Starting /dee2/code/volunteer_pipeline.sh SRR12919377 current disk space = 3050696310784 free memory = 1456853416 SRR12919377 SRAfilesize be50617806caeec57fa94beabaf4149e SRR12919377.sra SRR12919377.sra file validated SRR12919377 is paired end SRR12919377 is conventional basespace SRR12919377 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919377_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59 37.0 37.0 37.0 37.0 37.0 2 36.41125 37.0 37.0 37.0 37.0 37.0 3 36.6595 37.0 37.0 37.0 37.0 37.0 4 36.633 37.0 37.0 37.0 37.0 37.0 5 36.6335 37.0 37.0 37.0 37.0 37.0 6 36.6975 37.0 37.0 37.0 37.0 37.0 7 36.6205 37.0 37.0 37.0 37.0 37.0 8 36.6795 37.0 37.0 37.0 37.0 37.0 9 36.6685 37.0 37.0 37.0 37.0 37.0 10-14 36.659200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.6467 37.0 37.0 37.0 37.0 37.0 20-24 36.6471 37.0 37.0 37.0 37.0 37.0 25-29 36.5843 37.0 37.0 37.0 37.0 37.0 30-34 36.5737 37.0 37.0 37.0 37.0 37.0 35-39 36.5569 37.0 37.0 37.0 37.0 37.0 40-44 36.53339999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.5416 37.0 37.0 37.0 37.0 37.0 50-54 36.4705 37.0 37.0 37.0 37.0 37.0 55-59 36.4814 37.0 37.0 37.0 37.0 37.0 60-64 36.4347 37.0 37.0 37.0 37.0 37.0 65-69 36.4048 37.0 37.0 37.0 37.0 37.0 70-74 36.4251 37.0 37.0 37.0 37.0 37.0 75-79 36.3803 37.0 37.0 37.0 37.0 37.0 80-84 36.37479999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2542 37.0 37.0 37.0 37.0 37.0 90-94 36.2959 37.0 37.0 37.0 37.0 37.0 95-99 36.2649 37.0 37.0 37.0 37.0 37.0 100-104 36.266999999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.194 37.0 37.0 37.0 37.0 37.0 110-114 36.122 37.0 37.0 37.0 37.0 37.0 115-119 36.1415 37.0 37.0 37.0 37.0 37.0 120-124 36.16930000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.9757 37.0 37.0 37.0 37.0 37.0 130-134 35.9674 37.0 37.0 37.0 37.0 37.0 135-139 35.826100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.746100000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.638999999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.291250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 3.0 25 1.0 26 4.0 27 6.0 28 6.0 29 13.0 30 22.0 31 40.0 32 32.0 33 61.0 34 114.0 35 318.0 36 2949.0 37 428.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.5 12.775 5.25 35.475 2 18.927049385810978 13.863123589872147 35.67310102782652 31.53672599649035 3 16.675 18.775 30.049999999999997 34.5 4 21.45 26.0 26.3 26.25 5 23.325000000000003 31.674999999999997 23.75 21.25 6 20.674999999999997 35.225 23.724999999999998 20.375 7 14.575 27.575 40.625 17.224999999999998 8 17.974999999999998 25.124999999999996 32.0 24.9 9 17.2 23.325000000000003 35.6 23.875 10-14 20.0 29.235 27.465 23.3 15-19 19.869999999999997 28.235 28.43 23.465 20-24 20.39 28.29 28.095 23.225 25-29 19.845 28.465 27.76 23.93 30-34 19.97 28.689999999999998 27.49 23.849999999999998 35-39 20.305 28.655 27.295 23.745 40-44 20.25 29.235 27.339999999999996 23.175 45-49 19.925 28.425 27.35 24.3 50-54 20.28 28.315 27.92 23.485 55-59 20.48 28.115000000000002 27.584999999999997 23.82 60-64 20.69 28.050000000000004 27.255000000000003 24.005000000000003 65-69 20.52 28.235 27.295 23.95 70-74 19.765 28.82 27.534999999999997 23.880000000000003 75-79 20.525 28.084999999999997 27.77 23.62 80-84 20.04 28.685 27.839999999999996 23.435 85-89 20.235 29.044999999999998 27.325 23.395 90-94 20.89 