Starting /dee2/code/volunteer_pipeline.sh SRR12919378 current disk space = 3050755805184 free memory = 1414376300 SRR12919378 SRAfilesize 37e6d64b106f34318fb1a766e9ebbdba SRR12919378.sra SRR12919378.sra file validated SRR12919378 is paired end SRR12919378 is conventional basespace SRR12919378 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.638 37.0 37.0 37.0 37.0 37.0 2 36.2885 37.0 37.0 37.0 37.0 37.0 3 36.623 37.0 37.0 37.0 37.0 37.0 4 36.63 37.0 37.0 37.0 37.0 37.0 5 36.6675 37.0 37.0 37.0 37.0 37.0 6 36.696 37.0 37.0 37.0 37.0 37.0 7 36.6305 37.0 37.0 37.0 37.0 37.0 8 36.626 37.0 37.0 37.0 37.0 37.0 9 36.6075 37.0 37.0 37.0 37.0 37.0 10-14 36.6777 37.0 37.0 37.0 37.0 37.0 15-19 36.6732 37.0 37.0 37.0 37.0 37.0 20-24 36.6299 37.0 37.0 37.0 37.0 37.0 25-29 36.5846 37.0 37.0 37.0 37.0 37.0 30-34 36.5412 37.0 37.0 37.0 37.0 37.0 35-39 36.521 37.0 37.0 37.0 37.0 37.0 40-44 36.5376 37.0 37.0 37.0 37.0 37.0 45-49 36.4918 37.0 37.0 37.0 37.0 37.0 50-54 36.4506 37.0 37.0 37.0 37.0 37.0 55-59 36.4781 37.0 37.0 37.0 37.0 37.0 60-64 36.4335 37.0 37.0 37.0 37.0 37.0 65-69 36.38590000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3809 37.0 37.0 37.0 37.0 37.0 75-79 36.3058 37.0 37.0 37.0 37.0 37.0 80-84 36.37929999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2628 37.0 37.0 37.0 37.0 37.0 90-94 36.2649 37.0 37.0 37.0 37.0 37.0 95-99 36.2693 37.0 37.0 37.0 37.0 37.0 100-104 36.194300000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1795 37.0 37.0 37.0 37.0 37.0 110-114 36.1323 37.0 37.0 37.0 37.0 37.0 115-119 36.0769 37.0 37.0 37.0 37.0 37.0 120-124 36.0789 37.0 37.0 37.0 37.0 37.0 125-129 35.970800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.938199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.8778 37.0 37.0 37.0 37.0 37.0 140-144 35.7863 37.0 37.0 37.0 37.0 37.0 145-149 35.7654 37.0 37.0 37.0 37.0 37.0 150-151 35.626000000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 5.0 24 0.0 25 0.0 26 3.0 27 5.0 28 12.0 29 22.0 30 24.0 31 25.0 32 37.0 33 68.0 34 106.0 35 280.0 36 3018.0 37 391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.625 12.950000000000001 5.075 37.35 2 18.28470824949698 14.738430583501005 36.16700201207244 30.809859154929576 3 17.025000000000002 17.05 30.575000000000003 35.35 4 20.65 26.0 24.025 29.325000000000003 5 22.55 32.275 25.15 20.025000000000002 6 21.55 34.0 24.15 20.3 7 14.475 26.775 42.175000000000004 16.575 8 16.775000000000002 26.275 31.65 25.3 9 17.525 24.075 34.475 23.925 10-14 19.45 30.104999999999997 27.605 22.84 15-19 19.950000000000003 28.715000000000003 27.505000000000003 23.830000000000002 20-24 20.064999999999998 28.544999999999998 27.935 23.455000000000002 25-29 20.345 28.04 27.955000000000002 23.66 30-34 20.01 29.080000000000002 27.02 23.89 35-39 20.48 28.21 27.625 23.685000000000002 40-44 19.805 28.785 27.48 23.93 45-49 20.22 28.705000000000002 26.87 24.205 50-54 20.715 28.494999999999997 27.435 23.355 55-59 20.335 28.815 26.939999999999998 23.91 60-64 20.745 28.08 27.48 23.695 65-69 20.810000000000002 27.845 27.810000000000002 23.535 70-74 20.25 28.89 26.955000000000002 23.905 75-79 20.05 28.07 27.82 24.060000000000002 80-84 20.200000000000003 28.610000000000003 