Starting /dee2/code/volunteer_pipeline.sh SRR12919373 current disk space = 3050934906880 free memory = 1467750324 SRR12919373 SRAfilesize 95c5ca1ece4cbc0cef80db2a5d606239 SRR12919373.sra SRR12919373.sra file validated SRR12919373 is paired end SRR12919373 is conventional basespace SRR12919373 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.534 37.0 37.0 37.0 37.0 37.0 2 36.25525 37.0 37.0 37.0 37.0 37.0 3 36.5645 37.0 37.0 37.0 37.0 37.0 4 36.6045 37.0 37.0 37.0 37.0 37.0 5 36.6115 37.0 37.0 37.0 37.0 37.0 6 36.6105 37.0 37.0 37.0 37.0 37.0 7 36.5375 37.0 37.0 37.0 37.0 37.0 8 36.5935 37.0 37.0 37.0 37.0 37.0 9 36.6345 37.0 37.0 37.0 37.0 37.0 10-14 36.613600000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.60549999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5832 37.0 37.0 37.0 37.0 37.0 25-29 36.52720000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.4778 37.0 37.0 37.0 37.0 37.0 35-39 36.4588 37.0 37.0 37.0 37.0 37.0 40-44 36.4528 37.0 37.0 37.0 37.0 37.0 45-49 36.407300000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.434799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4354 37.0 37.0 37.0 37.0 37.0 60-64 36.353300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3526 37.0 37.0 37.0 37.0 37.0 70-74 36.3087 37.0 37.0 37.0 37.0 37.0 75-79 36.305699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3031 37.0 37.0 37.0 37.0 37.0 85-89 36.2433 37.0 37.0 37.0 37.0 37.0 90-94 36.1923 37.0 37.0 37.0 37.0 37.0 95-99 36.2202 37.0 37.0 37.0 37.0 37.0 100-104 36.1798 37.0 37.0 37.0 37.0 37.0 105-109 36.1489 37.0 37.0 37.0 37.0 37.0 110-114 36.0784 37.0 37.0 37.0 37.0 37.0 115-119 36.089800000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0849 37.0 37.0 37.0 37.0 37.0 125-129 35.92059999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.87220000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.78849999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.695899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.6457 37.0 37.0 37.0 37.0 37.0 150-151 35.431749999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 5.0 25 4.0 26 6.0 27 10.0 28 9.0 29 25.0 30 22.0 31 25.0 32 46.0 33 66.0 34 113.0 35 305.0 36 2948.0 37 411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.4 12.75 5.6000000000000005 39.25 2 20.628930817610065 13.534591194968554 36.20125786163522 29.635220125786166 3 17.299999999999997 18.099999999999998 28.199999999999996 36.4 4 21.224999999999998 23.875 25.025 29.875 5 22.6 31.0 24.325 22.075 6 21.375 34.0 23.724999999999998 20.9 7 16.150000000000002 27.525 39.4 16.925 8 17.4 26.424999999999997 32.525 23.65 9 18.575 24.85 33.35 23.225 10-14 20.055 29.544999999999998 27.544999999999998 22.855 15-19 19.99 28.37 27.345000000000002 24.295 20-24 20.095 28.925 27.775 23.205000000000002 25-29 19.689999999999998 28.744999999999997 27.415 24.15 30-34 19.72 28.439999999999998 27.905 23.935000000000002 35-39 19.835 28.505000000000003 27.305 24.355 40-44 19.689999999999998 29.365000000000002 27.125 23.82 45-49 20.225 28.444999999999997 27.805000000000003 23.525 50-54 20.064999999999998 28.310000000000002 27.834999999999997 23.79 55-59 19.865 28.360000000000003 27.77 24.005000000000003 60-64 20.27 28.065 27.534999999999997 24.13 65-69 20.285 27.72 28.310000000000002 23.685000000000002 70-74 20.61 28.105000000000004 