28.82 27.125 23.165 95-99 20.3 28.675 27.605 23.419999999999998 100-104 20.21 28.444999999999997 27.47 23.875 105-109 20.825 28.48 27.339999999999996 23.355 110-114 20.875 28.43 27.205000000000002 23.49 115-119 20.875 28.660000000000004 27.025 23.44 120-124 20.990000000000002 28.43 26.884999999999998 23.695 125-129 21.560000000000002 28.194999999999997 26.810000000000002 23.435 130-134 21.335 28.449999999999996 26.945000000000004 23.27 135-139 21.735 28.999999999999996 26.174999999999997 23.09 140-144 22.470000000000002 27.775 26.33 23.425 145-149 22.02 28.335 26.135 23.51 150-151 22.9375 28.462500000000002 26.224999999999998 22.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 5.0 25 4.5 26 4.5 27 9.0 28 12.0 29 16.0 30 21.5 31 26.0 32 33.0 33 47.0 34 65.5 35 80.0 36 81.0 37 97.5 38 123.5 39 146.0 40 188.5 41 226.0 42 227.5 43 245.5 44 256.0 45 243.5 46 261.5 47 245.5 48 214.0 49 208.0 50 188.0 51 146.0 52 122.0 53 112.0 54 90.0 55 61.5 56 47.0 57 42.5 58 30.0 59 24.5 60 19.0 61 10.5 62 5.0 63 3.0 64 2.0 65 1.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.75989085948159 84.075 2 7.3669849931787175 13.5 3 0.8458390177353342 2.325 4 0.027285129604365622 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.6375000000000002 0.0 0.0 0.0 0.0 100-101 1.9875 0.0 0.0 0.0 0.0 102-103 2.3875 0.0 0.0 0.0 0.0 104-105 2.9625000000000004 0.0 0.0 0.0 0.0 106-107 3.2875 0.0 0.0 0.0 0.0 108-109 3.6875 0.0 0.0 0.0 0.0 110-111 4.25 0.0 0.0 0.0 0.0 112-113 4.825 0.0 0.0 0.0 0.0 114-115 5.425 0.0 0.0 0.0 0.0 116-117 6.0375 0.0 0.0 0.0 0.0 118-119 6.5625 0.0 0.0 0.0 0.0 120-121 6.9625 0.0 0.0 0.0 0.0 122-123 7.5125 0.0 0.0 0.0 0.0 124-125 7.9624999999999995 0.0 0.0 0.0 0.0 126-127 8.675 0.0 0.0 0.0 0.0 128-129 9.525 0.0 0.0 0.0 0.0 130-131 10.3125 0.0 0.0 0.0 0.0 132-133 11.05 0.0 0.0 0.0 0.0 134-135 11.8 0.0 0.0 0.0 0.0 136-137 12.625 0.0 0.0 0.0 0.0 138-139 13.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCATT 10 0.006830828 145.0 1 CTGAACT 65 0.0076375785 13.384615 125-129 >>END_MODULE SRR12919377 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919377_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.267 37.0 37.0 37.0 37.0 37.0 2 36.286 37.0 37.0 37.0 37.0 37.0 3 36.411 37.0 37.0 37.0 37.0 37.0 4 36.3505 37.0 37.0 37.0 37.0 37.0 5 36.4225 37.0 37.0 37.0 37.0 37.0 6 36.4335 37.0 37.0 37.0 37.0 37.0 7 36.351 37.0 37.0 37.0 37.0 37.0 8 36.471 37.0 37.0 37.0 37.0 37.0 9 36.454 37.0 37.0 37.0 37.0 37.0 10-14 36.4234 37.0 37.0 37.0 37.0 37.0 15-19 36.4082 37.0 37.0 37.0 37.0 37.0 20-24 36.391999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.346500000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.3045 37.0 37.0 37.0 37.0 37.0 35-39 36.2743 37.0 37.0 37.0 37.0 37.0 40-44 36.1951 37.0 37.0 37.0 37.0 37.0 45-49 36.207499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.211400000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2108 37.0 37.0 37.0 37.0 37.0 60-64 36.104400000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.1644 37.0 37.0 37.0 37.0 37.0 70-74 36.0903 37.0 37.0 37.0 37.0 37.0 75-79 36.1086 37.0 37.0 37.0 37.0 37.0 80-84 36.060199999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.009699999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.981100000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.971199999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.948699999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.8652 