Starting /dee2/code/volunteer_pipeline.sh SRR12919370 current disk space = 3050613755904 free memory = 1575827216 SRR12919370 SRAfilesize 8c1bd4a12d8b991d23f406b92825db17 SRR12919370.sra SRR12919370.sra file validated SRR12919370 is paired end SRR12919370 is conventional basespace SRR12919370 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.589 37.0 37.0 37.0 37.0 37.0 2 36.36625 37.0 37.0 37.0 37.0 37.0 3 36.6955 37.0 37.0 37.0 37.0 37.0 4 36.6885 37.0 37.0 37.0 37.0 37.0 5 36.7035 37.0 37.0 37.0 37.0 37.0 6 36.7385 37.0 37.0 37.0 37.0 37.0 7 36.71 37.0 37.0 37.0 37.0 37.0 8 36.7575 37.0 37.0 37.0 37.0 37.0 9 36.72 37.0 37.0 37.0 37.0 37.0 10-14 36.701499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.693900000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.683400000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.5807 37.0 37.0 37.0 37.0 37.0 30-34 36.625899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.59000000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.5548 37.0 37.0 37.0 37.0 37.0 45-49 36.5538 37.0 37.0 37.0 37.0 37.0 50-54 36.4839 37.0 37.0 37.0 37.0 37.0 55-59 36.501599999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4442 37.0 37.0 37.0 37.0 37.0 65-69 36.465199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.423700000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.362 37.0 37.0 37.0 37.0 37.0 80-84 36.3514 37.0 37.0 37.0 37.0 37.0 85-89 36.3074 37.0 37.0 37.0 37.0 37.0 90-94 36.277 37.0 37.0 37.0 37.0 37.0 95-99 36.2693 37.0 37.0 37.0 37.0 37.0 100-104 36.2068 37.0 37.0 37.0 37.0 37.0 105-109 36.2278 37.0 37.0 37.0 37.0 37.0 110-114 36.117000000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1909 37.0 37.0 37.0 37.0 37.0 120-124 36.1229 37.0 37.0 37.0 37.0 37.0 125-129 36.0846 37.0 37.0 37.0 37.0 37.0 130-134 36.0015 37.0 37.0 37.0 37.0 37.0 135-139 35.900800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7984 37.0 37.0 37.0 37.0 37.0 145-149 35.8938 37.0 37.0 37.0 37.0 37.0 150-151 35.6525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 4.0 24 1.0 25 1.0 26 1.0 27 7.0 28 7.0 29 10.0 30 20.0 31 24.0 32 41.0 33 56.0 34 108.0 35 298.0 36 2955.0 37 466.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.35 11.799999999999999 7.025 41.825 2 18.804920913884008 13.557619884509165 37.63494853125785 30.002510670348983 3 17.025000000000002 17.95 28.249999999999996 36.775000000000006 4 19.875 25.525 25.45 29.15 5 23.225 29.25 26.125 21.4 6 20.200000000000003 33.825 24.3 21.675 7 15.25 28.000000000000004 41.949999999999996 14.799999999999999 8 17.575 25.900000000000002 33.0 23.525 9 17.849999999999998 23.25 34.949999999999996 23.95 10-14 19.55 29.665000000000003 28.115000000000002 22.67 15-19 19.005 28.33 28.83 23.835 20-24 19.39 28.975 27.775 23.86 25-29 19.555 28.475 28.335 23.635 30-34 19.695 29.325000000000003 27.675 23.305 35-39 19.45 29.125 27.98 23.445 40-44 19.375 28.705000000000002 28.21 23.71 45-49 20.25 28.305000000000003 27.91 23.535 50-54 19.12 28.425 28.1 24.355 55-59 19.655 28.89 27.845 23.61 60-64 19.145 28.26 28.810000000000002 23.785 65-69 19.505 28.57 28.17 23.755000000000003 70-74 19.665 28.655 27.884999999999998 23.794999999999998 75-79 19.885 28.59 27.525 24.0 80-84 19.794999999999998 28.59 27.735 23.880000000000003 85-89 19.81 28.384999999999998 28.03 23.775 90-94 19.895 27.525 28.095 24.485 95-99 19.685 28.53 28.305000000000003 23.48 100-104 19.435 28.605000000000004 28.015 23.945 105-109 20.175 27.785 28.125 23.915 110-114 19.794999999999998 28.62 28.349999999999998 23.235 115-119 19.96 28.22 27.450000000000003 24.37 120-124 20.24 27.860000000000003 28.43 23.47 125-129 20.11 28.470000000000002 28.075 23.345 130-134 20.06 28.389999999999997 27.725 23.825 135-139 20.355 28.355000000000004 27.67 23.62 140-144 20.549999999999997 27.965 27.700000000000003 23.785 145-149 20.75 28.505000000000003 26.810000000000002 23.935000000000002 150-151 20.6625 27.437499999999996 27.237499999999997 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.5 23 2.5 24 5.5 25 5.5 26 3.5 27 7.0 28 11.5 29 18.0 30 27.5 31 28.5 32 32.0 33 43.0 34 56.0 35 76.0 36 96.5 37 118.5 38 134.5 39 145.5 40 181.5 41 236.0 42 264.0 43 270.0 44 281.0 45 293.0 46 286.0 47 249.5 48 217.5 49 181.0 50 142.0 51 128.5 52 111.5 53 81.0 54 54.5 55 46.5 56 38.5 57 25.0 58 21.5 59 16.5 60 13.0 61 11.5 62 8.0 63 7.0 64 5.5 65 5.5 66 2.