Starting /dee2/code/volunteer_pipeline.sh SRR12919375 current disk space = 3050878373888 free memory = 1456955872 SRR12919375 SRAfilesize e6f1295f0aca94ff61f447c426903ed8 SRR12919375.sra SRR12919375.sra file validated SRR12919375 is paired end SRR12919375 is conventional basespace SRR12919375 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919375_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6325 37.0 37.0 37.0 37.0 37.0 2 36.2675 37.0 37.0 37.0 37.0 37.0 3 36.621 37.0 37.0 37.0 37.0 37.0 4 36.5945 37.0 37.0 37.0 37.0 37.0 5 36.667 37.0 37.0 37.0 37.0 37.0 6 36.6665 37.0 37.0 37.0 37.0 37.0 7 36.601 37.0 37.0 37.0 37.0 37.0 8 36.644 37.0 37.0 37.0 37.0 37.0 9 36.6345 37.0 37.0 37.0 37.0 37.0 10-14 36.6406 37.0 37.0 37.0 37.0 37.0 15-19 36.61319999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.605199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.547000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.5451 37.0 37.0 37.0 37.0 37.0 35-39 36.51520000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.478699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.474000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.41289999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.417100000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3654 37.0 37.0 37.0 37.0 37.0 65-69 36.402699999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3262 37.0 37.0 37.0 37.0 37.0 75-79 36.320499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3418 37.0 37.0 37.0 37.0 37.0 85-89 36.267999999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.2589 37.0 37.0 37.0 37.0 37.0 95-99 36.2329 37.0 37.0 37.0 37.0 37.0 100-104 36.184200000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.2117 37.0 37.0 37.0 37.0 37.0 110-114 36.087 37.0 37.0 37.0 37.0 37.0 115-119 36.1308 37.0 37.0 37.0 37.0 37.0 120-124 36.087700000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.056799999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9952 37.0 37.0 37.0 37.0 37.0 135-139 35.9581 37.0 37.0 37.0 37.0 37.0 140-144 35.794799999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.7698 37.0 37.0 37.0 37.0 37.0 150-151 35.551 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 2.0 25 3.0 26 4.0 27 11.0 28 12.0 29 14.0 30 23.0 31 33.0 32 37.0 33 61.0 34 112.0 35 299.0 36 2973.0 37 414.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.675000000000004 13.4 4.5249999999999995 33.4 2 20.0652938221999 12.004018081366148 37.36815670517328 30.562531391260674 3 17.525 16.7 29.549999999999997 36.225 4 21.925 24.275 24.85 28.95 5 21.375 31.025000000000002 24.575 23.025000000000002 6 20.0 34.55 23.825 21.625 7 14.975 27.025 40.2 17.8 8 16.975 26.6 33.4 23.025000000000002 9 17.125 23.0 35.9 23.974999999999998 10-14 19.66 30.185000000000002 27.51 22.645 15-19 20.41 27.26 27.99 24.34 20-24 19.875 28.465 27.82 23.84 25-29 19.75 28.74 27.884999999999998 23.625 30-34 19.885 28.52 27.345000000000002 24.25 35-39 19.72 28.685 26.97 24.625 40-44 20.26 28.65 27.200000000000003 23.89 45-49 20.935000000000002 28.470000000000002 27.500000000000004 23.095 50-54 20.849999999999998 27.955000000000002 27.33 23.865 55-59 20.055 29.409999999999997 27.22 23.315 60-64 20.48 