27.11 24.08 85-89 20.405 28.775000000000002 27.205000000000002 23.615 90-94 20.669999999999998 28.09 27.215 24.025 95-99 21.375 27.46 27.955000000000002 23.21 100-104 20.985 28.444999999999997 27.229999999999997 23.34 105-109 20.380000000000003 28.849999999999998 27.089999999999996 23.68 110-114 20.7 28.535 27.200000000000003 23.565 115-119 20.315 28.439999999999998 27.46 23.785 120-124 21.085 27.67 27.339999999999996 23.905 125-129 20.82 27.715 27.644999999999996 23.82 130-134 20.84 27.689999999999998 27.46 24.01 135-139 21.2 28.355000000000004 26.51 23.935000000000002 140-144 21.27 27.644999999999996 27.265 23.82 145-149 21.25 28.08 26.88 23.79 150-151 21.1875 27.0875 26.787499999999998 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 2.0 25 5.5 26 7.0 27 9.0 28 14.0 29 13.5 30 17.5 31 24.0 32 33.5 33 41.5 34 54.5 35 72.5 36 76.5 37 93.5 38 130.0 39 155.0 40 177.0 41 205.5 42 228.0 43 249.0 44 246.0 45 248.5 46 261.0 47 252.0 48 236.0 49 220.0 50 197.5 51 159.5 52 122.0 53 102.0 54 87.0 55 67.5 56 51.5 57 47.5 58 34.5 59 16.5 60 10.5 61 8.5 62 7.5 63 4.0 64 2.0 65 2.0 66 2.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.25 #Duplication Level Percentage of deduplicated Percentage of total 1 89.52380952380953 79.9 2 9.215686274509805 16.45 3 1.0364145658263304 2.775 4 0.19607843137254902 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.028011204481792715 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCGTTGTCGTCCGGAATGAGTTGGGTTGGCAGCACTTCAATGACAGCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.9874999999999998 0.0 0.0 0.0 0.0 108-109 2.1625 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.1500000000000004 0.0 0.0 0.0 0.0 118-119 3.6 0.0 0.0 0.0 0.0 120-121 3.9875000000000003 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 5.0375 0.0 0.0 0.0 0.0 126-127 5.512499999999999 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.1125 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTGCC 10 0.006830828 145.0 5 CTCACAA 10 0.006830828 145.0 9 >>END_MODULE SRR12919378 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919378_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.311 37.0 37.0 37.0 37.0 37.0 2 36.3315 37.0 37.0 37.0 37.0 37.0 3 36.289 37.0 37.0 37.0 37.0 37.0 4 36.277 37.0 37.0 37.0 37.0 37.0 5 36.395 37.0 37.0 37.0 37.0 37.0 6 36.303 37.0 37.0 37.0 37.0 37.0 7 36.311 37.0 37.0 37.0 37.0 37.0 8 36.373 37.0 37.0 37.0 37.0 37.0 9 36.297 37.0 37.0 37.0 37.0 37.0 10-14 36.402 37.0 37.0 37.0 37.0 37.0 15-19 36.3929 37.0 37.0 37.0 37.0 37.0 20-24 36.3489 37.0 37.0 37.0 37.0 37.0 25-29 36.2922 37.0 37.0 37.0 37.0 37.0 30-34 36.272299999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.2404 37.0 37.0 37.0 37.0 37.0 40-44 36.1999 37.0 37.0 37.0 37.0 37.0 45-49 36.14999999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.171699999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.143 37.0 37.0 37.0 37.0 37.0 60-64 36.1297 37.0 37.0 37.0 37.0 37.0 65-69 36.0599 37.0 37.0 37.0 37.0 37.0 70-74 36.1064 37.0 37.0 37.0 37.0 37.0 75-79 36.085300000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0365 37.0 37.0 37.0 37.0 37.0 85-89 35.9904 37.0 37.0 37.0 37.0 37.0 90-94 35.9557 37.0 