37.0 37.0 37.0 37.0 37.0 110-114 35.8565 37.0 37.0 37.0 37.0 37.0 115-119 35.829499999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.740700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.713499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.4829 37.0 37.0 37.0 37.0 37.0 135-139 35.335899999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.2028 37.0 37.0 37.0 32.2 37.0 145-149 35.1323 37.0 37.0 37.0 29.8 37.0 150-151 34.881 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 3.0 15 3.0 16 2.0 17 0.0 18 0.0 19 2.0 20 4.0 21 1.0 22 1.0 23 6.0 24 6.0 25 4.0 26 8.0 27 11.0 28 11.0 29 15.0 30 16.0 31 30.0 32 57.0 33 86.0 34 204.0 35 510.0 36 2679.0 37 337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.574999999999996 24.625 7.55 23.25 2 27.975 26.05 29.375 16.6 3 20.75 27.3 33.125 18.825 4 23.200000000000003 34.625 23.150000000000002 19.025 5 24.85 37.375 21.825 15.950000000000001 6 21.575 38.975 22.375 17.075000000000003 7 21.425 23.05 36.875 18.65 8 21.275 27.0 27.875 23.849999999999998 9 23.799999999999997 23.775 29.95 22.475 10-14 23.845 29.015 26.369999999999997 20.77 15-19 23.25 28.765 27.450000000000003 20.535 20-24 22.955000000000002 27.750000000000004 28.375 20.919999999999998 25-29 22.869999999999997 27.839999999999996 27.884999999999998 21.404999999999998 30-34 22.805 28.499999999999996 27.744999999999997 20.95 35-39 23.235 28.425 27.29 21.05 40-44 22.955000000000002 28.084999999999997 27.884999999999998 21.075 45-49 23.400000000000002 27.715 27.845 21.04 50-54 22.43 28.09 28.255000000000003 21.224999999999998 55-59 22.735 28.38 27.775 21.11 60-64 22.759999999999998 27.97 27.794999999999998 21.475 65-69 23.165 28.165000000000003 27.565 21.105 70-74 22.905 28.410000000000004 27.82 20.865000000000002 75-79 22.75 27.705000000000002 27.73 21.815 80-84 22.555 28.765 27.46 21.22 85-89 23.22 28.15 27.045 21.584999999999997 90-94 23.485 28.24 27.615000000000002 20.66 95-99 23.375 29.28 26.935 20.41 100-104 23.98 28.615000000000002 26.665 20.74 105-109 23.785 27.955000000000002 27.54 20.72 110-114 24.19 28.199999999999996 27.589999999999996 20.02 115-119 24.815 28.27 26.995 19.919999999999998 120-124 25.380000000000003 27.534999999999997 27.63 19.455 125-129 25.474999999999998 28.275 26.97 19.28 130-134 26.41 27.994999999999997 25.814999999999998 19.78 135-139 26.815 28.349999999999998 25.990000000000002 18.845 140-144 27.065 27.560000000000002 26.46 18.915000000000003 145-149 28.33 27.694999999999997 25.45 18.525 150-151 29.375 27.3125 24.6625 18.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.5 11 1.5 12 1.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 0.5 23 1.0 24 3.0 25 3.5 26 5.0 27 8.0 28 11.5 29 9.5 30 10.0 31 21.0 32 34.0 33 43.0 34 49.0 35 67.0 36 99.0 37 117.5 38 129.0 39 160.0 40 193.0 41 220.0 42 232.0 43 248.0 44 260.0 45 254.0 46 242.5 47 249.5 48 250.0 49 213.0 50 176.0 51 147.0 52 119.0 53 96.5 54 85.5 55 66.0 56 46.5 57 33.5 58 24.5 59 21.0 60 13.0 61 5.5 62 3.5 63 2.0 64 1.0 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.73960612691467 83.85000000000001 2 7.467177242888402 13.65 3 0.6291028446389497 1.725 4 0.10940919037199125 0.4 5 0.0 0.0 6 0.02735229759299781 