Starting /dee2/code/volunteer_pipeline.sh SRR12919374 current disk space = 3050602258432 free memory = 1573832420 SRR12919374 SRAfilesize 3bf561acb56e27053aa02cf495e8e848 SRR12919374.sra SRR12919374.sra file validated SRR12919374 is paired end SRR12919374 is conventional basespace SRR12919374 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919374_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7055 37.0 37.0 37.0 37.0 37.0 2 36.452 37.0 37.0 37.0 37.0 37.0 3 36.6585 37.0 37.0 37.0 37.0 37.0 4 36.6715 37.0 37.0 37.0 37.0 37.0 5 36.7555 37.0 37.0 37.0 37.0 37.0 6 36.734 37.0 37.0 37.0 37.0 37.0 7 36.661 37.0 37.0 37.0 37.0 37.0 8 36.7505 37.0 37.0 37.0 37.0 37.0 9 36.704 37.0 37.0 37.0 37.0 37.0 10-14 36.700900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6716 37.0 37.0 37.0 37.0 37.0 20-24 36.6744 37.0 37.0 37.0 37.0 37.0 25-29 36.608 37.0 37.0 37.0 37.0 37.0 30-34 36.6096 37.0 37.0 37.0 37.0 37.0 35-39 36.5602 37.0 37.0 37.0 37.0 37.0 40-44 36.591300000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.5358 37.0 37.0 37.0 37.0 37.0 50-54 36.461400000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.49739999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.404700000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3979 37.0 37.0 37.0 37.0 37.0 70-74 36.4056 37.0 37.0 37.0 37.0 37.0 75-79 36.33630000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.3977 37.0 37.0 37.0 37.0 37.0 85-89 36.2843 37.0 37.0 37.0 37.0 37.0 90-94 36.3144 37.0 37.0 37.0 37.0 37.0 95-99 36.2716 37.0 37.0 37.0 37.0 37.0 100-104 36.25189999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.2077 37.0 37.0 37.0 37.0 37.0 110-114 36.132799999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1485 37.0 37.0 37.0 37.0 37.0 120-124 36.170899999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.073499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9859 37.0 37.0 37.0 37.0 37.0 135-139 35.9033 37.0 37.0 37.0 37.0 37.0 140-144 35.775099999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.7119 37.0 37.0 37.0 37.0 37.0 150-151 35.4975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 2.0 20 0.0 21 0.0 22 1.0 23 0.0 24 1.0 25 4.0 26 5.0 27 7.0 28 4.0 29 20.0 30 18.0 31 28.0 32 33.0 33 57.0 34 99.0 35 314.0 36 2946.0 37 460.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.45 13.875000000000002 7.35 34.325 2 20.642893018583628 13.812154696132598 34.37970868910095 31.165243596182822 3 17.275 18.25 28.825 35.65 4 21.0 25.650000000000002 24.85 28.499999999999996 5 22.35 31.1 25.25 21.3 6 20.7 35.175 23.849999999999998 20.275000000000002 7 15.575 28.050000000000004 38.725 17.65 8 17.825 26.75 31.0 24.425 9 16.125 25.95 34.575 23.35 10-14 19.33 30.625000000000004 27.215 22.830000000000002 15-19 19.48 29.485 27.41 23.625 20-24 19.56 29.189999999999998 27.36 23.89 25-29 19.425 29.035 27.805000000000003 23.735 30-34 19.759999999999998 29.175 27.250000000000004 23.815 35-39 19.425 28.860000000000003 27.345000000000002 24.37 40-44 19.845 29.13 27.279999999999998 23.745 45-49 19.97 29.904999999999998 26.71 23.415 50-54 19.580000000000002 29.86 27.26 23.3 55-59 19.99 28.884999999999998 27.310000000000002 23.815 60-64 19.585 29.299999999999997 26.77 24.345 65-69 19.82 29.18 26.75 24.25 70-74 20.1 29.5 26.974999999999998 23.425 75-79 19.3 28.904999999999998 27.529999999999998 24.265 80-84 20.54 28.425 27.235 23.799999999999997 85-89 19.6 28.62 27.175 24.605 