 35.5652 37.0 37.0 37.0 37.0 37.0 130-134 35.461 37.0 37.0 37.0 37.0 37.0 135-139 35.317499999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.3067 37.0 37.0 37.0 32.2 37.0 145-149 35.1268 37.0 37.0 37.0 27.4 37.0 150-151 34.95575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 2.0 16 0.0 17 1.0 18 0.0 19 0.0 20 0.0 21 2.0 22 0.0 23 8.0 24 2.0 25 12.0 26 6.0 27 15.0 28 12.0 29 15.0 30 32.0 31 50.0 32 55.0 33 123.0 34 229.0 35 616.0 36 2562.0 37 256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.225 24.925 9.975000000000001 27.875 2 29.225 25.724999999999998 30.95 14.099999999999998 3 19.950000000000003 28.325 33.525 18.2 4 22.85 34.699999999999996 24.275 18.175 5 24.075 36.825 21.525 17.575 6 20.5 39.375 22.5 17.625 7 20.9 21.475 38.45 19.175 8 20.925 25.575 28.025 25.474999999999998 9 20.925 25.6 29.9 23.575 10-14 22.965 29.060000000000002 26.91 21.065 15-19 23.855 27.560000000000002 28.08 20.505000000000003 20-24 23.005 28.810000000000002 27.325 20.86 25-29 23.22 28.57 27.650000000000002 20.560000000000002 30-34 22.845 28.294999999999998 28.29 20.57 35-39 23.044999999999998 28.79 27.639999999999997 20.525 40-44 23.23 28.355000000000004 27.96 20.455000000000002 45-49 23.53 27.775 27.589999999999996 21.105 50-54 22.919999999999998 28.735 27.950000000000003 20.395 55-59 23.07 28.375 28.42 20.135 60-64 23.625 27.825 27.605 20.945 65-69 23.105 27.985 28.275 20.635 70-74 23.575 28.22 27.834999999999997 20.369999999999997 75-79 23.05 27.96 27.939999999999998 21.05 80-84 23.125 28.77 27.55 20.555 85-89 23.674999999999997 28.255000000000003 27.765 20.305 90-94 23.35 28.115000000000002 27.665 20.87 95-99 23.54 27.99 27.71 20.76 100-104 23.855 28.249999999999996 27.43 20.465 105-109 22.985 27.884999999999998 28.185 20.945 110-114 23.990000000000002 28.51 27.6 19.900000000000002 115-119 24.27 28.235 27.07 20.424999999999997 120-124 23.935000000000002 28.645 27.29 20.13 125-129 24.075 28.355000000000004 27.37 20.200000000000003 130-134 25.380000000000003 28.23 26.834999999999997 19.555 135-139 24.585 28.470000000000002 27.27 19.675 140-144 25.0 28.09 27.195000000000004 19.715 145-149 25.0 28.285 26.935 19.78 150-151 25.25 27.200000000000003 27.187499999999996 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 4.5 25 6.0 26 5.0 27 5.5 28 6.5 29 11.0 30 14.0 31 20.5 32 25.0 33 29.0 34 46.5 35 66.0 36 84.0 37 105.0 38 136.0 39 171.0 40 211.5 41 242.0 42 259.5 43 275.5 44 286.5 45 289.5 46 281.0 47 262.5 48 225.5 49 193.5 50 158.5 51 120.0 52 98.5 53 86.0 54 69.5 55 53.5 56 38.0 57 28.5 58 23.5 59 14.0 60 9.5 61 8.0 62 6.0 63 2.5 64 2.5 65 2.0 66 2.0 67 4.0 68 2.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.8 #Duplication Level Percentage of deduplicated Percentage of total 1 91.24449339207048 82.85 2 7.654185022026431 13.900000000000002 3 0.8535242290748899 2.325 4 0.22026431718061676 0.8 5 0.027533039647577095 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATCTGTTATAACGCCAACAATCAACGGATCTGACACTATTTTTCGCCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.2750000000000004 0.0 0.0 0.0 0.0 122-123 3.7125000000000004 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.4375 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.35 0.0 0.0 0.0 0.0 132-133 5.7375 0.0 0.0 0.0 0.0 134-135 6.2375 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTAA 10 0.006830828 145.0 2 TTCTAAA 10 0.006830828 145.0 3 >>END_MODULE Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193082 spots for SRR12919369.sra Written 1193082 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra Read 1193080 spots for SRR12919369.sra Written 1193080 spots for SRR12919369.sra SRR ids: ['SRR12919369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9ji80wlc SRR12919369.sra spots: 23861602 blocks: [[1, 1193080], [1193081, 2386160], [2386161, 3579240], [3579241, 4772320], [4772321, 5965400], [5965401, 7158480], [7158481, 8351560], [8351561, 9544640], [9544641, 10737720], [10737721, 11930800], [11930801, 13123880], [13123881, 14316960], [14316961, 15510040], [15510041, 16703120], [16703121, 17896200], [17896201, 19089280], [19089281, 20282360], [20282361, 21475440], [21475441, 22668520], [22668521, 23861602]] SRR12919369 file size 8087515 SRR12919369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919369 SRR12919369_1.fastq SRR12919369_2.fastq Input file: SRR12919369_1.fastq Paired file: SRR12919369_2.fastq trimmed: SRR12919369-trimmed-pair1.fastq, SRR12919369-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:20:31 2025 >> started Wed Feb 12 21:21:00 2025 >> done (29.511s) 23861602 read pairs processed; of these: 54 ( 0.00%) short read pairs filtered out after trimming by size control 101 ( 0.00%) empty read pairs filtered out after trimming by size control 23861447 (100.00%) read pairs available; of these: 3064794 (12.84%) trimmed read pairs available after processing 20796653 (87.