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02735229759299781 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.1875 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 2.0125 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 3.0125 0.0 0.0 0.0 0.0 106-107 3.3499999999999996 0.0 0.0 0.0 0.0 108-109 3.7625 0.0 0.0 0.0 0.0 110-111 4.324999999999999 0.0 0.0 0.0 0.0 112-113 4.9 0.0 0.0 0.0 0.0 114-115 5.5375 0.0 0.0 0.0 0.0 116-117 6.1625 0.0 0.0 0.0 0.0 118-119 6.6625 0.0 0.0 0.0 0.0 120-121 7.05 0.0 0.0 0.0 0.0 122-123 7.612500000000001 0.0 0.0 0.0 0.0 124-125 8.087499999999999 0.0 0.0 0.0 0.0 126-127 8.825 0.0 0.0 0.0 0.0 128-129 9.6875 0.0 0.0 0.0 0.0 130-131 10.475 0.0 0.0 0.0 0.0 132-133 11.2 0.0 0.0 0.0 0.0 134-135 11.95 0.0 0.0 0.0 0.0 136-137 12.825 0.0 0.0 0.0 0.0 138-139 13.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAAAA 10 0.006830828 145.0 6 TGAAGTT 40 0.0076550315 18.125 140-144 GGGAAAG 65 0.0076375785 13.384615 130-134 >>END_MODULE Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra Read 749808 spots for SRR12919377.sra Written 749808 spots for SRR12919377.sra Read 749799 spots for SRR12919377.sra Written 749799 spots for SRR12919377.sra SRR ids: ['SRR12919377.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sw0v9l5n SRR12919377.sra spots: 14995989 blocks: [[1, 749799], [749800, 1499598], [1499599, 2249397], [2249398, 2999196], [2999197, 3748995], [3748996, 4498794], [4498795, 5248593], [5248594, 5998392], [5998393, 6748191], [6748192, 7497990], [7497991, 8247789], [8247790, 8997588], [8997589, 9747387], [9747388, 10497186], [10497187, 11246985], [11246986, 11996784], [11996785, 12746583], [12746584, 13496382], [13496383, 14246181], [14246182, 14995989]] SRR12919377 file size 5074592 SRR12919377 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919377 SRR12919377_1.fastq SRR12919377_2.fastq Input file: SRR12919377_1.fastq Paired file: SRR12919377_2.fastq trimmed: SRR12919377-trimmed-pair1.fastq, SRR12919377-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:33:25 2025 >> started Wed Feb 12 21:33:42 2025 >> done (17.084s) 14995989 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 661 ( 0.00%) empty read pairs filtered out after trimming by size control 14995304 (100.00%) read pairs available; of these: 2794574 (18.64%) trimmed read pairs available after processing 12200730 (81.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 3 0.00% 28 2 0.00% 29 6 0.00% 30 12 0.00% 31 4 0.00% 32 14 0.00% 33 11 0.00% 34 19 0.00% 35 8 0.00% 36 20 0.00% 37 13 0.00% 38 19 0.00% 39 15 0.00% 40 16 0.00% 41 34 0.00% 42 20 0.00% 43 38 0.00% 44 39 0.00% 45 34 0.00% 46 48 0.00% 47 44 0.00% 48 67 0.00% 49 77 0.00% 50 108 0.00% 51 132 0.00% 52 96 0.00% 53 138 0.00% 54 115 0.00% 55 158 0.00% 56 186 0.00% 57 196 0.00% 58 285 0.00% 59 335 0.00% 60 454 0.00% 61 485 0.00% 62 602 0.00% 63 634 0.00% 64 717 0.00% 65 766 0.01% 66 857 0.01% 67 1017 0.01% 68 1158 0.01% 69 1378 0.01% 70 1657 0.01% 71 1933 0.01% 72 2327 0.02% 73 2589 0.02% 74 3002 0.02% 75 3250 0.02% 76 3560 0.02% 77 3994 0.03% 78 4231 0.03% 79 4975 0.03% 80 5683 0.04% 81 6517 0.04% 82 7566 0.05% 83 8222 0.05% 84 9447 0.06% 85 10174 0.07% 86 10943 0.07% 87 11562 0.08% 88 12044 0.08% 89 12856 0.09% 90 14321 0.10% 91 15542 0.10% 92 17206 0.11% 93 19004 0.13% 94 20171 0.13% 95 21696 0.14% 96 22462 0.15% 97 22586 