Starting /dee2/code/volunteer_pipeline.sh SRR12919379 current disk space = 3050608676864 free memory = 1466238372 SRR12919379 SRAfilesize 83b8e11029750f87c39bfbd3e5ea3a0f SRR12919379.sra SRR12919379.sra file validated SRR12919379 is paired end SRR12919379 is conventional basespace SRR12919379 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.618 37.0 37.0 37.0 37.0 37.0 2 36.5005 37.0 37.0 37.0 37.0 37.0 3 36.601 37.0 37.0 37.0 37.0 37.0 4 36.6855 37.0 37.0 37.0 37.0 37.0 5 36.62 37.0 37.0 37.0 37.0 37.0 6 36.733 37.0 37.0 37.0 37.0 37.0 7 36.656 37.0 37.0 37.0 37.0 37.0 8 36.6825 37.0 37.0 37.0 37.0 37.0 9 36.65 37.0 37.0 37.0 37.0 37.0 10-14 36.6499 37.0 37.0 37.0 37.0 37.0 15-19 36.612 37.0 37.0 37.0 37.0 37.0 20-24 36.5977 37.0 37.0 37.0 37.0 37.0 25-29 36.552499999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.515 37.0 37.0 37.0 37.0 37.0 35-39 36.508500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4896 37.0 37.0 37.0 37.0 37.0 45-49 36.4828 37.0 37.0 37.0 37.0 37.0 50-54 36.475100000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.4224 37.0 37.0 37.0 37.0 37.0 60-64 36.3769 37.0 37.0 37.0 37.0 37.0 65-69 36.362 37.0 37.0 37.0 37.0 37.0 70-74 36.370000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.330600000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.370599999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.25320000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2472 37.0 37.0 37.0 37.0 37.0 95-99 36.218 37.0 37.0 37.0 37.0 37.0 100-104 36.1709 37.0 37.0 37.0 37.0 37.0 105-109 36.146699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.065999999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.08630000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.0937 37.0 37.0 37.0 37.0 37.0 125-129 35.934 37.0 37.0 37.0 37.0 37.0 130-134 35.9659 37.0 37.0 37.0 37.0 37.0 135-139 35.8573 37.0 37.0 37.0 37.0 37.0 140-144 35.82119999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.788599999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.56625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 4.0 26 7.0 27 5.0 28 7.0 29 14.0 30 23.0 31 35.0 32 43.0 33 76.0 34 113.0 35 311.0 36 2940.0 37 420.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.3 12.075 5.525 41.099999999999994 2 19.01901901901902 12.837837837837837 36.511511511511515 31.631631631631627 3 16.35 17.8 27.750000000000004 38.1 4 20.65 24.65 24.725 29.975 5 21.6 31.15 23.925 23.325000000000003 6 20.575 33.975 23.724999999999998 21.725 7 14.2 27.025 41.025 17.75 8 16.125 26.650000000000002 32.7 24.525 9 17.150000000000002 24.2 35.05 23.599999999999998 10-14 18.95 29.625 27.87 23.555 15-19 19.555 28.4 27.66 24.385 20-24 19.61 27.975 28.235 24.18 25-29 19.744999999999997 29.020000000000003 27.85 23.385 30-34 19.605 28.46 27.76 24.175 35-39 19.55 28.804999999999996 27.735 23.91 40-44 19.45 28.765 27.855 23.93 45-49 20.21 28.63 27.689999999999998 23.47 50-54 20.119999999999997 28.299999999999997 27.88 23.7 55-59 19.84 27.97 27.975 24.215 60-64 20.24 29.020000000000003 27.415 23.325000000000003 65-69 19.939999999999998 28.595 27.950000000000003 23.515 70-74 20.555 28.494999999999997 28.105000000000004 22.845 75-79 19.965 28.57 27.750000000000004 23.715 80-84 20.82 28.68 27.505000000000003 