Starting /dee2/code/volunteer_pipeline.sh SRR12919376 current disk space = 3050919157760 free memory = 1413936204 SRR12919376 SRAfilesize 46c0d5023d66fe6b3b3e11612cbd82c3 SRR12919376.sra SRR12919376.sra file validated SRR12919376 is paired end SRR12919376 is conventional basespace SRR12919376 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919376_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5945 37.0 37.0 37.0 37.0 37.0 2 36.35825 37.0 37.0 37.0 37.0 37.0 3 36.614 37.0 37.0 37.0 37.0 37.0 4 36.636 37.0 37.0 37.0 37.0 37.0 5 36.6995 37.0 37.0 37.0 37.0 37.0 6 36.7145 37.0 37.0 37.0 37.0 37.0 7 36.645 37.0 37.0 37.0 37.0 37.0 8 36.705 37.0 37.0 37.0 37.0 37.0 9 36.6155 37.0 37.0 37.0 37.0 37.0 10-14 36.681 37.0 37.0 37.0 37.0 37.0 15-19 36.6595 37.0 37.0 37.0 37.0 37.0 20-24 36.608000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.61279999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.518899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5391 37.0 37.0 37.0 37.0 37.0 40-44 36.5377 37.0 37.0 37.0 37.0 37.0 45-49 36.4566 37.0 37.0 37.0 37.0 37.0 50-54 36.4733 37.0 37.0 37.0 37.0 37.0 55-59 36.443599999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4195 37.0 37.0 37.0 37.0 37.0 65-69 36.4029 37.0 37.0 37.0 37.0 37.0 70-74 36.38549999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3503 37.0 37.0 37.0 37.0 37.0 80-84 36.353 37.0 37.0 37.0 37.0 37.0 85-89 36.25449999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2599 37.0 37.0 37.0 37.0 37.0 95-99 36.2577 37.0 37.0 37.0 37.0 37.0 100-104 36.185199999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1768 37.0 37.0 37.0 37.0 37.0 110-114 36.1564 37.0 37.0 37.0 37.0 37.0 115-119 36.1275 37.0 37.0 37.0 37.0 37.0 120-124 36.1049 37.0 37.0 37.0 37.0 37.0 125-129 36.026599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9244 37.0 37.0 37.0 37.0 37.0 135-139 35.79 37.0 37.0 37.0 37.0 37.0 140-144 35.6387 37.0 37.0 37.0 37.0 37.0 145-149 35.6103 37.0 37.0 37.0 37.0 37.0 150-151 35.35575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 4.0 25 2.0 26 2.0 27 8.0 28 11.0 29 20.0 30 23.0 31 22.0 32 47.0 33 68.0 34 106.0 35 295.0 36 2971.0 37 419.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.75 12.725 4.775 36.75 2 18.38733986435569 12.660135644310474 36.04621954282843 32.9063049485054 3 16.675 17.349999999999998 28.325 37.65 4 22.05 24.125 24.975 28.849999999999998 5 22.85 30.65 25.324999999999996 21.175 6 20.349999999999998 34.25 23.474999999999998 21.925 7 14.924999999999999 26.3 41.575 17.2 8 16.275000000000002 27.275 31.6 24.85 9 17.625 23.925 35.3 23.150000000000002 10-14 20.075000000000003 29.575000000000003 27.345000000000002 23.005 15-19 20.035 28.485 27.6 23.880000000000003 20-24 20.345 28.475 27.875 23.305 25-29 20.424999999999997 28.055000000000003 27.93 23.59 30-34 20.29 28.13 27.83 23.75 35-39 20.275000000000002 28.065 27.139999999999997 24.52 40-44 19.465 28.09 28.075 24.37 45-49 20.59 28.525 26.985 23.9 50-54 20.315 28.65 27.689999999999998 23.345 55-59 20.315 27.74 28.13 23.815 60-64 20.27 27.584999999999997 28.15 23.995 65-69 20.349999999999998 27.98 27.775 23.895 70-74 20.785 28.939999999999998 26.484999999999996 23.79 75-79 20.27 27.715 27.245 24.77 80-84 20.495 28.915000000000003 27.345000000000002 