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.87124931805782 84.2 2 7.201309328968904 13.200000000000001 3 0.872885979268958 2.4 4 0.05455537370430987 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.0250000000000004 0.0 0.0 0.0 0.0 124-125 3.2750000000000004 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 5.025 0.0 0.0 0.0 0.0 134-135 5.45 0.0 0.0 0.0 0.0 136-137 5.824999999999999 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAATAC 10 0.006830828 145.0 8 GCCATTA 10 0.006830828 145.0 2 >>END_MODULE SRR12919370 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919370_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.251 37.0 37.0 37.0 37.0 37.0 2 36.2815 37.0 37.0 37.0 37.0 37.0 3 36.3545 37.0 37.0 37.0 37.0 37.0 4 36.4025 37.0 37.0 37.0 37.0 37.0 5 36.3695 37.0 37.0 37.0 37.0 37.0 6 36.3805 37.0 37.0 37.0 37.0 37.0 7 36.302 37.0 37.0 37.0 37.0 37.0 8 36.386 37.0 37.0 37.0 37.0 37.0 9 36.4345 37.0 37.0 37.0 37.0 37.0 10-14 36.347899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.344 37.0 37.0 37.0 37.0 37.0 20-24 36.3232 37.0 37.0 37.0 37.0 37.0 25-29 36.2871 37.0 37.0 37.0 37.0 37.0 30-34 36.25749999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.2536 37.0 37.0 37.0 37.0 37.0 40-44 36.1811 37.0 37.0 37.0 37.0 37.0 45-49 36.14450000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.1698 37.0 37.0 37.0 37.0 37.0 55-59 36.1323 37.0 37.0 37.0 37.0 37.0 60-64 36.1207 37.0 37.0 37.0 37.0 37.0 65-69 36.06229999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.0775 37.0 37.0 37.0 37.0 37.0 75-79 36.0198 37.0 37.0 37.0 37.0 37.0 80-84 36.011900000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.9971 37.0 37.0 37.0 37.0 37.0 90-94 35.8333 37.0 37.0 37.0 37.0 37.0 95-99 35.9383 37.0 37.0 37.0 37.0 37.0 100-104 35.866699999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.8236 37.0 37.0 37.0 37.0 37.0 110-114 35.82690000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.820100000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.72189999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.700900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.6094 37.0 37.0 37.0 37.0 37.0 135-139 35.470600000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.448899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.375800000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.17375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 3.0 16 1.0 17 4.0 18 0.0 19 0.0 20 3.0 21 5.0 22 2.0 23 5.0 24 5.0 25 5.0 26 6.0 27 5.0 28 12.0 29 15.0 30 21.0 31 29.0 32 49.0 33 90.0 34 178.0 35 552.0 36 2738.0 37 268.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.2 25.025 9.425 27.35 2 28.325 25.3 30.099999999999998 16.275000000000002 3 18.8 30.175 31.674999999999997 19.35 4 23.425 34.849999999999994 24.15 17.575 5 24.7 36.55 21.625 17.125 6 21.325 39.900000000000006 21.525 17.25 7 20.075000000000003 23.025000000000002 37.375 19.525000000000002 8 20.849999999999998 26.85 28.575 23.724999999999998 9 21.825 24.575 30.65 22.95 10-14 23.724999999999998 28.935 27.13 20.21 15-19 23.53 27.98 28.18 20.31 20-24 22.805 29.035 27.889999999999997 20.27 25-29 23.825 28.865000000000002 27.49 19.82 30-34 23.53 28.99 27.675 19.805 35-39 23.435 28.77 27.525 20.27 40-44 23.330000000000002 28.415000000000003 27.785 20.47 45-49 22.919999999999998 28.21 28.09 20.78 50-54 23.26 28.544999999999998 27.655 20.54 55-59 23.175 28.88 27.245 20.7 60-64 23.79 28.105000000000004 28.285 19.82 65-69 23.935000000000002 28.38 27.565 20.119999999999997 70-74 23.425 28.53 27.735 20.31 75-79 