22.994999999999997 85-89 20.59 28.439999999999998 27.095000000000002 23.875 90-94 20.22 27.91 28.015 23.855 95-99 20.575 28.365000000000002 27.544999999999998 23.515 100-104 20.325 28.375 27.445000000000004 23.855 105-109 20.315 28.665000000000003 27.47 23.549999999999997 110-114 20.435 27.71 28.01 23.845 115-119 20.79 28.105000000000004 27.74 23.365 120-124 21.195 28.065 27.605 23.135 125-129 20.64 28.62 27.525 23.215 130-134 20.560000000000002 28.965000000000003 27.245 23.23 135-139 20.94 27.505000000000003 27.29 24.265 140-144 21.060000000000002 28.405 26.265 24.27 145-149 21.04 27.925 27.37 23.665 150-151 21.1375 27.6875 27.150000000000002 24.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 3.0 22 3.5 23 5.0 24 6.0 25 3.5 26 6.5 27 8.5 28 10.5 29 14.0 30 18.5 31 26.0 32 36.0 33 43.5 34 53.0 35 71.5 36 89.5 37 115.0 38 131.0 39 148.0 40 178.0 41 201.5 42 217.5 43 233.5 44 247.5 45 266.0 46 279.0 47 280.0 48 252.5 49 210.0 50 179.5 51 142.5 52 117.0 53 99.0 54 77.5 55 60.5 56 47.0 57 36.0 58 27.5 59 22.0 60 15.0 61 5.5 62 4.0 63 2.5 64 0.0 65 1.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.675 #Duplication Level Percentage of deduplicated Percentage of total 1 90.62586159360353 82.175 2 8.60215053763441 15.6 3 0.6617038875103392 1.7999999999999998 4 0.0827129859387924 0.3 5 0.027570995312930797 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.8999999999999999 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.3250000000000002 0.0 0.0 0.0 0.0 102-103 1.425 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.3499999999999996 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.2375 0.0 0.0 0.0 0.0 114-115 3.7125 0.0 0.0 0.0 0.0 116-117 4.0125 0.0 0.0 0.0 0.0 118-119 4.4125 0.0 0.0 0.0 0.0 120-121 4.824999999999999 0.0 0.0 0.0 0.0 122-123 5.2625 0.0 0.0 0.0 0.0 124-125 5.6375 0.0 0.0 0.0 0.0 126-127 5.987500000000001 0.0 0.0 0.0 0.0 128-129 6.4875 0.0 0.0 0.0 0.0 130-131 6.9375 0.0 0.0 0.0 0.0 132-133 7.525 0.0 0.0 0.0 0.0 134-135 8.075 0.0 0.0 0.0 0.0 136-137 8.575 0.0 0.0 0.0 0.0 138-139 9.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGACAG 10 0.006830828 145.0 5 AAGGCCT 10 0.006830828 145.0 9 >>END_MODULE SRR12919379 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919379_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2645 37.0 37.0 37.0 37.0 37.0 2 36.2375 37.0 37.0 37.0 37.0 37.0 3 36.2165 37.0 37.0 37.0 37.0 37.0 4 36.359 37.0 37.0 37.0 37.0 37.0 5 36.385 37.0 37.0 37.0 37.0 37.0 6 36.3495 37.0 37.0 37.0 37.0 37.0 7 36.3415 37.0 37.0 37.0 37.0 37.0 8 36.5295 37.0 37.0 37.0 37.0 37.0 9 36.3955 37.0 37.0 37.0 37.0 37.0 10-14 36.431200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.40089999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.384 37.0 37.0 37.0 37.0 37.0 25-29 36.3014 37.0 37.0 37.0 37.0 37.0 30-34 36.295300000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.2827 37.0 37.0 37.0 37.0 37.0 40-44 36.233799999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.2461 37.0 37.0 37.0 37.0 37.0 50-54 36.2345 37.0 37.0 37.0 37.0 37.0 55-59 36.1707 37.0 37.0 37.0 37.0 37.0 60-64 36.1123 37.0 37.0 37.0 37.0 37.0 65-69 36.1634 37.0 37.0 37.0 37.0 37.0 70-74 36.111000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.077799999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0345 