90-94 20.599999999999998 28.57 26.795 24.035 95-99 19.8 28.165000000000003 27.55 24.485 100-104 20.45 28.294999999999998 27.02 24.235 105-109 20.755000000000003 28.515 26.82 23.91 110-114 20.315 28.18 26.939999999999998 24.565 115-119 20.655 29.335 26.16 23.849999999999998 120-124 20.65 28.32 26.314999999999998 24.715 125-129 21.29 28.685 25.124999999999996 24.9 130-134 20.655 29.005 26.19 24.15 135-139 21.29 28.689999999999998 25.480000000000004 24.54 140-144 21.25 28.655 25.430000000000003 24.665 145-149 21.26 28.57 25.655 24.515 150-151 20.775 28.449999999999996 25.674999999999997 25.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 4.5 24 5.0 25 3.0 26 4.5 27 8.5 28 14.5 29 17.5 30 17.5 31 20.0 32 32.5 33 49.0 34 65.5 35 99.0 36 110.5 37 119.5 38 143.0 39 162.0 40 183.0 41 203.0 42 228.5 43 230.0 44 224.5 45 233.5 46 231.5 47 226.5 48 227.0 49 217.0 50 190.0 51 154.0 52 134.5 53 115.5 54 87.5 55 71.5 56 55.0 57 36.0 58 26.0 59 18.0 60 10.5 61 5.0 62 3.0 63 3.0 64 1.0 65 1.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.31030701754386 83.275 2 7.949561403508771 14.499999999999998 3 0.6304824561403508 1.725 4 0.05482456140350877 0.2 5 0.027412280701754384 0.125 6 0.0 0.0 7 0.027412280701754384 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 7 0.17500000000000002 No Hit CTGTCATCTTTGCTTTCGATTAATTAATTACCGTAGAGAGCATGTATGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.2625000000000002 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 2.0625 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.675 0.0 0.0 0.0 0.0 106-107 3.3375000000000004 0.0 0.0 0.0 0.0 108-109 3.7625 0.0 0.0 0.0 0.0 110-111 4.175 0.0 0.0 0.0 0.0 112-113 4.6 0.0 0.0 0.0 0.0 114-115 5.1375 0.0 0.0 0.0 0.0 116-117 5.75 0.0 0.0 0.0 0.0 118-119 6.55 0.0 0.0 0.0 0.0 120-121 7.3 0.0 0.0 0.0 0.0 122-123 7.9624999999999995 0.0 0.0 0.0 0.0 124-125 8.8375 0.0 0.0 0.0 0.0 126-127 9.575 0.0 0.0 0.0 0.0 128-129 10.25 0.0 0.0 0.0 0.0 130-131 11.05 0.0 0.0 0.0 0.0 132-133 12.0625 0.0 0.0 0.0 0.0 134-135 12.875 0.0 0.0 0.0 0.0 136-137 13.6375 0.0 0.0 0.0 0.0 138-139 14.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTCT 10 0.006830828 145.0 1 CCGAATC 10 0.006830828 145.0 3 AAAAAAA 50 0.0013298223 17.4 55-59 >>END_MODULE SRR12919374 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919374_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2935 37.0 37.0 37.0 37.0 37.0 2 36.4305 37.0 37.0 37.0 37.0 37.0 3 36.4465 37.0 37.0 37.0 37.0 37.0 4 36.406 37.0 37.0 37.0 37.0 37.0 5 36.4815 37.0 37.0 37.0 37.0 37.0 6 36.491 37.0 37.0 37.0 37.0 37.0 7 36.4945 37.0 37.0 37.0 37.0 37.0 8 36.5345 37.0 37.0 37.0 37.0 37.0 9 36.4575 37.0 37.0 37.0 37.0 37.0 10-14 36.533300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.493700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4938 37.0 37.0 37.0 37.0 37.0 25-29 36.398799999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4024 37.0 37.0 37.0 37.0 37.0 35-39 36.3711 37.0 37.0 37.0 37.0 37.0 40-44 36.3423 37.0 37.0 37.0 37.0 37.0 45-49 36.3272 37.0 37.0 37.0 37.0 37.0 50-54 36.306999999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.2836 37.0 37.0 37.0 37.0 37.0 60-64 36.28770000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2789 37.0 37.0 37.0 37.0 37.0 70-74 36.2017 37.0 37.0 37.0 37.0 37.0 75-79 36.2311 37.0 37.0 37.0 37.0 37.0 80-84 