27.43 23.855 75-79 20.775 28.23 27.189999999999998 23.805 80-84 19.99 28.58 27.534999999999997 23.895 85-89 20.625 28.58 26.86 23.935000000000002 90-94 20.555 27.875 27.310000000000002 24.26 95-99 21.33 27.495000000000005 27.279999999999998 23.895 100-104 20.865000000000002 28.610000000000003 26.740000000000002 23.785 105-109 20.91 28.32 26.950000000000003 23.82 110-114 20.285 28.865000000000002 26.625 24.224999999999998 115-119 20.97 28.205000000000002 27.565 23.26 120-124 20.705000000000002 28.084999999999997 26.47 24.740000000000002 125-129 20.419999999999998 28.7 26.13 24.75 130-134 21.435000000000002 27.975 26.009999999999998 24.58 135-139 21.275 27.87 26.790000000000003 24.065 140-144 21.335 27.589999999999996 26.66 24.415 145-149 20.9 27.639999999999997 27.169999999999998 24.29 150-151 21.525 27.425 26.3125 24.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 2.0 25 3.5 26 4.0 27 9.5 28 12.5 29 12.5 30 15.5 31 27.5 32 36.0 33 44.0 34 56.5 35 61.0 36 68.5 37 91.5 38 124.5 39 152.5 40 184.5 41 215.5 42 253.0 43 262.0 44 235.5 45 235.5 46 242.0 47 239.5 48 248.5 49 242.5 50 201.0 51 159.0 52 128.5 53 96.0 54 76.0 55 66.5 56 50.0 57 35.5 58 24.5 59 17.5 60 15.5 61 13.0 62 7.5 63 3.5 64 7.5 65 5.5 66 1.5 67 3.0 68 2.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.42671009771986 85.125 2 6.7861020629750275 12.5 3 0.6243213897937026 1.725 4 0.13572204125950055 0.5 5 0.0 0.0 6 0.02714440825190011 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGTGATCACCTGATCCAAGACCATAAGGCAAAGTGTGCATGAATTCGC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.7875 0.0 0.0 0.0 0.0 100-101 2.0375 0.0 0.0 0.0 0.0 102-103 2.3125 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.8375 0.0 0.0 0.0 0.0 108-109 3.325 0.0 0.0 0.0 0.0 110-111 3.6125 0.0 0.0 0.0 0.0 112-113 4.0625 0.0 0.0 0.0 0.0 114-115 4.4 0.0 0.0 0.0 0.0 116-117 4.875 0.0 0.0 0.0 0.0 118-119 5.375 0.0 0.0 0.0 0.0 120-121 5.7625 0.0 0.0 0.0 0.0 122-123 6.225 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.325 0.0 0.0 0.0 0.0 128-129 7.85 0.0 0.0 0.0 0.0 130-131 8.35 0.0 0.0 0.0 0.0 132-133 8.7 0.0 0.0 0.0 0.0 134-135 9.1625 0.0 0.0 0.0 0.0 136-137 9.725 0.0 0.0 0.0 0.0 138-139 10.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTCT 10 0.006830828 145.0 6 GTCCCAA 10 0.006830828 145.0 1 >>END_MODULE SRR12919373 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919373_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4215 37.0 37.0 37.0 37.0 37.0 2 36.3105 37.0 37.0 37.0 37.0 37.0 3 36.4145 37.0 37.0 37.0 37.0 37.0 4 36.2885 37.0 37.0 37.0 37.0 37.0 5 36.38 37.0 37.0 37.0 37.0 37.0 6 36.422 37.0 37.0 37.0 37.0 37.0 7 36.371 37.0 37.0 37.0 37.0 37.0 8 36.4565 37.0 37.0 37.0 37.0 37.0 9 36.4205 37.0 37.0 37.0 37.0 37.0 10-14 36.3968 37.0 37.0 37.0 37.0 37.0 15-19 36.3679 37.0 37.0 37.0 37.0 37.0 20-24 36.4082 37.0 37.0 37.0 37.0 37.0 25-29 36.2909 37.0 37.0 37.0 37.0 37.0 30-34 36.2673 37.0 37.0 37.0 37.0 37.0 35-39 36.2698 37.0 37.0 37.0 37.0 37.0 40-44 36.2372 37.0 37.0 37.0 37.0 37.0 45-49 36.210499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2678 37.0 37.0 37.0 37.0 37.0 55-59 36.1817 37.0 37.0 37.0 37.0 37.0 60-64 36.188 37.0 37.0 37.0 37.0 37.0 65-69 36.1738 37.0 37.0 37.0 37.0 37.0 70-74 36.1511 37.0 37.0 37.0 37.0 37.0 75-79 36.06420000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.075 