0.15% 98 23441 0.16% 99 24542 0.16% 100 25978 0.17% 101 27077 0.18% 102 29161 0.19% 103 30654 0.20% 104 32136 0.21% 105 33649 0.22% 106 34399 0.23% 107 34500 0.23% 108 35160 0.23% 109 35880 0.24% 110 36152 0.24% 111 37919 0.25% 112 38795 0.26% 113 40256 0.27% 114 42613 0.28% 115 43889 0.29% 116 44801 0.30% 117 45300 0.30% 118 45044 0.30% 119 45354 0.30% 120 45779 0.31% 121 46786 0.31% 122 48059 0.32% 123 49644 0.33% 124 51112 0.34% 125 51719 0.34% 126 53261 0.36% 127 52776 0.35% 128 52861 0.35% 129 53114 0.35% 130 52891 0.35% 131 53187 0.35% 132 53883 0.36% 133 55500 0.37% 134 56731 0.38% 135 57179 0.38% 136 57480 0.38% 137 57753 0.39% 138 57664 0.38% 139 57940 0.39% 140 57383 0.38% 141 57224 0.38% 142 57853 0.39% 143 58537 0.39% 144 59185 0.39% 145 60262 0.40% 146 60455 0.40% 147 60872 0.41% 148 61036 0.41% 149 60051 0.40% 150 59774 0.40% 151 12200730 81.36% 14995304 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.67 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=78.97 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=23 prefix-density=0.92 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=47.32 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAAT SRR12919377 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:34:26 Started mapping on | Feb 12 21:34:27 Finished on | Feb 12 21:36:12 Mapping speed, Million of reads per hour | 514.12 Number of input reads | 14995304 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13924911 Uniquely mapped reads % | 92.86% Average mapped length | 290.21 Number of splices: Total | 13272198 Number of splices: Annotated (sjdb) | 13019347 Number of splices: GT/AG | 12987371 Number of splices: GC/AG | 238529 Number of splices: AT/AC | 8846 Number of splices: Non-canonical | 37452 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344199 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 34971 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.48% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 726194 726194 726194 N_multimapping 344199 344199 344199 N_noFeature 458759 13729975 548968 N_ambiguous 194219 668 89085 UnstrandedReadsAssigned:13271933 PositiveStrandReadsAssigned:194268 NegativeStrandReadsAssigned:13286858 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919377 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919377-trimmed-pair1.fastq SRR12919377-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,995,304 reads, 13,389,822 reads pseudoaligned [quant] estimated average fragment length: 240.249 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR12919377.ke.tsv 34699 SRR12919377.se.tsv 87100 total ==> SRR12919377.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.75 324 14.7097 Potri.005G024800.1.v4.1 1035 795.751 130 13.1929 Potri.004G059700.1.v4.1 961 722.023 22 2.46063 Potri.007G009000.2.v4.1 1416 1176.75 0 0 Potri.003G141000.2.v4.1 2943 2703.75 532.406 15.902 Potri.016G087400.1.v4.1 270 99.4675 650 527.723 Potri.015G069301.1.v4.1 564 341.504 0 0 Potri.010G195200.1.v4.1 1773 1533.75 3 0.157958 Potri.012G127500.1.v4.1 977 737.9 183 20.0275 ==> SRR12919377.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 344 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 144 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR12919377 completed mapping pipeline successfully