36.208800000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.232699999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.100199999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.12089999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.1519 37.0 37.0 37.0 37.0 37.0 105-109 36.06840000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.073 37.0 37.0 37.0 37.0 37.0 115-119 35.9886 37.0 37.0 37.0 37.0 37.0 120-124 35.972 37.0 37.0 37.0 37.0 37.0 125-129 35.88 37.0 37.0 37.0 37.0 37.0 130-134 35.769 37.0 37.0 37.0 37.0 37.0 135-139 35.4952 37.0 37.0 37.0 37.0 37.0 140-144 35.499900000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.2815 37.0 37.0 37.0 34.6 37.0 150-151 35.128 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 6.0 15 2.0 16 3.0 17 1.0 18 2.0 19 2.0 20 1.0 21 6.0 22 7.0 23 11.0 24 4.0 25 4.0 26 3.0 27 3.0 28 5.0 29 12.0 30 14.0 31 14.0 32 35.0 33 56.0 34 126.0 35 419.0 36 2837.0 37 426.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.474999999999994 22.95 9.45 23.125 2 30.3 24.925 27.55 17.224999999999998 3 21.725 28.449999999999996 30.75 19.075 4 24.0 34.425 23.5 18.075 5 26.650000000000002 35.099999999999994 21.15 17.1 6 22.875 38.35 21.975 16.8 7 21.6 20.549999999999997 37.574999999999996 20.275000000000002 8 23.9 24.775 26.825 24.5 9 21.925 26.3 29.25 22.525000000000002 10-14 24.97 29.160000000000004 25.765 20.105 15-19 24.335 28.125 26.735 20.805 20-24 24.52 28.384999999999998 26.355 20.74 25-29 24.745 27.855 26.685 20.715 30-34 24.03 28.275 26.52 21.175 35-39 23.685000000000002 28.345 27.67 20.3 40-44 24.375 28.095 27.205000000000002 20.325 45-49 24.15 27.565 27.485 20.8 50-54 24.23 27.944999999999997 27.405 20.419999999999998 55-59 24.03 27.450000000000003 27.79 20.73 60-64 24.39 27.425 27.47 20.715 65-69 23.74 28.134999999999998 27.21 20.915 70-74 23.905 27.744999999999997 27.750000000000004 20.599999999999998 75-79 24.29 27.3 27.82 20.59 80-84 23.905 27.36 27.655 21.08 85-89 24.36 27.765 26.790000000000003 21.085 90-94 23.51 28.155 27.400000000000002 20.935000000000002 95-99 24.91 27.794999999999998 27.325 19.97 100-104 25.135 28.294999999999998 27.105 19.465 105-109 25.11 28.255000000000003 27.084999999999997 19.55 110-114 25.19 27.375 28.03 19.405 115-119 25.44 28.365000000000002 26.834999999999997 19.36 120-124 25.8 27.865000000000002 27.139999999999997 19.195 125-129 26.14 27.975 26.36 19.525000000000002 130-134 26.555 28.485 26.21 18.75 135-139 27.08 27.465 26.745 18.709999999999997 140-144 27.505000000000003 28.355000000000004 25.735000000000003 18.404999999999998 145-149 28.89 28.1 25.259999999999998 17.75 150-151 30.325000000000003 27.8125 24.6625 17.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.0 8 1.0 9 1.0 10 1.5 11 0.5 12 0.0 13 0.5 14 0.5 15 1.0 16 1.5 17 3.0 18 3.0 19 1.0 20 1.5 21 1.0 22 0.0 23 1.0 24 2.0 25 2.0 26 2.0 27 3.0 28 3.0 29 5.0 30 10.0 31 10.5 32 15.0 33 29.0 34 40.5 35 49.0 36 63.5 37 93.0 38 136.5 39 162.0 40 170.5 41 182.0 42 208.0 43 249.0 44 283.5 45 280.0 46 248.0 47 242.5 48 253.0 49 241.5 50 200.5 51 152.0 52 126.0 53 122.5 54 116.5 55 80.5 56 50.5 57 37.5 58 24.5 59 22.5 60 18.0 61 10.5 62 7.0 63 4.0 64 1.5 65 2.5 66 2.0 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 1.