37.0 37.0 37.0 37.0 95-99 35.915800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.897000000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.9201 37.0 37.0 37.0 37.0 37.0 110-114 35.879 37.0 37.0 37.0 37.0 37.0 115-119 35.8152 37.0 37.0 37.0 37.0 37.0 120-124 35.7308 37.0 37.0 37.0 37.0 37.0 125-129 35.7281 37.0 37.0 37.0 37.0 37.0 130-134 35.5454 37.0 37.0 37.0 37.0 37.0 135-139 35.450900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.432599999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.2518 37.0 37.0 37.0 32.2 37.0 150-151 34.89575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 1.0 16 3.0 17 1.0 18 1.0 19 0.0 20 3.0 21 1.0 22 6.0 23 5.0 24 2.0 25 11.0 26 5.0 27 9.0 28 7.0 29 20.0 30 25.0 31 37.0 32 45.0 33 100.0 34 171.0 35 487.0 36 2737.0 37 317.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.575 24.65 8.725 24.05 2 26.450000000000003 28.175 29.95 15.425 3 20.9 27.6 32.425 19.075 4 24.45 34.55 22.3 18.7 5 23.799999999999997 38.025 21.725 16.45 6 22.5 37.325 22.3 17.875 7 21.15 23.05 36.425000000000004 19.375 8 21.85 26.575 27.425 24.15 9 23.125 24.75 29.549999999999997 22.575 10-14 23.455000000000002 29.525000000000002 25.840000000000003 21.18 15-19 22.855 27.51 28.310000000000002 21.325 20-24 23.27 28.525 26.955000000000002 21.25 25-29 23.974999999999998 27.815 27.515 20.695 30-34 23.695 27.6 27.765 20.94 35-39 22.814999999999998 28.13 28.16 20.895 40-44 23.43 27.785 28.1 20.685000000000002 45-49 23.075000000000003 27.975 27.05 21.9 50-54 22.95 28.189999999999998 27.185 21.675 55-59 22.965 27.36 28.08 21.595 60-64 22.91 27.49 27.38 22.220000000000002 65-69 23.73 27.675 27.76 20.835 70-74 23.630000000000003 27.52 27.54 21.310000000000002 75-79 23.395 27.685 27.13 21.790000000000003 80-84 23.68 28.235 27.045 21.04 85-89 23.605 27.565 26.950000000000003 21.88 90-94 23.405 27.944999999999997 27.05 21.6 95-99 24.07 27.99 26.974999999999998 20.965 100-104 24.115000000000002 27.779999999999998 27.07 21.035 105-109 24.15 27.834999999999997 27.155 20.86 110-114 24.095 28.33 27.544999999999998 20.03 115-119 24.66 28.395 26.55 20.395 120-124 24.945 27.515 27.125 20.415 125-129 25.124999999999996 27.58 27.235 20.06 130-134 25.185000000000002 27.57 27.08 20.165 135-139 25.395 27.525 26.825 20.255000000000003 140-144 26.045 27.315 26.855 19.785 145-149 26.395000000000003 27.255000000000003 26.75 19.6 150-151 26.05 27.725 26.625 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 1.0 19 1.5 20 1.0 21 3.0 22 4.0 23 1.5 24 1.0 25 1.5 26 3.0 27 4.0 28 7.0 29 10.0 30 13.5 31 20.5 32 21.0 33 26.5 34 38.5 35 53.5 36 75.5 37 105.0 38 130.0 39 144.5 40 181.0 41 218.5 42 243.5 43 246.0 44 250.0 45 251.5 46 249.5 47 271.0 48 272.5 49 228.0 50 180.0 51 155.0 52 138.5 53 117.5 54 83.5 55 55.0 56 42.0 57 39.0 58 27.5 59 22.0 60 18.0 61 10.5 62 7.5 63 5.5 64 2.5 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.5 #Duplication Level Percentage of deduplicated Percentage of total 1 89.91620111731844 80.475 2 8.88268156424581 15.9 3 0.9497206703910615 2.55 4 0.19553072625698326 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.027932960893854747 0.17500000000000002 8 0.027932960893854747 