Starting /dee2/code/volunteer_pipeline.sh SRR12919371 current disk space = 3050748428288 free memory = 1580404968 SRR12919371 SRAfilesize 2c2f13203278e1a0380b231052205060 SRR12919371.sra SRR12919371.sra file validated SRR12919371 is paired end SRR12919371 is conventional basespace SRR12919371 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.579 37.0 37.0 37.0 37.0 37.0 2 36.30025 37.0 37.0 37.0 37.0 37.0 3 36.604 37.0 37.0 37.0 37.0 37.0 4 36.674 37.0 37.0 37.0 37.0 37.0 5 36.695 37.0 37.0 37.0 37.0 37.0 6 36.717 37.0 37.0 37.0 37.0 37.0 7 36.6735 37.0 37.0 37.0 37.0 37.0 8 36.718 37.0 37.0 37.0 37.0 37.0 9 36.6575 37.0 37.0 37.0 37.0 37.0 10-14 36.6903 37.0 37.0 37.0 37.0 37.0 15-19 36.6524 37.0 37.0 37.0 37.0 37.0 20-24 36.6103 37.0 37.0 37.0 37.0 37.0 25-29 36.57430000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.537 37.0 37.0 37.0 37.0 37.0 35-39 36.5276 37.0 37.0 37.0 37.0 37.0 40-44 36.531400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4881 37.0 37.0 37.0 37.0 37.0 50-54 36.4595 37.0 37.0 37.0 37.0 37.0 55-59 36.4563 37.0 37.0 37.0 37.0 37.0 60-64 36.413 37.0 37.0 37.0 37.0 37.0 65-69 36.3382 37.0 37.0 37.0 37.0 37.0 70-74 36.360699999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.347500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3613 37.0 37.0 37.0 37.0 37.0 85-89 36.241 37.0 37.0 37.0 37.0 37.0 90-94 36.214 37.0 37.0 37.0 37.0 37.0 95-99 36.2281 37.0 37.0 37.0 37.0 37.0 100-104 36.213499999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1995 37.0 37.0 37.0 37.0 37.0 110-114 36.1138 37.0 37.0 37.0 37.0 37.0 115-119 36.0965 37.0 37.0 37.0 37.0 37.0 120-124 36.121399999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.037099999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9539 37.0 37.0 37.0 37.0 37.0 135-139 35.905499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8112 37.0 37.0 37.0 37.0 37.0 145-149 35.818 37.0 37.0 37.0 37.0 37.0 150-151 35.55675 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 5.0 26 3.0 27 3.0 28 8.0 29 17.0 30 19.0 31 33.0 32 43.0 33 65.0 34 108.0 35 304.0 36 3025.0 37 363.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.175 13.625000000000002 5.45 40.75 2 19.417231851293646 15.197186636523485 35.71966842501884 29.665913087164032 3 16.950000000000003 18.525 29.575000000000003 34.949999999999996 4 20.375 25.124999999999996 24.55 29.95 5 21.125 30.599999999999998 25.224999999999998 23.05 6 21.224999999999998 34.425 24.05 20.3 7 14.799999999999999 27.224999999999998 41.825 16.150000000000002 8 16.975 27.200000000000003 33.2 22.625 9 17.275 23.974999999999998 35.0 23.75 10-14 18.785 29.67 28.95 22.595000000000002 15-19 19.67 28.665000000000003 28.185 23.48 20-24 19.314999999999998 29.01 27.985 23.69 25-29 19.23 28.475 28.935 23.36 30-34 19.215 29.065 27.965 23.755000000000003 35-39 20.01 28.754999999999995 27.49 23.745 40-44 19.384999999999998 29.770000000000003 27.939999999999998 22.905 45-49 19.72 28.83 27.615000000000002 23.835 50-54 19.54 28.720000000000002 27.805000000000003 23.935000000000002 55-59 19.17 28.48 28.275 24.075 60-64 19.245 28.715000000000003 28.105000000000004 23.935000000000002 65-69 19.009999999999998 28.845 27.97 24.175 70-74 19.68 29.225 27.395000000000003 23.7 75-79 20.155 28.494999999999997 27.694999999999997 23.655 80-84 19.915 28.205000000000002 27.834999999999997 24.044999999999998 85-89 20.155 28.89 27.88 23.075000000000003 90-94 20.175 28.025 27.71 24.09 95-99 19.75 29.744999999999997 27.615000000000002 22.89 100-104 19.794999999999998 28.43 28.16 23.615 105-109 20.015 28.77 27.944999999999997 23.27 110-114 20.235 28.04 27.939999999999998 23.785 115-119 20.05 28.794999999999998 27.029999999999998 24.125 120-124 19.580000000000002 28.875 27.51 24.035 125-129 20.125 27.735 27.925 24.215 130-134 19.86 28.035 28.285 23.82 135-139 20.105 28.68 27.334999999999997 23.880000000000003 140-144 20.19 28.475 26.99 24.345 145-149 19.7 