37.0 37.0 37.0 37.0 37.0 85-89 36.068400000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9957 37.0 37.0 37.0 37.0 37.0 95-99 36.0044 37.0 37.0 37.0 37.0 37.0 100-104 36.0227 37.0 37.0 37.0 37.0 37.0 105-109 35.922900000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.9019 37.0 37.0 37.0 37.0 37.0 115-119 35.8611 37.0 37.0 37.0 37.0 37.0 120-124 35.8665 37.0 37.0 37.0 37.0 37.0 125-129 35.819300000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.6924 37.0 37.0 37.0 37.0 37.0 135-139 35.5457 37.0 37.0 37.0 37.0 37.0 140-144 35.56519999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.3463 37.0 37.0 37.0 34.6 37.0 150-151 35.18925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 0.0 15 1.0 16 2.0 17 1.0 18 0.0 19 0.0 20 0.0 21 2.0 22 5.0 23 8.0 24 4.0 25 5.0 26 8.0 27 6.0 28 10.0 29 17.0 30 20.0 31 29.0 32 41.0 33 93.0 34 166.0 35 497.0 36 2730.0 37 351.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.75 25.8 9.15 24.3 2 28.175 26.375 28.65 16.8 3 20.75 27.900000000000002 32.7 18.65 4 24.975 32.95 22.95 19.125 5 24.5 36.5 22.425 16.575 6 21.375 38.875 21.224999999999998 18.525 7 20.0 22.125 37.675 20.200000000000003 8 21.7 25.924999999999997 27.900000000000002 24.474999999999998 9 22.225 24.7 30.775000000000002 22.3 10-14 23.330000000000002 29.68 26.57 20.419999999999998 15-19 23.97 28.449999999999996 26.47 21.11 20-24 23.54 28.215 27.095000000000002 21.15 25-29 22.7 28.9 27.91 20.49 30-34 23.29 27.439999999999998 28.03 21.240000000000002 35-39 23.305 27.58 28.04 21.075 40-44 23.549999999999997 27.52 27.88 21.05 45-49 23.494999999999997 27.435 28.199999999999996 20.87 50-54 23.52 27.785 27.555000000000003 21.14 55-59 23.415 27.425 27.975 21.185000000000002 60-64 23.52 27.66 27.675 21.145 65-69 23.53 28.22 26.87 21.38 70-74 23.875 27.755000000000003 26.75 21.62 75-79 22.939999999999998 28.165000000000003 27.994999999999997 20.9 80-84 23.005 27.88 27.939999999999998 21.175 85-89 23.7 27.889999999999997 26.88 21.529999999999998 90-94 24.365000000000002 27.43 27.47 20.735 95-99 23.895 28.33 26.77 21.005 100-104 24.22 27.855 26.784999999999997 21.14 105-109 23.185 28.055000000000003 27.435 21.325 110-114 24.16 27.68 27.705000000000002 20.455000000000002 115-119 24.65 27.515 27.339999999999996 20.495 120-124 25.130000000000003 28.000000000000004 26.68 20.19 125-129 24.46 27.694999999999997 27.015 20.830000000000002 130-134 24.79 28.105000000000004 26.045 21.060000000000002 135-139 24.795 28.02 26.790000000000003 20.395 140-144 24.725 27.04 27.465 20.77 145-149 25.605 27.975 26.355 20.064999999999998 150-151 25.374999999999996 28.7 25.974999999999998 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 1.5 23 1.5 24 2.0 25 3.5 26 4.0 27 4.5 28 7.5 29 10.0 30 10.0 31 15.5 32 28.0 33 45.0 34 49.0 35 52.5 36 79.0 37 102.0 38 129.5 39 152.0 40 172.0 41 205.5 42 236.0 43 258.5 44 274.0 45 267.5 46 262.5 47 267.5 48 232.0 49 204.5 50 180.5 51 140.5 52 122.0 53 109.5 54 94.0 55 70.5 56 50.5 57 38.5 58 26.0 59 20.0 60 17.0 61 14.0 62 10.0 63 6.0 64 3.5 65 2.0 66 1.0 67 1.5 68 2.0 69 1.0 70 0.5 71 1.0 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.46053347849755 84.925 2 6.614044637996734 12.15 3 0.6260206859009254 1.725 4 0.21774632553075668 0.8 5 0.05443658138268917 0.25 6 0.027218290691344585 