37.0 37.0 37.0 37.0 37.0 85-89 36.0843 37.0 37.0 37.0 37.0 37.0 90-94 35.9847 37.0 37.0 37.0 37.0 37.0 95-99 35.937799999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.97279999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.9236 37.0 37.0 37.0 37.0 37.0 110-114 35.907900000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.8612 37.0 37.0 37.0 37.0 37.0 120-124 35.737100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.7158 37.0 37.0 37.0 37.0 37.0 130-134 35.614999999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.472300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.3809 37.0 37.0 37.0 34.6 37.0 145-149 35.3448 37.0 37.0 37.0 34.6 37.0 150-151 35.103 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 3.0 16 2.0 17 3.0 18 2.0 19 1.0 20 1.0 21 2.0 22 5.0 23 5.0 24 9.0 25 3.0 26 2.0 27 8.0 28 12.0 29 21.0 30 26.0 31 29.0 32 44.0 33 84.0 34 170.0 35 490.0 36 2737.0 37 339.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.775 24.325 8.95 25.95 2 25.7 26.900000000000002 30.8 16.6 3 19.525000000000002 28.1 33.725 18.65 4 21.9 33.975 24.6 19.525000000000002 5 24.375 38.05 22.075 15.5 6 21.675 38.425 22.650000000000002 17.25 7 19.6 23.35 37.45 19.6 8 21.6 24.65 28.65 25.1 9 21.175 25.924999999999997 30.625000000000004 22.275 10-14 23.575 29.28 26.365 20.78 15-19 23.195 28.084999999999997 28.499999999999996 20.22 20-24 23.244999999999997 29.03 26.99 20.735 25-29 22.935 28.62 27.284999999999997 21.16 30-34 23.215 28.16 27.96 20.665 35-39 23.005 28.33 27.62 21.044999999999998 40-44 22.685 28.985 27.744999999999997 20.585 45-49 23.225 27.66 28.09 21.025 50-54 23.35 27.93 27.595 21.125 55-59 23.07 28.03 28.08 20.82 60-64 23.080000000000002 27.639999999999997 27.860000000000003 21.42 65-69 23.48 27.615000000000002 27.889999999999997 21.015 70-74 22.985 27.650000000000002 27.855 21.51 75-79 23.225 27.97 27.834999999999997 20.97 80-84 23.674999999999997 28.42 27.060000000000002 20.845 85-89 23.21 28.389999999999997 27.555000000000003 20.845 90-94 23.885 27.97 27.49 20.655 95-99 23.044999999999998 28.27 27.71 20.974999999999998 100-104 23.455000000000002 28.189999999999998 27.41 20.945 105-109 23.735 28.03 27.485 20.75 110-114 23.685000000000002 28.055000000000003 27.985 20.275000000000002 115-119 24.44 28.754999999999995 26.779999999999998 20.025000000000002 120-124 23.91 28.03 27.205000000000002 20.855 125-129 24.7 28.444999999999997 27.115000000000002 19.74 130-134 25.44 27.52 27.555000000000003 19.485 135-139 25.064999999999998 27.800000000000004 27.445000000000004 19.689999999999998 140-144 25.82 27.889999999999997 26.685 19.605 145-149 26.41 27.560000000000002 26.265 19.765 150-151 27.125 27.0625 26.237500000000004 19.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.5 23 3.5 24 3.5 25 2.0 26 5.0 27 9.5 28 10.5 29 11.0 30 18.5 31 23.0 32 24.0 33 35.5 34 56.5 35 73.5 36 78.0 37 104.0 38 145.5 39 153.0 40 173.0 41 223.5 42 268.0 43 274.5 44 278.0 45 284.0 46 257.0 47 237.5 48 229.0 49 206.5 50 173.5 51 137.5 52 112.0 53 91.0 54 67.5 55 51.0 56 37.5 57 33.5 58 27.0 59 21.5 60 19.5 61 11.5 62 4.0 63 3.0 64 2.0 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.8363234888214 82.27499999999999 2 8.252829147115651 14.95 3 0.6900358818658571 1.875 