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 7 0.00% 21 6 0.00% 22 12 0.00% 23 7 0.00% 24 14 0.00% 25 15 0.00% 26 11 0.00% 27 9 0.00% 28 16 0.00% 29 12 0.00% 30 25 0.00% 31 15 0.00% 32 17 0.00% 33 7 0.00% 34 21 0.00% 35 33 0.00% 36 27 0.00% 37 35 0.00% 38 27 0.00% 39 25 0.00% 40 21 0.00% 41 27 0.00% 42 47 0.00% 43 29 0.00% 44 39 0.00% 45 34 0.00% 46 31 0.00% 47 55 0.00% 48 51 0.00% 49 68 0.00% 50 68 0.00% 51 83 0.00% 52 97 0.00% 53 123 0.00% 54 105 0.00% 55 133 0.00% 56 135 0.00% 57 153 0.00% 58 163 0.00% 59 191 0.00% 60 273 0.00% 61 312 0.00% 62 343 0.00% 63 378 0.00% 64 405 0.00% 65 455 0.00% 66 484 0.00% 67 559 0.00% 68 612 0.00% 69 769 0.00% 70 967 0.00% 71 1092 0.00% 72 1414 0.01% 73 1648 0.01% 74 1810 0.01% 75 1908 0.01% 76 2120 0.01% 77 2346 0.01% 78 2598 0.01% 79 2986 0.01% 80 3484 0.01% 81 4189 0.02% 82 5053 0.02% 83 5733 0.02% 84 6279 0.03% 85 6711 0.03% 86 7104 0.03% 87 7598 0.03% 88 8184 0.03% 89 8970 0.04% 90 10291 0.04% 91 11758 0.05% 92 13394 0.06% 93 15023 0.06% 94 16184 0.07% 95 17352 0.07% 96 18068 0.08% 97 18502 0.08% 98 19369 0.08% 99 20367 0.09% 100 22183 0.09% 101 24059 0.10% 102 26283 0.11% 103 29169 0.12% 104 30955 0.13% 105 31878 0.13% 106 33087 0.14% 107 33275 0.14% 108 33840 0.14% 109 34620 0.15% 110 35735 0.15% 111 37860 0.16% 112 40729 0.17% 113 43083 0.18% 114 45574 0.19% 115 47182 0.20% 116 47368 0.20% 117 47779 0.20% 118 47543 0.20% 119 48320 0.20% 120 49092 0.21% 121 50794 0.21% 122 52753 0.22% 123 56357 0.24% 124 58343 0.24% 125 60197 0.25% 126 61027 0.26% 127 61898 0.26% 128 60769 0.25% 129 60556 0.25% 130 61044 0.26% 131 61646 0.26% 132 63617 0.27% 133 66117 0.28% 134 68877 0.29% 135 70430 0.30% 136 71672 0.30% 137 70864 0.30% 138 70367 0.29% 139 70204 0.29% 140 69574 0.29% 141 70028 0.29% 142 71590 0.30% 143 73506 0.31% 144 76381 0.32% 145 78093 0.33% 146 78169 0.33% 147 78696 0.33% 148 77824 0.33% 149 77242 0.32% 150 77448 0.32% 151 20796653 87.16% 23861447 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=7.12 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=2.6 sequence=TCCTTCTGGATGTTGTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=468.12 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=34.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=39 prefix-density=0.13 prefix-fanout=2.0 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=570.62 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=20.9 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCG SRR12919369 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:21:45 Started mapping on | Feb 12 21:21:46 Finished on | Feb 12 21:24:53 Mapping speed, Million of reads per hour | 459.36 Number of input reads | 23861447 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 22215484 Uniquely mapped reads % | 93.10% Average mapped length | 294.15 Number of splices: Total | 20515791 Number of splices: Annotated (sjdb) | 20029412 Number of splices: GT/AG | 20125319 Number of splices: GC/AG | 300470 Number of splices: AT/AC | 19428 Number of splices: Non-canonical | 70574 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.03% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 613911 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 83250 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.85% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1032052 1032052 1032052 N_multimapping 613911 613911 613911 N_noFeature 882876 21903300 1019597 N_ambiguous 313639 1463 137395 UnstrandedReadsAssigned:21018969 PositiveStrandReadsAssigned:310721 NegativeStrandReadsAssigned:21058492 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919369 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919369-trimmed-pair1.fastq SRR12919369-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,861,447 reads, 21,161,515 reads pseudoaligned [quant] estimated average fragment length: 263.803 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR12919369.ke.tsv 34699 SRR12919369.se.tsv 87100 total ==> SRR12919369.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.2 840 23.6533 Potri.005G024800.1.v4.1 1035 772.197 185 11.8408 Potri.004G059700.1.v4.1 961 698.41 61 4.31676 Potri.007G009000.2.v4.1 1416 1153.2 0 0 Potri.003G141000.2.v4.1 2943 2680.2 1180 21.7597 Potri.016G087400.1.v4.1 270 90.6171 1767 963.751 Potri.015G069301.1.v4.1 564 321.22 0 0 Potri.010G195200.1.v4.1 1773 1510.2 210 6.87265 Potri.012G127500.1.v4.1 977 714.302 10254 709.495 ==> SRR12919369.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 228 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 347 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 76 Potri.001G452600.v4.1 1 SRR12919369 completed mapping pipeline successfully