28.7 27.345000000000002 24.255 150-151 20.5125 27.725 27.4125 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 0.5 22 0.5 23 2.0 24 2.5 25 2.0 26 2.5 27 6.5 28 11.5 29 14.0 30 19.0 31 32.0 32 42.0 33 50.0 34 67.0 35 82.0 36 100.0 37 127.5 38 143.5 39 170.0 40 200.5 41 229.0 42 256.0 43 257.5 44 282.0 45 288.0 46 258.0 47 243.0 48 219.5 49 184.5 50 147.5 51 124.0 52 98.5 53 75.0 54 66.5 55 50.0 56 33.5 57 28.0 58 25.0 59 15.0 60 7.0 61 4.5 62 5.0 63 7.0 64 5.0 65 3.0 66 2.5 67 0.5 68 0.0 69 0.5 70 2.0 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.125 #Duplication Level Percentage of deduplicated Percentage of total 1 89.31276297335204 79.60000000000001 2 9.368863955119215 16.7 3 1.1220196353436185 3.0 4 0.19635343618513326 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.1624999999999996 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.4375 0.0 0.0 0.0 0.0 136-137 4.825 0.0 0.0 0.0 0.0 138-139 5.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATTGT 10 0.006830828 145.0 1 >>END_MODULE SRR12919371 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0415 37.0 37.0 37.0 37.0 37.0 2 35.74 37.0 37.0 37.0 37.0 37.0 3 35.898 37.0 37.0 37.0 37.0 37.0 4 35.977 37.0 37.0 37.0 37.0 37.0 5 36.1385 37.0 37.0 37.0 37.0 37.0 6 36.0795 37.0 37.0 37.0 37.0 37.0 7 35.95 37.0 37.0 37.0 37.0 37.0 8 36.08 37.0 37.0 37.0 37.0 37.0 9 36.1585 37.0 37.0 37.0 37.0 37.0 10-14 36.1557 37.0 37.0 37.0 37.0 37.0 15-19 36.155499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0575 37.0 37.0 37.0 37.0 37.0 25-29 36.032599999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.9464 37.0 37.0 37.0 37.0 37.0 35-39 35.965999999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.926 37.0 37.0 37.0 37.0 37.0 45-49 35.788 37.0 37.0 37.0 37.0 37.0 50-54 35.904 37.0 37.0 37.0 37.0 37.0 55-59 35.8098 37.0 37.0 37.0 37.0 37.0 60-64 35.8181 37.0 37.0 37.0 37.0 37.0 65-69 35.802 37.0 37.0 37.0 37.0 37.0 70-74 35.738 37.0 37.0 37.0 37.0 37.0 75-79 35.671499999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.738800000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.6085 37.0 37.0 37.0 37.0 37.0 90-94 35.569599999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.569900000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.5463 37.0 37.0 37.0 37.0 37.0 105-109 35.5024 37.0 37.0 37.0 37.0 37.0 110-114 35.5008 37.0 37.0 37.0 37.0 37.0 115-119 35.4536 37.0 37.0 37.0 37.0 37.0 120-124 35.4428 37.0 37.0 37.0 32.2 37.0 125-129 35.400800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.3082 37.0 37.0 37.0 29.8 37.0 135-139 35.1726 37.0 37.0 37.0 25.0 37.0 140-144 35.1071 37.0 37.0 37.0 27.4 37.0 145-149 35.0717 37.0 37.0 37.0 25.0 37.0 150-151 34.971999999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 1.0 14 2.0 15 2.0 16 2.0 17 2.0 18 1.0 19 1.0 20 2.0 21 4.0 22 3.0 23 7.0 24 9.0 25 9.0 26 10.0 27 7.0 28 12.0 29 23.0 30 31.0 31 48.0 32 70.0 33 133.0 34 296.0 35 736.0 36 2415.0 37 171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.550000000000004 25.825 10.6 24.025 2 27.224999999999998 26.25 31.35 15.174999999999999 3 18.4 28.975 34.125 18.5 4 23.974999999999998 33.925 24.175 17.925 5 24.5 36.75 22.7 16.05 6 21.95 38.824999999999996 22.825 16.400000000000002 7 21.65 22.5 37.175000000000004 18.675 8 21.9 25.3 29.15 23.65 9 22.725 24.55 30.65 22.075 10-14 23.585 28.970000000000002 26.745 20.7 15-19 23.705000000000002 28.21 28.175 19.91 20-24 24.21 27.465 27.889999999999997 20.435 25-29 23.305 28.470000000000002 27.68 20.544999999999998 30-34 24.04 27.63 28.46 19.869999999999997 35-39 23.48 28.749999999999996 27.544999999999998 20.225 40-44 23.494999999999997 28.405 27.54 20.560000000000002 45-49 23.46 28.299999999999997 28.175 20.064999999999998 50-54 23.555 27.189999999999998 28.825 20.43 55-59 24.435000000000002 27.775 28.065 19.725 60-64 23.369999999999997 27.71 28.175 20.745 65-69 23.674999999999997 28.13 27.834999999999997 20.36 70-74 