4 0.11040574109853712 0.4 5 0.11040574109853712 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTGTGTCGCCGCAGCAGAATAAGAAGGATGTCTCACAGGAAGTTCGAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit AGTTGGAGAAAGGTTGGGTCTACCGTGAGCACCACAGCTCACCAGGGTAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3250000000000002 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.9875 0.0 0.0 0.0 0.0 108-109 2.3499999999999996 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.2375 0.0 0.0 0.0 0.0 114-115 3.7125 0.0 0.0 0.0 0.0 116-117 4.0375 0.0 0.0 0.0 0.0 118-119 4.475 0.0 0.0 0.0 0.0 120-121 4.9125 0.0 0.0 0.0 0.0 122-123 5.3625 0.0 0.0 0.0 0.0 124-125 5.7375 0.0 0.0 0.0 0.0 126-127 6.0875 0.0 0.0 0.0 0.0 128-129 6.5875 0.0 0.0 0.0 0.0 130-131 7.0375 0.0 0.0 0.0 0.0 132-133 7.625 0.0 0.0 0.0 0.0 134-135 8.1875 0.0 0.0 0.0 0.0 136-137 8.712499999999999 0.0 0.0 0.0 0.0 138-139 9.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402074 spots for SRR12919379.sra Written 402074 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra Read 402065 spots for SRR12919379.sra Written 402065 spots for SRR12919379.sra SRR ids: ['SRR12919379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fe_fd3bk SRR12919379.sra spots: 8041309 blocks: [[1, 402065], [402066, 804130], [804131, 1206195], [1206196, 1608260], [1608261, 2010325], [2010326, 2412390], [2412391, 2814455], [2814456, 3216520], [3216521, 3618585], [3618586, 4020650], [4020651, 4422715], [4422716, 4824780], [4824781, 5226845], [5226846, 5628910], [5628911, 6030975], [6030976, 6433040], [6433041, 6835105], [6835106, 7237170], [7237171, 7639235], [7639236, 8041309]] SRR12919379 file size 2714913 SRR12919379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919379 SRR12919379_1.fastq SRR12919379_2.fastq Input file: SRR12919379_1.fastq Paired file: SRR12919379_2.fastq trimmed: SRR12919379-trimmed-pair1.fastq, SRR12919379-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:44:33 2025 >> started Wed Feb 12 21:44:47 2025 >> done (13.192s) 8041309 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 201 ( 0.00%) empty read pairs filtered out after trimming by size control 8041097 (100.00%) read pairs available; of these: 975879 (12.14%) trimmed read pairs available after processing 7065218 (87.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 3 0.00% 22 0 0.00% 23 2 0.00% 24 1 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 4 0.00% 29 2 0.00% 30 3 0.00% 31 1 0.00% 32 2 0.00% 33 2 0.00% 34 4 0.00% 35 3 0.00% 36 1 0.00% 37 11 0.00% 38 3 0.00% 39 5 0.00% 40 5 0.00% 41 7 0.00% 42 12 0.00% 43 12 0.00% 44 19 0.00% 45 15 0.00% 46 14 0.00% 47 15 0.00% 48 18 0.00% 49 14 0.00% 50 31 0.00% 51 24 0.00% 52 30 0.00% 53 30 0.00% 54 43 0.00% 55 43 0.00% 56 39 0.00% 57 58 0.00% 58 63 0.00% 59 77 0.00% 60 68 0.00% 61 112 0.00% 62 133 0.00% 63 162 0.00% 64 172 0.00% 65 146 0.00% 66 206 0.00% 67 207 0.00% 68 233 0.00% 69 276 0.00% 70 335 0.00% 71 419 0.01% 72 480 0.01% 73 554 0.01% 74 549 0.01% 75 678 0.01% 76 766 0.01% 77 812 0.01% 78 908 0.01% 79 1016 0.01% 80 1183 0.01% 81 1370 0.02% 82 1559 0.02% 83 1732 0.02% 84 2044 0.03% 85 2211 0.03% 86 2377 0.03% 87 2637 0.03% 88 2781 0.03% 89 3033 0.04% 90 3204 0.04% 91 3706 0.05% 92 4005 0.05% 93 4426 0.06% 94 4797 0.06% 95 