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAGCAGACTCTGGGTGTGGTAAGAGTACCTTCATGAGGAGGTTAACAA 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.0875 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 5.137499999999999 0.0 0.0 0.0 0.0 126-127 5.612500000000001 0.0 0.0 0.0 0.0 128-129 6.0375 0.0 0.0 0.0 0.0 130-131 6.699999999999999 0.0 0.0 0.0 0.0 132-133 7.2125 0.0 0.0 0.0 0.0 134-135 7.6 0.0 0.0 0.0 0.0 136-137 8.2125 0.0 0.0 0.0 0.0 138-139 8.912500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885700 spots for SRR12919378.sra Written 885700 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra Read 885690 spots for SRR12919378.sra Written 885690 spots for SRR12919378.sra SRR ids: ['SRR12919378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oluy8av0 SRR12919378.sra spots: 17713810 blocks: [[1, 885690], [885691, 1771380], [1771381, 2657070], [2657071, 3542760], [3542761, 4428450], [4428451, 5314140], [5314141, 6199830], [6199831, 7085520], [7085521, 7971210], [7971211, 8856900], [8856901, 9742590], [9742591, 10628280], [10628281, 11513970], [11513971, 12399660], [12399661, 13285350], [13285351, 14171040], [14171041, 15056730], [15056731, 15942420], [15942421, 16828110], [16828111, 17713810]] SRR12919378 file size 5998227 SRR12919378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919378 SRR12919378_1.fastq SRR12919378_2.fastq Input file: SRR12919378_1.fastq Paired file: SRR12919378_2.fastq trimmed: SRR12919378-trimmed-pair1.fastq, SRR12919378-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:26:00 2025 >> started Wed Feb 12 21:26:30 2025 >> done (29.485s) 17713810 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 2223 ( 0.01%) empty read pairs filtered out after trimming by size control 17711563 (99.99%) read pairs available; of these: 2272745 (12.83%) trimmed read pairs available after processing 15438818 (87.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 6 0.00% 21 2 0.00% 22 3 0.00% 23 6 0.00% 24 5 0.00% 25 5 0.00% 26 3 0.00% 27 5 0.00% 28 3 0.00% 29 9 0.00% 30 7 0.00% 31 11 0.00% 32 7 0.00% 33 16 0.00% 34 7 0.00% 35 13 0.00% 36 12 0.00% 37 19 0.00% 38 21 0.00% 39 13 0.00% 40 22 0.00% 41 23 0.00% 42 35 0.00% 43 21 0.00% 44 36 0.00% 45 40 0.00% 46 35 0.00% 47 34 0.00% 48 66 0.00% 49 43 0.00% 50 62 0.00% 51 87 0.00% 52 106 0.00% 53 120 0.00% 54 112 0.00% 55 103 0.00% 56 148 0.00% 57 151 0.00% 58 162 0.00% 59 223 0.00% 60 257 0.00% 61 301 0.00% 62 348 0.00% 63 376 0.00% 64 435 0.00% 65 417 0.00% 66 562 0.00% 67 524 0.00% 68 638 0.00% 69 819 0.00% 70 867 0.00% 71 1059 0.01% 72 1228 0.01% 73 1369 0.01% 74 1569 0.01% 75 1668 0.01% 76 1797 0.01% 77 2023 0.01% 78 2185 0.01% 79 2537 0.01% 80 2943 0.02% 81 3441 0.02% 82 3944 0.02% 83 4414 0.02% 84 4842 0.03% 85 5251 0.03% 86 5757 0.03% 87 6119 0.03% 88 6632 0.04% 89 7209 0.04% 90 8167 0.05% 91 8995 0.05% 92 10035 0.06% 93 11029 0.06% 94 12082 0.07% 95 12776 0.07% 96 13381 0.08% 97 14180 0.08% 98 14651 0.08% 99 15347 0.09% 100 16477 0.09% 101 17407 0.10% 102 18863 0.11% 103 20335 0.11% 104 21574 0.12% 105 22426 0.13% 106 23464 0.13% 107 23792 0.13% 108 24434 0.14% 109 25142 0.14% 110 25826 0.15% 111 27470 0.16% 112 28943 0.16% 113 30200 0.17% 114 31383 0.18% 115 32728 0.18% 