23.86 27.43 28.389999999999997 20.32 75-79 23.465 27.725 28.835 19.975 80-84 23.97 27.005000000000003 28.67 20.355 85-89 24.08 28.21 27.384999999999998 20.325 90-94 23.515 27.805000000000003 28.125 20.555 95-99 23.755000000000003 27.965 27.92 20.36 100-104 23.595 28.54 27.994999999999997 19.869999999999997 105-109 24.125 27.279999999999998 27.794999999999998 20.8 110-114 23.485 28.549999999999997 27.905 20.06 115-119 24.26 28.634999999999998 27.439999999999998 19.665 120-124 24.4 28.43 27.18 19.99 125-129 24.25 28.849999999999998 27.16 19.74 130-134 25.074999999999996 28.185 27.315 19.425 135-139 24.36 28.075 27.93 19.634999999999998 140-144 25.174999999999997 28.38 27.500000000000004 18.945 145-149 24.73 27.615000000000002 27.565 20.09 150-151 25.637500000000003 26.887499999999996 27.4125 20.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 1.0 25 2.0 26 2.5 27 7.0 28 9.5 29 6.0 30 11.0 31 21.5 32 31.0 33 51.5 34 62.0 35 64.0 36 84.5 37 114.5 38 150.5 39 177.5 40 195.0 41 244.0 42 269.5 43 266.0 44 280.5 45 274.5 46 255.5 47 248.5 48 221.5 49 187.5 50 170.5 51 125.0 52 97.5 53 87.0 54 60.0 55 43.0 56 36.5 57 35.0 58 27.5 59 20.0 60 13.0 61 8.0 62 5.5 63 3.5 64 2.0 65 1.5 66 2.5 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.575 #Duplication Level Percentage of deduplicated Percentage of total 1 89.98046329891153 80.60000000000001 2 8.679877197878874 15.55 3 1.0884733463578007 2.9250000000000003 4 0.22327658386826682 0.8 5 0.027909572983533353 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.2625 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.3499999999999996 0.0 0.0 0.0 0.0 130-131 3.725 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.6125 0.0 0.0 0.0 0.0 136-137 5.0 0.0 0.0 0.0 0.0 138-139 5.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTAAC 10 0.006830828 145.0 1 >>END_MODULE Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675554 spots for SRR12919371.sra Written 675554 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra Read 675538 spots for SRR12919371.sra Written 675538 spots for SRR12919371.sra SRR ids: ['SRR12919371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__l1i3n_q SRR12919371.sra spots: 13510776 blocks: [[1, 675538], [675539, 1351076], [1351077, 2026614], [2026615, 2702152], [2702153, 3377690], [3377691, 4053228], [4053229, 4728766], [4728767, 5404304], [5404305, 6079842], [6079843, 6755380], [6755381, 7430918], [7430919, 8106456], [8106457, 8781994], [8781995, 9457532], [9457533, 10133070], [10133071, 10808608], [10808609, 11484146], [11484147, 12159684], [12159685, 12835222], [12835223, 13510776]] SRR12919371 file size 4569852 SRR12919371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919371 SRR12919371_1.fastq SRR12919371_2.fastq Input file: SRR12919371_1.fastq Paired file: SRR12919371_2.fastq trimmed: SRR12919371-trimmed-pair1.fastq, SRR12919371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:35:42 2025 >> started Wed Feb 12 21:35:57 2025 >> done (15.309s) 13510776 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 220 ( 0.00%) empty read pairs filtered out after trimming by size control 13510537 (100.00%) read pairs available; of these: 1144548 ( 8.47%) trimmed read pairs available after processing 12365989 (91.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 6 0.00% 22 2 0.00% 23 3 0.00% 24 6 0.00% 25 5 0.00% 26 3 0.00% 27 6 0.00% 28 9 0.00% 29 4 0.00% 30 10 0.00% 31 4 0.00% 32 6 0.00% 33 4 0.00% 34 14 0.00% 35 8 0.00% 36 6 0.00% 37 11 0.00% 38 13 0.00% 39 9 0.00% 40 10 0.00% 41 10 0.00% 42 12 0.00% 43 15 0.00% 44 18 0.00% 45 8 0.00% 46 16 0.00% 47 17 0.00% 48 19 0.00% 49 25 0.00% 50 30 0.00% 51 26 0.00% 52 27 0.00% 53 39 0.00% 54 39 0.00% 55 50 0.00% 56 42 0.00% 57 36 0.00% 58 53 0.00% 59 57 0.00% 60 62 0.00% 61 91 0.00% 62 118 0.00% 63 111 0.00% 64 126 0.00% 65 143 0.00% 66 179 0.00% 67 193 0.00% 68 180 0.00% 69 242 0.00% 70 261 0.00% 71 359 0.00% 72 397 