28.005000000000003 27.47 24.044999999999998 65-69 20.200000000000003 28.425 27.33 24.044999999999998 70-74 20.4 28.405 27.6 23.595 75-79 20.03 28.67 27.279999999999998 24.02 80-84 20.505000000000003 28.04 27.855 23.599999999999998 85-89 20.555 29.360000000000003 26.619999999999997 23.465 90-94 20.515 28.455000000000002 27.589999999999996 23.44 95-99 20.57 27.98 27.534999999999997 23.915 100-104 20.705000000000002 28.275 27.169999999999998 23.849999999999998 105-109 20.805 28.53 27.045 23.62 110-114 20.76 28.860000000000003 26.525 23.855 115-119 21.245 28.64 26.755000000000003 23.36 120-124 20.735 28.655 26.474999999999998 24.135 125-129 21.12 28.155 26.465 24.26 130-134 21.43 28.689999999999998 26.145000000000003 23.735 135-139 20.735 28.225 27.169999999999998 23.87 140-144 20.965 27.884999999999998 26.68 24.47 145-149 20.635 28.205000000000002 26.979999999999997 24.18 150-151 20.3125 29.037499999999998 25.8125 24.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 1.5 22 2.5 23 1.0 24 3.5 25 7.0 26 7.0 27 12.0 28 12.0 29 8.5 30 12.0 31 21.0 32 34.0 33 36.0 34 41.0 35 67.5 36 84.5 37 105.5 38 137.5 39 156.5 40 173.5 41 205.0 42 226.5 43 237.0 44 247.0 45 262.0 46 256.0 47 250.0 48 243.0 49 213.0 50 189.0 51 168.0 52 157.5 53 118.0 54 73.0 55 53.0 56 49.0 57 38.5 58 23.5 59 20.5 60 15.5 61 7.0 62 4.5 63 6.5 64 4.0 65 2.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.22179416620804 82.875 2 7.649972482113373 13.900000000000002 3 0.9631260319207484 2.625 4 0.1651073197578426 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.3125 0.0 0.0 0.0 0.0 106-107 2.5999999999999996 0.0 0.0 0.0 0.0 108-109 2.9000000000000004 0.0 0.0 0.0 0.0 110-111 3.225 0.0 0.0 0.0 0.0 112-113 3.6125 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.612500000000001 0.0 0.0 0.0 0.0 118-119 5.199999999999999 0.0 0.0 0.0 0.0 120-121 5.7875 0.0 0.0 0.0 0.0 122-123 6.1625 0.0 0.0 0.0 0.0 124-125 6.75 0.0 0.0 0.0 0.0 126-127 7.4 0.0 0.0 0.0 0.0 128-129 8.087499999999999 0.0 0.0 0.0 0.0 130-131 8.5625 0.0 0.0 0.0 0.0 132-133 9.1375 0.0 0.0 0.0 0.0 134-135 9.7125 0.0 0.0 0.0 0.0 136-137 10.375 0.0 0.0 0.0 0.0 138-139 10.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919375 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919375_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2905 37.0 37.0 37.0 37.0 37.0 2 36.4245 37.0 37.0 37.0 37.0 37.0 3 36.3665 37.0 37.0 37.0 37.0 37.0 4 36.402 37.0 37.0 37.0 37.0 37.0 5 36.473 37.0 37.0 37.0 37.0 37.0 6 36.506 37.0 37.0 37.0 37.0 37.0 7 36.4185 37.0 37.0 37.0 37.0 37.0 8 36.4495 37.0 37.0 37.0 37.0 37.0 9 36.458 37.0 37.0 37.0 37.0 37.0 10-14 36.4382 37.0 37.0 37.0 37.0 37.0 15-19 36.393699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3936 37.0 37.0 37.0 37.0 37.0 25-29 36.3434 37.0 37.0 37.0 37.0 37.0 30-34 36.2927 37.0 37.0 37.0 37.0 37.0 35-39 36.316700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2626 37.0 37.0 37.0 37.0 37.0 45-49 36.2584 37.0 37.0 37.0 37.0 37.0 50-54 36.2033 37.0 37.0 37.0 37.0 37.0 55-59 36.2068 37.0 37.0 37.0 37.0 37.0 60-64 36.2187 37.0 37.0 37.0 37.0 37.0 65-69 36.1809 37.0 37.0 37.0 37.0 37.0 70-74 36.1304 37.0 37.0 37.0 37.0 37.0 75-79 36.098 37.0 37.0 37.0 37.0 37.0 80-84 