23.244999999999997 85-89 21.01 28.005000000000003 27.565 23.419999999999998 90-94 20.44 27.49 28.360000000000003 23.71 95-99 20.4 27.49 27.500000000000004 24.610000000000003 100-104 20.605 28.67 26.700000000000003 24.025 105-109 20.055 28.294999999999998 27.205000000000002 24.445 110-114 20.865000000000002 27.965 27.589999999999996 23.580000000000002 115-119 20.495 28.285 27.305 23.915 120-124 21.310000000000002 28.32 26.38 23.990000000000002 125-129 21.215 28.165000000000003 26.615 24.005000000000003 130-134 21.05 28.095 26.91 23.945 135-139 21.32 27.715 26.740000000000002 24.224999999999998 140-144 21.265 28.105000000000004 26.375 24.255 145-149 21.205 28.005000000000003 26.845000000000002 23.945 150-151 21.2625 27.537499999999998 26.5375 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 2.0 24 3.0 25 4.0 26 3.5 27 6.5 28 11.5 29 17.0 30 20.0 31 24.0 32 29.0 33 41.0 34 54.5 35 52.0 36 69.5 37 100.5 38 115.0 39 139.0 40 170.5 41 207.5 42 222.5 43 234.0 44 261.5 45 264.5 46 273.5 47 265.0 48 235.5 49 215.0 50 189.0 51 169.5 52 144.0 53 115.5 54 92.0 55 64.5 56 53.0 57 38.5 58 25.0 59 21.5 60 13.0 61 10.5 62 9.5 63 4.0 64 0.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.76026637069923 81.77499999999999 2 7.796892341842397 14.05 3 1.1653718091009988 3.15 4 0.24972253052164264 0.8999999999999999 5 0.02774694783573807 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.175 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.7999999999999998 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.375 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.1125 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 5.050000000000001 0.0 0.0 0.0 0.0 124-125 5.5125 0.0 0.0 0.0 0.0 126-127 6.225 0.0 0.0 0.0 0.0 128-129 6.825 0.0 0.0 0.0 0.0 130-131 7.325 0.0 0.0 0.0 0.0 132-133 8.0375 0.0 0.0 0.0 0.0 134-135 8.4625 0.0 0.0 0.0 0.0 136-137 9.1625 0.0 0.0 0.0 0.0 138-139 9.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919376 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919376_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.277 37.0 37.0 37.0 37.0 37.0 2 36.0485 37.0 37.0 37.0 37.0 37.0 3 36.17 37.0 37.0 37.0 37.0 37.0 4 36.24 37.0 37.0 37.0 37.0 37.0 5 36.3 37.0 37.0 37.0 37.0 37.0 6 36.321 37.0 37.0 37.0 37.0 37.0 7 36.267 37.0 37.0 37.0 37.0 37.0 8 36.2565 37.0 37.0 37.0 37.0 37.0 9 36.435 37.0 37.0 37.0 37.0 37.0 10-14 36.281099999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2848 37.0 37.0 37.0 37.0 37.0 20-24 36.281800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.2066 37.0 37.0 37.0 37.0 37.0 30-34 36.1809 37.0 37.0 37.0 37.0 37.0 35-39 36.210899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.1985 37.0 37.0 37.0 37.0 37.0 45-49 36.1956 37.0 37.0 37.0 37.0 37.0 50-54 36.130900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1029 37.0 37.0 37.0 37.0 37.0 60-64 36.0937 37.0 37.0 37.0 37.0 37.0 65-69 36.0262 37.0 37.0 37.0 37.0 37.0 70-74 35.9743 37.0 37.0 37.0 37.0 37.0 75-79 35.9923 37.0 37.0 37.0 37.0 37.0 80-84 35.92909999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.886 37.0 37.0 37.0 37.0 37.0 90-94 35.88719999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.89209999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.891400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.8403 