116 33391 0.19% 117 34395 0.19% 118 34633 0.20% 119 35415 0.20% 120 36375 0.21% 121 36788 0.21% 122 38392 0.22% 123 39879 0.23% 124 41514 0.23% 125 42548 0.24% 126 43714 0.25% 127 43516 0.25% 128 44154 0.25% 129 44732 0.25% 130 45475 0.26% 131 45889 0.26% 132 47365 0.27% 133 48482 0.27% 134 50287 0.28% 135 51418 0.29% 136 52106 0.29% 137 52772 0.30% 138 53047 0.30% 139 53564 0.30% 140 53327 0.30% 141 53997 0.30% 142 55406 0.31% 143 55995 0.32% 144 58512 0.33% 145 59294 0.33% 146 59323 0.33% 147 59954 0.34% 148 60875 0.34% 149 60524 0.34% 150 61241 0.35% 151 15438818 87.17% 17711563 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=19 prefix-density=0.82 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=41.53 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.2 sequence=AAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=20 prefix-density=0.92 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=20.71 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=4.6 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAATCCCTCCTCCTC SRR12919378 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:27:22 Started mapping on | Feb 12 21:27:23 Finished on | Feb 12 21:29:57 Mapping speed, Million of reads per hour | 414.04 Number of input reads | 17711563 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16626178 Uniquely mapped reads % | 93.87% Average mapped length | 294.23 Number of splices: Total | 16437268 Number of splices: Annotated (sjdb) | 16135299 Number of splices: GT/AG | 16088438 Number of splices: GC/AG | 296525 Number of splices: AT/AC | 10089 Number of splices: Non-canonical | 42216 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438140 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 29937 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.38% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 647245 647245 647245 N_multimapping 438140 438140 438140 N_noFeature 472087 16407385 544575 N_ambiguous 262693 828 115921 UnstrandedReadsAssigned:15891398 PositiveStrandReadsAssigned:217965 NegativeStrandReadsAssigned:15965682 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919378 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919378-trimmed-pair1.fastq SRR12919378-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,711,563 reads, 16,048,363 reads pseudoaligned [quant] estimated average fragment length: 252.595 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR12919378.ke.tsv 34699 SRR12919378.se.tsv 87100 total ==> SRR12919378.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.41 386 13.3114 Potri.005G024800.1.v4.1 1035 783.405 232 18.0396 Potri.004G059700.1.v4.1 961 709.538 30 2.57555 Potri.007G009000.2.v4.1 1416 1164.41 0 0 Potri.003G141000.2.v4.1 2943 2691.41 639.348 14.4705 Potri.016G087400.1.v4.1 270 89.1307 859 587.071 Potri.015G069301.1.v4.1 564 327.397 0 0 Potri.010G195200.1.v4.1 1773 1521.41 23 0.920891 Potri.012G127500.1.v4.1 977 725.486 237 19.8996 ==> SRR12919378.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 355 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 195 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR12919378 completed mapping pipeline successfully