36.055099999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.0587 37.0 37.0 37.0 37.0 37.0 90-94 35.95190000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.053599999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.025400000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.927200000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.9541 37.0 37.0 37.0 37.0 37.0 115-119 35.8714 37.0 37.0 37.0 37.0 37.0 120-124 35.8199 37.0 37.0 37.0 37.0 37.0 125-129 35.7341 37.0 37.0 37.0 37.0 37.0 130-134 35.6583 37.0 37.0 37.0 37.0 37.0 135-139 35.44340000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.3442 37.0 37.0 37.0 37.0 37.0 145-149 35.194500000000005 37.0 37.0 37.0 29.8 37.0 150-151 35.02775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 3.0 15 2.0 16 1.0 17 1.0 18 4.0 19 0.0 20 1.0 21 2.0 22 4.0 23 4.0 24 5.0 25 4.0 26 5.0 27 10.0 28 12.0 29 15.0 30 12.0 31 37.0 32 52.0 33 82.0 34 183.0 35 443.0 36 2725.0 37 388.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.475 25.6 6.525 22.400000000000002 2 27.200000000000003 25.95 29.675 17.175 3 21.15 28.225 31.75 18.875 4 23.95 34.35 22.35 19.35 5 25.074999999999996 36.175000000000004 21.85 16.900000000000002 6 20.599999999999998 39.2 21.825 18.375 7 21.2 23.65 37.2 17.95 8 20.7 26.525 27.900000000000002 24.875 9 22.725 24.5 30.325000000000003 22.45 10-14 23.71 28.660000000000004 26.305 21.325 15-19 23.965 27.88 27.29 20.865000000000002 20-24 23.41 28.73 27.72 20.14 25-29 23.755000000000003 28.244999999999997 27.505000000000003 20.495 30-34 23.69 28.055000000000003 27.57 20.685000000000002 35-39 23.555 28.285 27.275 20.885 40-44 23.39 27.889999999999997 27.834999999999997 20.885 45-49 23.27 27.839999999999996 27.525 21.365000000000002 50-54 23.815 27.279999999999998 27.765 21.14 55-59 22.845 27.825 27.985 21.345 60-64 23.385 27.575 27.99 21.05 65-69 23.549999999999997 27.485 27.395000000000003 21.57 70-74 23.105 27.584999999999997 27.79 21.52 75-79 24.115000000000002 27.21 27.74 20.935000000000002 80-84 23.525 27.485 28.335 20.655 85-89 23.54 27.825 27.6 21.035 90-94 24.215 27.400000000000002 27.47 20.915 95-99 22.865 27.82 28.305000000000003 21.01 100-104 23.91 28.335 26.755000000000003 21.0 105-109 24.8 27.925 26.640000000000004 20.635 110-114 23.465 28.98 27.04 20.515 115-119 24.58 28.199999999999996 27.215 20.005 120-124 25.14 28.065 26.669999999999998 20.125 125-129 25.085 28.000000000000004 26.450000000000003 20.465 130-134 25.145 27.42 27.305 20.13 135-139 26.25 27.21 26.705000000000002 19.835 140-144 25.650000000000002 27.894999999999996 27.139999999999997 19.314999999999998 145-149 26.784999999999997 27.389999999999997 26.38 19.445 150-151 26.7125 27.800000000000004 26.224999999999998 19.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.0 24 1.0 25 2.0 26 3.0 27 6.0 28 9.5 29 13.0 30 13.5 31 19.0 32 26.0 33 32.5 34 46.0 35 58.5 36 75.5 37 105.5 38 127.5 39 151.0 40 187.5 41 221.5 42 241.0 43 250.0 44 256.5 45 258.0 46 261.0 47 250.0 48 235.0 49 212.0 50 191.0 51 162.0 52 126.0 53 100.0 54 75.5 55 59.5 56 53.5 57 45.5 58 33.5 59 26.0 60 15.0 61 8.0 62 4.0 63 6.0 64 5.0 65 0.5 66 1.