0.00% 73 458 0.00% 74 519 0.00% 75 565 0.00% 76 721 0.01% 77 702 0.01% 78 813 0.01% 79 960 0.01% 80 1070 0.01% 81 1244 0.01% 82 1520 0.01% 83 1695 0.01% 84 1882 0.01% 85 2008 0.01% 86 2178 0.02% 87 2471 0.02% 88 2657 0.02% 89 2918 0.02% 90 3210 0.02% 91 3637 0.03% 92 4111 0.03% 93 4454 0.03% 94 4964 0.04% 95 5366 0.04% 96 5362 0.04% 97 5901 0.04% 98 6426 0.05% 99 6689 0.05% 100 7084 0.05% 101 7657 0.06% 102 8216 0.06% 103 9056 0.07% 104 9714 0.07% 105 10158 0.08% 106 10722 0.08% 107 10836 0.08% 108 11279 0.08% 109 11718 0.09% 110 12162 0.09% 111 12865 0.10% 112 13656 0.10% 113 14044 0.10% 114 15007 0.11% 115 15662 0.12% 116 16148 0.12% 117 16692 0.12% 118 16889 0.13% 119 17099 0.13% 120 17700 0.13% 121 18084 0.13% 122 18787 0.14% 123 19918 0.15% 124 20489 0.15% 125 21330 0.16% 126 22119 0.16% 127 22669 0.17% 128 22536 0.17% 129 22900 0.17% 130 23227 0.17% 131 23509 0.17% 132 24453 0.18% 133 25425 0.19% 134 26336 0.19% 135 26939 0.20% 136 27059 0.20% 137 28058 0.21% 138 28199 0.21% 139 28475 0.21% 140 28590 0.21% 141 29182 0.22% 142 30082 0.22% 143 30955 0.23% 144 31797 0.24% 145 32182 0.24% 146 32990 0.24% 147 33701 0.25% 148 33766 0.25% 149 33935 0.25% 150 34845 0.26% 151 12365989 91.53% 13510537 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.94 fanout-score-rank=17 prefix-density=0.51 prefix-fanout=3.4 sequence=ATCATCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=51.72 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.9 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=27 prefix-density=0.43 prefix-fanout=1.9 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTCTGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=650.90 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=20.8 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTT SRR12919371 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:36:45 Started mapping on | Feb 12 21:36:45 Finished on | Feb 12 21:38:41 Mapping speed, Million of reads per hour | 419.29 Number of input reads | 13510537 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12397767 Uniquely mapped reads % | 91.76% Average mapped length | 296.68 Number of splices: Total | 11549980 Number of splices: Annotated (sjdb) | 11240843 Number of splices: GT/AG | 11327511 Number of splices: GC/AG | 165559 Number of splices: AT/AC | 11073 Number of splices: Non-canonical | 45837 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.03% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320288 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 59815 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.23% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 792482 792482 792482 N_multimapping 320288 320288 320288 N_noFeature 483669 12245939 545315 N_ambiguous 182611 798 92070 UnstrandedReadsAssigned:11731487 PositiveStrandReadsAssigned:151030 NegativeStrandReadsAssigned:11760382 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919371-trimmed-pair1.fastq SRR12919371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,510,537 reads, 11,759,690 reads pseudoaligned [quant] estimated average fragment length: 269.987 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR12919371.ke.tsv 34699 SRR12919371.se.tsv 87100 total ==> SRR12919371.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.01 390 19.6371 Potri.005G024800.1.v4.1 1035 766.013 149 17.13 Potri.004G059700.1.v4.1 961 692.16 8 1.01787 Potri.007G009000.2.v4.1 1416 1147.01 0 0 Potri.003G141000.2.v4.1 2943 2674.01 795 26.1825 Potri.016G087400.1.v4.1 270 80.8012 934 1017.97 Potri.015G069301.1.v4.1 564 309.963 0 0 Potri.010G195200.1.v4.1 1773 1504.01 62 3.63034 Potri.012G127500.1.v4.1 977 708.073 3389 421.502 ==> SRR12919371.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 91 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 138 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 35 SRR12919371 completed mapping pipeline successfully