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.60954208938854 83.525 2 7.403345215245408 13.5 3 0.8225939128050452 2.25 4 0.10967918837400603 0.4 5 0.027419797093501508 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027419797093501508 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit TGATATCACACCCAACAACACTAAATCAAATTACACCAAGTTCCACATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.6375000000000002 0.0 0.0 0.0 0.0 100-101 2.1125 0.0 0.0 0.0 0.0 102-103 2.4625 0.0 0.0 0.0 0.0 104-105 2.7 0.0 0.0 0.0 0.0 106-107 3.3625 0.0 0.0 0.0 0.0 108-109 3.7874999999999996 0.0 0.0 0.0 0.0 110-111 4.2 0.0 0.0 0.0 0.0 112-113 4.625 0.0 0.0 0.0 0.0 114-115 5.1625 0.0 0.0 0.0 0.0 116-117 5.775 0.0 0.0 0.0 0.0 118-119 6.575 0.0 0.0 0.0 0.0 120-121 7.3375 0.0 0.0 0.0 0.0 122-123 8.0125 0.0 0.0 0.0 0.0 124-125 8.8875 0.0 0.0 0.0 0.0 126-127 9.625 0.0 0.0 0.0 0.0 128-129 10.3 0.0 0.0 0.0 0.0 130-131 11.125 0.0 0.0 0.0 0.0 132-133 12.149999999999999 0.0 0.0 0.0 0.0 134-135 12.975000000000001 0.0 0.0 0.0 0.0 136-137 13.75 0.0 0.0 0.0 0.0 138-139 14.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTCTT 10 0.006830828 145.0 6 CGAGGTG 20 0.00593511 29.0 140-144 >>END_MODULE Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967736 spots for SRR12919374.sra Written 967736 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra Read 967717 spots for SRR12919374.sra Written 967717 spots for SRR12919374.sra SRR ids: ['SRR12919374.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7dhi4534 SRR12919374.sra spots: 19354359 blocks: [[1, 967717], [967718, 1935434], [1935435, 2903151], [2903152, 3870868], [3870869, 4838585], [4838586, 5806302], [5806303, 6774019], [6774020, 7741736], [7741737, 8709453], [8709454, 9677170], [9677171, 10644887], [10644888, 11612604], [11612605, 12580321], [12580322, 13548038], [13548039, 14515755], [14515756, 15483472], [15483473, 16451189], [16451190, 17418906], [17418907, 18386623], [18386624, 19354359]] SRR12919374 file size 6555757 SRR12919374 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919374 SRR12919374_1.fastq SRR12919374_2.fastq Input file: SRR12919374_1.fastq Paired file: SRR12919374_2.fastq trimmed: SRR12919374-trimmed-pair1.fastq, SRR12919374-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:45:14 2025 >> started Wed Feb 12 21:45:35 2025 >> done (20.151s) 19354359 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 2660 ( 0.01%) empty read pairs filtered out after trimming by size control 19351682 (99.99%) read pairs available; of these: 3852373 (19.91%) trimmed read pairs available after processing 15499309 (80.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 7 0.00% 28 2 0.00% 29 3 0.00% 30 10 0.00% 31 7 0.00% 32 10 0.00% 33 12 0.00% 34 14 0.00% 35 10 0.00% 36 7 0.00% 37 11 0.00% 38 15 0.00% 39 23 0.00% 40 27 0.00% 41 34 0.00% 42 32 0.00% 43 32 0.00% 44 33 0.00% 45 37 0.00% 46 30 0.00% 47 38 0.00% 48 69 0.00% 49 89 0.00% 50 111 0.00% 51 96 0.00% 52 113 0.00% 53 115 0.00% 54 129 0.00% 55 146 0.00% 56 176 0.00% 57 217 0.00% 58 250 0.00% 59 318 0.00% 60 378 0.00% 61 529 0.00% 62 553 0.00% 63 632 0.00% 64 643 0.00% 65 732 0.00% 66 901 0.00% 67 997 0.01% 68 1169 0.01% 69 1368 0.01% 70 1634 0.01% 71 1985 0.01% 72 2381 0.01% 73 2782 0.01% 74 3182 0.02% 75 3496 0.02% 76 3819 0.02% 77 4157 0.02% 78 4698 0.02% 79 5379 0.03% 80 5954 0.03% 81 7182 0.04% 82 8219 0.04% 83 9234 0.05% 84 10372 0.05% 85 11309 0.06% 86 12071 0.06% 87 13449 0.07% 88 14011 0.07% 89 15519 0.08% 90 17037 0.09% 91 18656 0.10% 92 21062 0.11% 93 23024 0.12% 94 24946 0.13% 95 26511 0.14% 96 28309 0.15% 97 28669 0.15% 98 29795 0.15% 99 31875 0.16% 100 33154 0.17% 101 34910 0.18% 102 37968 0.20% 103 39646 0.20% 104 42635 