37.0 37.0 37.0 37.0 37.0 110-114 35.815000000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.741 37.0 37.0 37.0 37.0 37.0 120-124 35.7443 37.0 37.0 37.0 37.0 37.0 125-129 35.7205 37.0 37.0 37.0 37.0 37.0 130-134 35.5572 37.0 37.0 37.0 37.0 37.0 135-139 35.4191 37.0 37.0 37.0 37.0 37.0 140-144 35.3735 37.0 37.0 37.0 34.6 37.0 145-149 35.317699999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.109750000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 3.0 15 1.0 16 0.0 17 2.0 18 1.0 19 2.0 20 2.0 21 3.0 22 3.0 23 7.0 24 5.0 25 5.0 26 4.0 27 18.0 28 8.0 29 17.0 30 25.0 31 32.0 32 59.0 33 96.0 34 185.0 35 510.0 36 2688.0 37 319.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.625 24.224999999999998 7.825 25.324999999999996 2 27.0 26.974999999999998 28.499999999999996 17.525 3 20.599999999999998 29.575000000000003 31.324999999999996 18.5 4 24.125 33.4 23.45 19.025 5 25.275 36.825 21.025 16.875 6 21.725 39.125 21.65 17.5 7 21.925 22.075 36.625 19.375 8 21.025 26.650000000000002 28.7 23.625 9 21.725 25.825 29.549999999999997 22.900000000000002 10-14 23.5 29.325000000000003 26.02 21.154999999999998 15-19 23.53 27.644999999999996 27.889999999999997 20.935000000000002 20-24 23.04 27.58 27.794999999999998 21.584999999999997 25-29 23.305 28.7 26.83 21.165 30-34 22.855 27.794999999999998 28.275 21.075 35-39 22.54 28.015 28.225 21.22 40-44 23.175 28.199999999999996 27.750000000000004 20.875 45-49 22.81 28.050000000000004 28.1 21.04 50-54 22.59 27.87 28.134999999999998 21.404999999999998 55-59 23.355 28.165000000000003 27.16 21.32 60-64 23.135 27.650000000000002 27.67 21.545 65-69 23.815 27.87 27.46 20.855 70-74 23.465 27.839999999999996 27.325 21.37 75-79 23.825 27.655 27.175 21.345 80-84 23.075000000000003 28.175 27.42 21.33 85-89 22.78 27.965 26.915 22.34 90-94 23.595 27.58 27.66 21.165 95-99 23.775 27.985 27.275 20.965 100-104 23.580000000000002 28.439999999999998 27.005000000000003 20.974999999999998 105-109 24.235 27.955000000000002 26.695 21.115000000000002 110-114 23.53 28.139999999999997 27.605 20.724999999999998 115-119 24.25 28.110000000000003 26.52 21.12 120-124 23.605 27.915 27.560000000000002 20.919999999999998 125-129 24.89 28.22 26.435 20.455000000000002 130-134 24.75 27.955000000000002 26.77 20.525 135-139 24.295 27.665 27.11 20.93 140-144 25.650000000000002 27.560000000000002 26.590000000000003 20.200000000000003 145-149 25.919999999999998 27.755000000000003 26.195 20.13 150-151 25.624999999999996 28.075 25.974999999999998 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 3.5 26 4.0 27 7.0 28 9.5 29 12.0 30 19.5 31 16.5 32 18.5 33 32.0 34 45.5 35 57.5 36 72.5 37 93.0 38 109.5 39 142.0 40 186.0 41 208.5 42 245.0 43 276.0 44 275.5 45 273.5 46 259.0 47 255.5 48 256.0 49 238.0 50 204.5 51 149.0 52 108.5 53 100.0 54 86.0 55 61.0 56 48.0 57 34.5 58 22.0 59 19.0 60 12.0 61 6.5 62 5.5 63 3.0 64 1.0 65 0.5 66 0.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 1.0 85 1.0 86 0.0 87 1.0 88 1.