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATAGCAACCATCCGTAGATTCAAAGGCTTTCCGAGAAGCGACATTAGGGG 6 0.15 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.2625 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.0625 0.0 0.0 0.0 0.0 102-103 2.3375 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.375 0.0 0.0 0.0 0.0 110-111 3.6624999999999996 0.0 0.0 0.0 0.0 112-113 4.112500000000001 0.0 0.0 0.0 0.0 114-115 4.45 0.0 0.0 0.0 0.0 116-117 4.95 0.0 0.0 0.0 0.0 118-119 5.45 0.0 0.0 0.0 0.0 120-121 5.8375 0.0 0.0 0.0 0.0 122-123 6.3125 0.0 0.0 0.0 0.0 124-125 6.9 0.0 0.0 0.0 0.0 126-127 7.45 0.0 0.0 0.0 0.0 128-129 8.0 0.0 0.0 0.0 0.0 130-131 8.475 0.0 0.0 0.0 0.0 132-133 8.825 0.0 0.0 0.0 0.0 134-135 9.2875 0.0 0.0 0.0 0.0 136-137 9.85 0.0 0.0 0.0 0.0 138-139 10.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACTG 10 0.006830828 145.0 3 GAACTGA 10 0.006830828 145.0 4 >>END_MODULE Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955811 spots for SRR12919373.sra Written 955811 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra Read 955795 spots for SRR12919373.sra Written 955795 spots for SRR12919373.sra SRR ids: ['SRR12919373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pfx7heq8 SRR12919373.sra spots: 19115916 blocks: [[1, 955795], [955796, 1911590], [1911591, 2867385], [2867386, 3823180], [3823181, 4778975], [4778976, 5734770], [5734771, 6690565], [6690566, 7646360], [7646361, 8602155], [8602156, 9557950], [9557951, 10513745], [10513746, 11469540], [11469541, 12425335], [12425336, 13381130], [13381131, 14336925], [14336926, 15292720], [15292721, 16248515], [16248516, 17204310], [17204311, 18160105], [18160106, 19115916]] SRR12919373 file size 6474724 SRR12919373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919373 SRR12919373_1.fastq SRR12919373_2.fastq Input file: SRR12919373_1.fastq Paired file: SRR12919373_2.fastq trimmed: SRR12919373-trimmed-pair1.fastq, SRR12919373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:09:47 2025 >> started Wed Feb 12 21:10:09 2025 >> done (21.999s) 19115916 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 1546 ( 0.01%) empty read pairs filtered out after trimming by size control 19114344 (99.99%) read pairs available; of these: 3036029 (15.88%) trimmed read pairs available after processing 16078315 (84.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 2 0.00% 21 3 0.00% 22 0 0.00% 23 6 0.00% 24 6 0.00% 25 6 0.00% 26 8 0.00% 27 5 0.00% 28 7 0.00% 29 7 0.00% 30 8 0.00% 31 6 0.00% 32 13 0.00% 33 8 0.00% 34 12 0.00% 35 15 0.00% 36 12 0.00% 37 19 0.00% 38 20 0.00% 39 21 0.00% 40 28 0.00% 41 40 0.00% 42 33 0.00% 43 31 0.00% 44 36 0.00% 45 40 0.00% 46 41 0.00% 47 52 0.00% 48 61 0.00% 49 81 0.00% 50 87 0.00% 51 129 0.00% 52 140 0.00% 53 165 0.00% 54 138 0.00% 55 168 0.00% 56 203 0.00% 57 220 0.00% 58 260 0.00% 59 340 0.00% 60 408 0.00% 61 508 0.00% 62 557 0.00% 63 650 0.00% 64 758 0.00% 65 799 0.00% 66 912 0.00% 67 992 0.01% 68 1262 0.01% 69 1441 0.01% 70 1710 0.01% 71 2063 0.01% 72 2411 0.01% 73 2824 0.01% 74 3140 0.02% 75 3455 0.02% 76 3899 0.02% 77 4114 0.02% 78 4466 0.02% 79 5055 0.03% 80 5829 0.03% 81 6701 0.04% 82 7932 0.04% 83 8742 0.05% 84 9740 0.05% 85 10354 0.05% 86 11217 0.06% 87 11735 0.06% 88 12592 0.07% 89 13134 0.07% 90 14645 0.08% 91 15625 0.08% 92 17038 0.09% 93 19106 0.10% 94 20554 0.11% 95 21418 0.11% 96 22647 0.12% 97 