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 91.56361637812586 83.3 2 7.337180544105523 13.350000000000001 3 0.8244023083264632 2.25 4 0.24732069249793898 0.8999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02748007694421544 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.6500000000000004 0.0 0.0 0.0 0.0 108-109 2.95 0.0 0.0 0.0 0.0 110-111 3.275 0.0 0.0 0.0 0.0 112-113 3.6625 0.0 0.0 0.0 0.0 114-115 4.0875 0.0 0.0 0.0 0.0 116-117 4.6875 0.0 0.0 0.0 0.0 118-119 5.275 0.0 0.0 0.0 0.0 120-121 5.85 0.0 0.0 0.0 0.0 122-123 6.237500000000001 0.0 0.0 0.0 0.0 124-125 6.8375 0.0 0.0 0.0 0.0 126-127 7.4625 0.0 0.0 0.0 0.0 128-129 8.1375 0.0 0.0 0.0 0.0 130-131 8.587499999999999 0.0 0.0 0.0 0.0 132-133 9.1625 0.0 0.0 0.0 0.0 134-135 9.6875 0.0 0.0 0.0 0.0 136-137 10.375 0.0 0.0 0.0 0.0 138-139 10.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771180 spots for SRR12919375.sra Written 771180 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra Read 771170 spots for SRR12919375.sra Written 771170 spots for SRR12919375.sra SRR ids: ['SRR12919375.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7tqi826b SRR12919375.sra spots: 15423410 blocks: [[1, 771170], [771171, 1542340], [1542341, 2313510], [2313511, 3084680], [3084681, 3855850], [3855851, 4627020], [4627021, 5398190], [5398191, 6169360], [6169361, 6940530], [6940531, 7711700], [7711701, 8482870], [8482871, 9254040], [9254041, 10025210], [10025211, 10796380], [10796381, 11567550], [11567551, 12338720], [12338721, 13109890], [13109891, 13881060], [13881061, 14652230], [14652231, 15423410]] SRR12919375 file size 5219849 SRR12919375 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919375 SRR12919375_1.fastq SRR12919375_2.fastq Input file: SRR12919375_1.fastq Paired file: SRR12919375_2.fastq trimmed: SRR12919375-trimmed-pair1.fastq, SRR12919375-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:18:03 2025 >> started Wed Feb 12 21:18:30 2025 >> done (27.224s) 15423410 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 3901 ( 0.03%) empty read pairs filtered out after trimming by size control 15419485 (99.97%) read pairs available; of these: 2441810 (15.84%) trimmed read pairs available after processing 12977675 (84.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 6 0.00% 28 7 0.00% 29 5 0.00% 30 8 0.00% 31 7 0.00% 32 6 0.00% 33 9 0.00% 34 8 0.00% 35 19 0.00% 36 12 0.00% 37 12 0.00% 38 17 0.00% 39 18 0.00% 40 27 0.00% 41 17 0.00% 42 20 0.00% 43 32 0.00% 44 35 0.00% 45 26 0.00% 46 42 0.00% 47 34 0.00% 48 52 0.00% 49 83 0.00% 50 64 0.00% 51 97 0.00% 52 122 0.00% 53 113 0.00% 54 112 0.00% 55 133 0.00% 56 149 0.00% 57 179 0.00% 58 237 0.00% 59 245 0.00% 60 331 0.00% 61 376 0.00% 62 450 0.00% 63 527 0.00% 64 575 0.00% 65 655 0.00% 66 685 0.00% 67 800 0.01% 68 869 0.01% 69 1105 0.01% 70 1340 0.01% 71 1513 0.01% 72 1905 0.01% 73 2061 0.01% 74 2336 0.02% 75 2631 0.02% 76 2906 0.02% 77 3239 0.02% 78 3590 0.02% 79 4014 0.03% 80 4595 0.03% 81 5282 0.03% 82 6047 0.04% 83 6617 0.04% 84 7528 0.05% 85 8204 0.05% 86 8753 0.06% 87 9197 0.06% 88 9824 0.06% 89 10391 0.07% 90 11740 0.08% 91 12611 0.08% 92 13846 0.09% 93 15299 0.10% 94 16329 0.11% 95 17272 0.11% 96 18376 0.12% 97 18978 0.12% 98 19165 0.12% 99 20717 0.13% 100 21160 0.14% 101 22237 0.14% 102 23834 0.15% 103 24807 0.16% 104 