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.3 #Duplication Level Percentage of deduplicated Percentage of total 1 90.97452934662236 82.15 2 7.751937984496124 14.000000000000002 3 0.9966777408637874 2.7 4 0.1937984496124031 0.7000000000000001 5 0.0 0.0 6 0.08305647840531562 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit AAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.175 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.375 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.1875 0.0 0.0 0.0 0.0 120-121 4.675000000000001 0.0 0.0 0.0 0.0 122-123 5.1125 0.0 0.0 0.0 0.0 124-125 5.550000000000001 0.0 0.0 0.0 0.0 126-127 6.2125 0.0 0.0 0.0 0.0 128-129 6.8 0.0 0.0 0.0 0.0 130-131 7.3 0.0 0.0 0.0 0.0 132-133 8.0 0.0 0.0 0.0 0.0 134-135 8.4125 0.0 0.0 0.0 0.0 136-137 9.125 0.0 0.0 0.0 0.0 138-139 9.662500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAATT 10 0.006830828 145.0 7 AAAAAAA 125 0.005090842 9.28 130-134 >>END_MODULE Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758268 spots for SRR12919376.sra Written 758268 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra Read 758264 spots for SRR12919376.sra Written 758264 spots for SRR12919376.sra SRR ids: ['SRR12919376.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wkluat39 SRR12919376.sra spots: 15165284 blocks: [[1, 758264], [758265, 1516528], [1516529, 2274792], [2274793, 3033056], [3033057, 3791320], [3791321, 4549584], [4549585, 5307848], [5307849, 6066112], [6066113, 6824376], [6824377, 7582640], [7582641, 8340904], [8340905, 9099168], [9099169, 9857432], [9857433, 10615696], [10615697, 11373960], [11373961, 12132224], [12132225, 12890488], [12890489, 13648752], [13648753, 14407016], [14407017, 15165284]] SRR12919376 file size 5132126 SRR12919376 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919376 SRR12919376_1.fastq SRR12919376_2.fastq Input file: SRR12919376_1.fastq Paired file: SRR12919376_2.fastq trimmed: SRR12919376-trimmed-pair1.fastq, SRR12919376-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:11:41 2025 >> started Wed Feb 12 21:12:06 2025 >> done (25.472s) 15165284 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 552 ( 0.00%) empty read pairs filtered out after trimming by size control 15164719 (100.00%) read pairs available; of these: 2341596 (15.44%) trimmed read pairs available after processing 12823123 (84.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 5 0.00% 24 2 0.00% 25 5 0.00% 26 7 0.00% 27 3 0.00% 28 6 0.00% 29 10 0.00% 30 3 0.00% 31 3 0.00% 32 6 0.00% 33 7 0.00% 34 8 0.00% 35 11 0.00% 36 9 0.00% 37 8 0.00% 38 7 0.00% 39 11 0.00% 40 14 0.00% 41 17 0.00% 42 12 0.00% 43 17 0.00% 44 16 0.00% 45 18 0.00% 46 25 0.00% 47 28 0.00% 48 24 0.00% 49 39 0.00% 50 49 0.00% 51 44 0.00% 52 58 0.00% 53 71 0.00% 54 75 0.00% 55 85 0.00% 56 80 0.00% 57 112 0.00% 58 125 0.00% 59 144 0.00% 60 201 0.00% 61 238 0.00% 62 252 0.00% 63 291 0.00% 64 330 0.00% 65 403 0.00% 66 414 0.00% 67 499 0.00% 68 522 0.00% 69 652 0.00% 70 799 0.01% 71 903 0.01% 72 989 0.01% 73 1172 0.01% 74 1454 0.01% 75 1502 0.01% 76 1750 0.01% 77 2021 0.01% 78 2231 0.01% 79 2656 0.02% 80 2857 0.02% 81 3379 0.02% 82 4062 0.03% 83 4526 0.03% 84 5153 0.03% 85 5614 0.04% 86 6051 0.04% 87 6571 0.04% 88 7157 0.05% 89 7794 0.05% 90 8682 0.06% 91 9601 0.06% 92 10487 0.07% 93 11717 0.08% 94 12853 0.08% 95 13941 0.09% 96 14687 0.10% 97 15275 0.10% 98 16233 0.11% 99 16918 0.11% 100 18012 0.12% 101 19166 0.13% 102 20132 0.13% 103 22030 0.15% 104 23278 0.15% 105 24208 0.16% 106 24982 0.16% 107 26301 0.17% 108 27182 0.18% 109 27685 