5175 0.06% 96 5601 0.07% 97 5830 0.07% 98 6206 0.08% 99 6429 0.08% 100 6879 0.09% 101 7248 0.09% 102 7789 0.10% 103 8418 0.10% 104 9059 0.11% 105 9341 0.12% 106 9819 0.12% 107 10194 0.13% 108 10375 0.13% 109 10882 0.14% 110 11009 0.14% 111 11568 0.14% 112 12525 0.16% 113 12689 0.16% 114 13003 0.16% 115 13710 0.17% 116 14207 0.18% 117 14490 0.18% 118 15042 0.19% 119 15102 0.19% 120 15709 0.20% 121 16152 0.20% 122 16359 0.20% 123 17186 0.21% 124 17727 0.22% 125 17839 0.22% 126 18601 0.23% 127 18993 0.24% 128 18868 0.23% 129 19393 0.24% 130 20036 0.25% 131 19862 0.25% 132 20125 0.25% 133 20936 0.26% 134 21610 0.27% 135 21853 0.27% 136 22565 0.28% 137 22885 0.28% 138 23001 0.29% 139 23488 0.29% 140 23588 0.29% 141 24104 0.30% 142 24152 0.30% 143 24485 0.30% 144 25271 0.31% 145 25878 0.32% 146 26029 0.32% 147 26184 0.33% 148 26821 0.33% 149 26347 0.33% 150 27321 0.34% 151 7065218 87.86% 8041097 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=12.67 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.5 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=20 prefix-density=0.67 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=70.23 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.7 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12919379 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:45:30 Started mapping on | Feb 12 21:45:30 Finished on | Feb 12 21:47:01 Mapping speed, Million of reads per hour | 318.11 Number of input reads | 8041097 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 7585619 Uniquely mapped reads % | 94.34% Average mapped length | 294.83 Number of splices: Total | 7553998 Number of splices: Annotated (sjdb) | 7391132 Number of splices: GT/AG | 7402303 Number of splices: GC/AG | 124379 Number of splices: AT/AC | 5521 Number of splices: Non-canonical | 21795 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 170582 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 13315 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 284896 284896 284896 N_multimapping 170582 170582 170582 N_noFeature 287763 7488327 332986 N_ambiguous 98091 555 45645 UnstrandedReadsAssigned:7199765 PositiveStrandReadsAssigned:96737 NegativeStrandReadsAssigned:7206988 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919379 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919379-trimmed-pair1.fastq SRR12919379-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,041,097 reads, 7,206,581 reads pseudoaligned [quant] estimated average fragment length: 250.918 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR12919379.ke.tsv 34699 SRR12919379.se.tsv 87100 total ==> SRR12919379.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.08 333 26.5236 Potri.005G024800.1.v4.1 1035 785.082 138 24.7545 Potri.004G059700.1.v4.1 961 711.178 39 7.72283 Potri.007G009000.2.v4.1 1416 1166.08 0 0 Potri.003G141000.2.v4.1 2943 2693.08 349.457 18.274 Potri.016G087400.1.v4.1 270 86.9115 370 599.535 Potri.015G069301.1.v4.1 564 326.518 0 0 Potri.010G195200.1.v4.1 1773 1523.08 64 5.91762 Potri.012G127500.1.v4.1 977 727.133 172 33.3123 ==> SRR12919379.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 92 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12919379 completed mapping pipeline successfully