26061 0.17% 105 27553 0.18% 106 27789 0.18% 107 28632 0.19% 108 29234 0.19% 109 29810 0.19% 110 30185 0.20% 111 31625 0.21% 112 32689 0.21% 113 33407 0.22% 114 35017 0.23% 115 36545 0.24% 116 37174 0.24% 117 38365 0.25% 118 38015 0.25% 119 38445 0.25% 120 39861 0.26% 121 40755 0.26% 122 40621 0.26% 123 42286 0.27% 124 43534 0.28% 125 43806 0.28% 126 45917 0.30% 127 46560 0.30% 128 46530 0.30% 129 47484 0.31% 130 47526 0.31% 131 47455 0.31% 132 48334 0.31% 133 49407 0.32% 134 50050 0.32% 135 51011 0.33% 136 51821 0.34% 137 51918 0.34% 138 52518 0.34% 139 53610 0.35% 140 53309 0.35% 141 53812 0.35% 142 53788 0.35% 143 53798 0.35% 144 55958 0.36% 145 56242 0.36% 146 56555 0.37% 147 56936 0.37% 148 57418 0.37% 149 57301 0.37% 150 58454 0.38% 151 12977675 84.16% 15419485 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.64 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=72.61 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.0 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=21 prefix-density=0.72 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=44.34 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12919375 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:19:11 Started mapping on | Feb 12 21:19:11 Finished on | Feb 12 21:21:37 Mapping speed, Million of reads per hour | 380.21 Number of input reads | 15419485 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14381147 Uniquely mapped reads % | 93.27% Average mapped length | 292.08 Number of splices: Total | 13804313 Number of splices: Annotated (sjdb) | 13546992 Number of splices: GT/AG | 13510023 Number of splices: GC/AG | 249164 Number of splices: AT/AC | 9364 Number of splices: Non-canonical | 35762 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378162 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 78487 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 660176 660176 660176 N_multimapping 378162 378162 378162 N_noFeature 489613 14177959 575360 N_ambiguous 214934 844 96978 UnstrandedReadsAssigned:13676600 PositiveStrandReadsAssigned:202344 NegativeStrandReadsAssigned:13708809 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919375 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919375-trimmed-pair1.fastq SRR12919375-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,419,485 reads, 13,848,767 reads pseudoaligned [quant] estimated average fragment length: 241.151 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR12919375.ke.tsv 34699 SRR12919375.se.tsv 87100 total ==> SRR12919375.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.85 288 11.6562 Potri.005G024800.1.v4.1 1035 794.849 234 21.1831 Potri.004G059700.1.v4.1 961 721.085 74 7.38421 Potri.007G009000.2.v4.1 1416 1175.85 0 0 Potri.003G141000.2.v4.1 2943 2702.85 516.864 13.7598 Potri.016G087400.1.v4.1 270 93.4138 821 632.398 Potri.015G069301.1.v4.1 564 336.193 0 0 Potri.010G195200.1.v4.1 1773 1532.85 5 0.234709 Potri.012G127500.1.v4.1 977 736.989 156 15.2308 ==> SRR12919375.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 518 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 176 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR12919375 completed mapping pipeline successfully