23.34 28.144999999999996 27.855 20.66 80-84 22.835 28.33 28.67 20.165 85-89 23.44 28.360000000000003 27.515 20.685000000000002 90-94 23.365 27.755000000000003 28.660000000000004 20.22 95-99 23.955000000000002 27.77 27.605 20.669999999999998 100-104 23.985 29.185 27.169999999999998 19.66 105-109 23.76 27.544999999999998 28.000000000000004 20.695 110-114 23.705000000000002 28.015 27.889999999999997 20.39 115-119 24.455 27.894999999999996 27.445000000000004 20.205000000000002 120-124 24.245 28.455000000000002 27.48 19.82 125-129 24.51 28.51 27.445000000000004 19.535 130-134 24.125 28.310000000000002 27.85 19.715 135-139 25.11 27.925 27.66 19.305 140-144 25.395 28.384999999999998 27.07 19.15 145-149 25.869999999999997 27.775 26.97 19.384999999999998 150-151 25.900000000000002 28.3875 27.1 18.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 3.0 25 2.5 26 4.5 27 8.5 28 7.5 29 11.0 30 18.5 31 21.0 32 34.0 33 41.0 34 47.0 35 67.0 36 91.5 37 127.5 38 156.5 39 181.0 40 194.5 41 230.5 42 268.5 43 273.0 44 282.5 45 283.0 46 265.5 47 244.0 48 219.5 49 181.5 50 148.0 51 127.5 52 96.5 53 72.0 54 60.0 55 47.0 56 33.0 57 29.5 58 29.5 59 19.0 60 10.5 61 7.5 62 9.0 63 10.0 64 7.0 65 3.5 66 4.5 67 3.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.025 #Duplication Level Percentage of deduplicated Percentage of total 1 92.33903830480847 84.975 2 6.7372996468350985 12.4 3 0.8421624558543873 2.325 4 0.08149959250203749 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.0250000000000004 0.0 0.0 0.0 0.0 124-125 3.2750000000000004 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 5.025 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.824999999999999 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 20.714287 140-144 >>END_MODULE Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066619 spots for SRR12919370.sra Written 1066619 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra Read 1066612 spots for SRR12919370.sra Written 1066612 spots for SRR12919370.sra SRR ids: ['SRR12919370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vm_1n91k SRR12919370.sra spots: 21332247 blocks: [[1, 1066612], [1066613, 2133224], [2133225, 3199836], [3199837, 4266448], [4266449, 5333060], [5333061, 6399672], [6399673, 7466284], [7466285, 8532896], [8532897, 9599508], [9599509, 10666120], [10666121, 11732732], [11732733, 12799344], [12799345, 13865956], [13865957, 14932568], [14932569, 15999180], [15999181, 17065792], [17065793, 18132404], [18132405, 19199016], [19199017, 20265628], [20265629, 21332247]] SRR12919370 file size 7227930 SRR12919370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919370 SRR12919370_1.fastq SRR12919370_2.fastq Input file: SRR12919370_1.fastq Paired file: SRR12919370_2.fastq trimmed: SRR12919370-trimmed-pair1.fastq, SRR12919370-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:47:46 2025 >> started Wed Feb 12 21:48:11 2025 >> done (24.305s) 21332247 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 861 ( 0.00%) empty read pairs filtered out after trimming by size control 21331359 (100.00%) read pairs available; of these: 1877877 ( 8.80%) trimmed read pairs available after processing 19453482 (91.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 6 0.00% 21 9 0.00% 22 6 0.00% 23 5 0.00% 24 9 0.00% 25 8 0.00% 26 2 0.00% 27 13 0.00% 28 15 0.00% 29 11 0.00% 30 12 0.00% 31 14 0.00% 32 10 0.00% 33 25 0.00% 34 19 0.00% 35 13 0.00% 36 16 0.00% 37 23 0.00% 38 23 0.00% 39 17 0.00% 40 26 0.00% 41 21 0.00% 42 28 0.00% 43 34 0.00% 44 23 0.00% 45 38 0.00% 46 36 0.00% 47 31 0.00% 48 44 0.00% 49 48 0.00% 50 51 0.00% 51 53 0.00% 52 60 0.00% 53 70 0.00% 54 65 0.00% 55 76 0.00% 56 93 0.00% 57 83 0.00% 58 116 0.00% 59 131 0.00% 60 154 0.00% 61 202 0.00% 62 186 0.00% 63 207 0.00% 64 265 0.00% 65 259 0.00% 66 310 0.00% 67 323 0.00% 68 381 0.00% 69 448 0.00% 70 556 0.00% 71 637 0.00% 72 659 0.00% 73 832 0.00% 74 859 0.00% 75 1119 0.01% 76 1099 0.01% 77 1229 0.01% 78 1418 0.01% 79 1583 