23322 0.12% 98 23993 0.13% 99 25002 0.13% 100 25896 0.14% 101 26872 0.14% 102 28813 0.15% 103 30371 0.16% 104 31791 0.17% 105 33826 0.18% 106 34815 0.18% 107 35664 0.19% 108 35961 0.19% 109 36735 0.19% 110 37129 0.19% 111 38608 0.20% 112 39950 0.21% 113 41427 0.22% 114 42817 0.22% 115 44802 0.23% 116 46664 0.24% 117 47482 0.25% 118 48023 0.25% 119 47823 0.25% 120 49055 0.26% 121 49849 0.26% 122 50794 0.27% 123 52322 0.27% 124 53865 0.28% 125 54772 0.29% 126 57657 0.30% 127 57613 0.30% 128 57565 0.30% 129 58806 0.31% 130 58460 0.31% 131 58811 0.31% 132 59518 0.31% 133 60600 0.32% 134 62073 0.32% 135 62944 0.33% 136 65040 0.34% 137 65393 0.34% 138 66383 0.35% 139 67280 0.35% 140 66439 0.35% 141 66492 0.35% 142 67280 0.35% 143 67554 0.35% 144 69116 0.36% 145 70406 0.37% 146 70630 0.37% 147 71805 0.38% 148 72289 0.38% 149 72572 0.38% 150 71941 0.38% 151 16078315 84.12% 19114344 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.80 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=11.63 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.5 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=18 prefix-density=0.84 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=105.14 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12919373 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:10:53 Started mapping on | Feb 12 21:10:53 Finished on | Feb 12 21:13:25 Mapping speed, Million of reads per hour | 452.71 Number of input reads | 19114344 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17671933 Uniquely mapped reads % | 92.45% Average mapped length | 292.13 Number of splices: Total | 17379542 Number of splices: Annotated (sjdb) | 17063793 Number of splices: GT/AG | 17009181 Number of splices: GC/AG | 310824 Number of splices: AT/AC | 10386 Number of splices: Non-canonical | 49151 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431218 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 57375 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.85% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1011193 1011193 1011193 N_multimapping 431218 431218 431218 N_noFeature 517782 17407738 614562 N_ambiguous 294140 1020 126158 UnstrandedReadsAssigned:16860011 PositiveStrandReadsAssigned:263175 NegativeStrandReadsAssigned:16931213 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919373 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919373-trimmed-pair1.fastq SRR12919373-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,114,344 reads, 17,040,725 reads pseudoaligned [quant] estimated average fragment length: 244.369 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR12919373.ke.tsv 34699 SRR12919373.se.tsv 87100 total ==> SRR12919373.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.63 570 18.066 Potri.005G024800.1.v4.1 1035 791.631 367 26.0758 Potri.004G059700.1.v4.1 961 717.756 50 3.91821 Potri.007G009000.2.v4.1 1416 1172.63 0 0 Potri.003G141000.2.v4.1 2943 2699.63 556 11.5842 Potri.016G087400.1.v4.1 270 94.4316 800.441 476.767 Potri.015G069301.1.v4.1 564 334.454 0 0 Potri.010G195200.1.v4.1 1773 1529.63 19 0.698652 Potri.012G127500.1.v4.1 977 733.703 194 14.8722 ==> SRR12919373.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 309 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR12919373 completed mapping pipeline successfully