0.18% 110 28470 0.19% 111 29712 0.20% 112 30830 0.20% 113 32341 0.21% 114 33861 0.22% 115 34757 0.23% 116 35643 0.24% 117 36959 0.24% 118 37500 0.25% 119 38174 0.25% 120 38939 0.26% 121 39439 0.26% 122 40675 0.27% 123 41373 0.27% 124 43526 0.29% 125 43780 0.29% 126 45483 0.30% 127 45904 0.30% 128 46307 0.31% 129 47094 0.31% 130 47814 0.32% 131 47783 0.32% 132 49149 0.32% 133 50355 0.33% 134 50552 0.33% 135 51509 0.34% 136 52812 0.35% 137 53010 0.35% 138 53191 0.35% 139 54173 0.36% 140 54181 0.36% 141 54094 0.36% 142 54546 0.36% 143 55533 0.37% 144 56655 0.37% 145 57762 0.38% 146 57462 0.38% 147 57759 0.38% 148 58528 0.39% 149 58435 0.39% 150 58535 0.39% 151 12823123 84.56% 15164719 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=18 prefix-density=0.83 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=12.28 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.3 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTG criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=21 prefix-density=0.98 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=51.89 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.0 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12919376 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:12:59 Started mapping on | Feb 12 21:12:59 Finished on | Feb 12 21:15:01 Mapping speed, Million of reads per hour | 447.48 Number of input reads | 15164719 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14240462 Uniquely mapped reads % | 93.91% Average mapped length | 292.78 Number of splices: Total | 13824692 Number of splices: Annotated (sjdb) | 13564106 Number of splices: GT/AG | 13539907 Number of splices: GC/AG | 242604 Number of splices: AT/AC | 7800 Number of splices: Non-canonical | 34381 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361009 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 21163 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 563248 563248 563248 N_multimapping 361009 361009 361009 N_noFeature 408005 14068309 473379 N_ambiguous 215304 639 108260 UnstrandedReadsAssigned:13617153 PositiveStrandReadsAssigned:171514 NegativeStrandReadsAssigned:13658823 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919376 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919376-trimmed-pair1.fastq SRR12919376-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,164,719 reads, 13,717,559 reads pseudoaligned [quant] estimated average fragment length: 243.726 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52401 SRR12919376.ke.tsv 34699 SRR12919376.se.tsv 87100 total ==> SRR12919376.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.27 417 17.3577 Potri.005G024800.1.v4.1 1035 792.274 248 23.1312 Potri.004G059700.1.v4.1 961 718.503 21 2.1598 Potri.007G009000.2.v4.1 1416 1173.27 0 0 Potri.003G141000.2.v4.1 2943 2700.27 329.894 9.02793 Potri.016G087400.1.v4.1 270 93.0837 492 390.583 Potri.015G069301.1.v4.1 564 333.992 0 0 Potri.010G195200.1.v4.1 1773 1530.27 11 0.531185 Potri.012G127500.1.v4.1 977 734.435 374 37.6305 ==> SRR12919376.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 167 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 67 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 13 SRR12919376 completed mapping pipeline successfully