0.01% 80 1797 0.01% 81 2025 0.01% 82 2554 0.01% 83 2846 0.01% 84 3347 0.02% 85 3587 0.02% 86 3827 0.02% 87 4154 0.02% 88 4555 0.02% 89 4691 0.02% 90 5347 0.03% 91 6251 0.03% 92 6911 0.03% 93 7513 0.04% 94 8401 0.04% 95 8918 0.04% 96 9553 0.04% 97 10124 0.05% 98 10590 0.05% 99 11183 0.05% 100 12099 0.06% 101 13062 0.06% 102 13803 0.06% 103 15107 0.07% 104 16151 0.08% 105 16831 0.08% 106 18018 0.08% 107 18517 0.09% 108 18849 0.09% 109 19706 0.09% 110 20062 0.09% 111 21382 0.10% 112 22337 0.10% 113 23566 0.11% 114 24790 0.12% 115 26359 0.12% 116 26656 0.12% 117 27205 0.13% 118 28076 0.13% 119 28613 0.13% 120 29331 0.14% 121 30152 0.14% 122 31249 0.15% 123 32113 0.15% 124 33869 0.16% 125 34891 0.16% 126 36154 0.17% 127 36621 0.17% 128 37059 0.17% 129 37749 0.18% 130 38380 0.18% 131 39124 0.18% 132 40218 0.19% 133 41246 0.19% 134 41881 0.20% 135 43679 0.20% 136 44903 0.21% 137 45404 0.21% 138 46224 0.22% 139 46468 0.22% 140 47388 0.22% 141 47640 0.22% 142 48880 0.23% 143 49345 0.23% 144 51485 0.24% 145 52363 0.25% 146 53161 0.25% 147 53950 0.25% 148 54294 0.25% 149 53850 0.25% 150 55324 0.26% 151 19453482 91.20% 21331359 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=24 prefix-density=0.64 prefix-fanout=2.6 sequence=TGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTTTTTGCATCAAAATTATCGTTAAGGAAGTCTCCGTA criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=19.05 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=2.6 sequence=TGAACTTGTTTTACCAGCTACAT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=38 prefix-density=0.43 prefix-fanout=2.0 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTCTGATGAATGCCTGCCCGGAAAACCCAAAGTTGTCTTTGGATCGAAGAGTTCTACTTCTGATTTTTACGTTCGAAATAAAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=124.28 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.3 sequence=GAGCTTCAAAGCATGGTCAGTGACCTATAGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACT SRR12919370 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:49:00 Started mapping on | Feb 12 21:49:00 Finished on | Feb 12 21:51:23 Mapping speed, Million of reads per hour | 537.01 Number of input reads | 21331359 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19920263 Uniquely mapped reads % | 93.38% Average mapped length | 296.62 Number of splices: Total | 18752080 Number of splices: Annotated (sjdb) | 18234141 Number of splices: GT/AG | 18403412 Number of splices: GC/AG | 273762 Number of splices: AT/AC | 18678 Number of splices: Non-canonical | 56228 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 526011 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 95381 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 885085 885085 885085 N_multimapping 526011 526011 526011 N_noFeature 860081 19690131 961308 N_ambiguous 258052 1384 128371 UnstrandedReadsAssigned:18802130 PositiveStrandReadsAssigned:228748 NegativeStrandReadsAssigned:18830584 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919370 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919370-trimmed-pair1.fastq SRR12919370-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,331,359 reads, 18,916,029 reads pseudoaligned [quant] estimated average fragment length: 273.573 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52401 SRR12919370.ke.tsv 34699 SRR12919370.se.tsv 87100 total ==> SRR12919370.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.43 620 20.5688 Potri.005G024800.1.v4.1 1035 762.427 494 37.5187 Potri.004G059700.1.v4.1 961 688.574 38 3.1956 Potri.007G009000.2.v4.1 1416 1143.43 0 0 Potri.003G141000.2.v4.1 2943 2670.43 681 14.7668 Potri.016G087400.1.v4.1 270 81.8736 1601 1132.31 Potri.015G069301.1.v4.1 564 309.251 0 0 Potri.010G195200.1.v4.1 1773 1500.43 176 6.7923 Potri.012G127500.1.v4.1 977 704.499 2014 165.538 ==> SRR12919370.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 276 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 47 SRR12919370 completed mapping pipeline successfully