0.22% 105 44551 0.23% 106 45340 0.23% 107 46498 0.24% 108 47283 0.24% 109 48038 0.25% 110 49106 0.25% 111 51634 0.27% 112 54046 0.28% 113 55918 0.29% 114 58646 0.30% 115 61026 0.32% 116 62203 0.32% 117 63100 0.33% 118 62668 0.32% 119 63126 0.33% 120 65044 0.34% 121 66098 0.34% 122 67764 0.35% 123 69844 0.36% 124 71903 0.37% 125 72752 0.38% 126 74936 0.39% 127 74251 0.38% 128 74004 0.38% 129 75093 0.39% 130 74737 0.39% 131 75642 0.39% 132 76727 0.40% 133 79086 0.41% 134 80127 0.41% 135 82030 0.42% 136 82898 0.43% 137 82568 0.43% 138 82169 0.42% 139 82655 0.43% 140 81413 0.42% 141 81502 0.42% 142 82816 0.43% 143 83427 0.43% 144 86702 0.45% 145 86774 0.45% 146 87272 0.45% 147 87899 0.45% 148 88263 0.46% 149 86371 0.45% 150 87244 0.45% 151 15499309 80.09% 19351682 reads passed initial QC criterion=sequence-density sequence-density=1.14 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=13 prefix-density=1.22 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=30.70 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=5.5 sequence=TTCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=13 prefix-density=0.94 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=17.29 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.6 sequence=AGTACTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAG SRR12919374 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:46:15 Started mapping on | Feb 12 21:46:15 Finished on | Feb 12 21:48:52 Mapping speed, Million of reads per hour | 443.73 Number of input reads | 19351682 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17682680 Uniquely mapped reads % | 91.38% Average mapped length | 290.01 Number of splices: Total | 15618347 Number of splices: Annotated (sjdb) | 15354399 Number of splices: GT/AG | 15279252 Number of splices: GC/AG | 278905 Number of splices: AT/AC | 10123 Number of splices: Non-canonical | 50067 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436136 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 83074 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.73% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1232866 1232866 1232866 N_multimapping 436136 436136 436136 N_noFeature 411264 17339418 517634 N_ambiguous 357940 1550 120009 UnstrandedReadsAssigned:16913476 PositiveStrandReadsAssigned:341712 NegativeStrandReadsAssigned:17045037 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919374 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919374-trimmed-pair1.fastq SRR12919374-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,351,682 reads, 17,215,944 reads pseudoaligned [quant] estimated average fragment length: 221.835 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,433 rounds 52401 SRR12919374.ke.tsv 34699 SRR12919374.se.tsv 87100 total ==> SRR12919374.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.16 354 9.02793 Potri.005G024800.1.v4.1 1035 814.165 499 28.0906 Potri.004G059700.1.v4.1 961 740.199 59 3.65323 Potri.007G009000.2.v4.1 1416 1195.16 0 0 Potri.003G141000.2.v4.1 2943 2722.16 480.973 8.09803 Potri.016G087400.1.v4.1 270 97.2523 764.017 360.061 Potri.015G069301.1.v4.1 564 349.292 0 0 Potri.010G195200.1.v4.1 1773 1552.16 45 1.32876 Potri.012G127500.1.v4.1 977 756.18 488 29.5779 ==> SRR12919374.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 60 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR12919374 completed mapping pipeline successfully