Starting /dee2/code/volunteer_pipeline.sh SRR12919380 current disk space = 3050551980032 free memory = 1514127648 SRR12919380 SRAfilesize 0b342f557ceaef235dd22dafafa72568 SRR12919380.sra SRR12919380.sra file validated SRR12919380 is paired end SRR12919380 is conventional basespace SRR12919380 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919380_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.578 37.0 37.0 37.0 37.0 37.0 2 36.1655 37.0 37.0 37.0 37.0 37.0 3 36.528 37.0 37.0 37.0 37.0 37.0 4 36.614 37.0 37.0 37.0 37.0 37.0 5 36.681 37.0 37.0 37.0 37.0 37.0 6 36.6355 37.0 37.0 37.0 37.0 37.0 7 36.6435 37.0 37.0 37.0 37.0 37.0 8 36.6315 37.0 37.0 37.0 37.0 37.0 9 36.625 37.0 37.0 37.0 37.0 37.0 10-14 36.6636 37.0 37.0 37.0 37.0 37.0 15-19 36.5969 37.0 37.0 37.0 37.0 37.0 20-24 36.60269999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5384 37.0 37.0 37.0 37.0 37.0 30-34 36.5129 37.0 37.0 37.0 37.0 37.0 35-39 36.5497 37.0 37.0 37.0 37.0 37.0 40-44 36.5011 37.0 37.0 37.0 37.0 37.0 45-49 36.5022 37.0 37.0 37.0 37.0 37.0 50-54 36.48350000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.466 37.0 37.0 37.0 37.0 37.0 60-64 36.4234 37.0 37.0 37.0 37.0 37.0 65-69 36.4053 37.0 37.0 37.0 37.0 37.0 70-74 36.3662 37.0 37.0 37.0 37.0 37.0 75-79 36.346999999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.314 37.0 37.0 37.0 37.0 37.0 85-89 36.2452 37.0 37.0 37.0 37.0 37.0 90-94 36.2904 37.0 37.0 37.0 37.0 37.0 95-99 36.228899999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2066 37.0 37.0 37.0 37.0 37.0 105-109 36.1985 37.0 37.0 37.0 37.0 37.0 110-114 36.171200000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.149 37.0 37.0 37.0 37.0 37.0 120-124 36.1433 37.0 37.0 37.0 37.0 37.0 125-129 36.0676 37.0 37.0 37.0 37.0 37.0 130-134 36.0279 37.0 37.0 37.0 37.0 37.0 135-139 35.9002 37.0 37.0 37.0 37.0 37.0 140-144 35.8455 37.0 37.0 37.0 37.0 37.0 145-149 35.8768 37.0 37.0 37.0 37.0 37.0 150-151 35.72025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 3.0 26 2.0 27 6.0 28 6.0 29 12.0 30 23.0 31 25.0 32 45.0 33 69.0 34 130.0 35 311.0 36 2984.0 37 383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.849999999999994 12.0 5.25 41.9 2 18.907351460221548 13.343403826787512 39.45115810674723 28.298086606243704 3 16.825000000000003 17.675 28.749999999999996 36.75 4 23.0 25.424999999999997 22.725 28.849999999999998 5 23.325000000000003 30.825000000000003 24.55 21.3 6 20.9 34.275 24.025 20.8 7 15.825 26.55 41.0 16.625 8 16.175 26.325 33.525 23.974999999999998 9 16.45 25.575 35.325 22.650000000000002 10-14 19.725 29.459999999999997 28.134999999999998 22.68 15-19 19.675 27.445000000000004 28.865000000000002 24.015 20-24 19.84 28.515 28.07 23.575 25-29 19.634999999999998 28.549999999999997 28.310000000000002 23.505000000000003 30-34 19.91 28.58 27.955000000000002 23.555 35-39 19.830000000000002 28.575 27.839999999999996 23.755000000000003 40-44 19.939999999999998 28.694999999999997 27.860000000000003 23.505000000000003 45-49 19.775000000000002 28.555000000000003 27.92 23.75 50-54 20.24 28.144999999999996 27.785 23.830000000000002 55-59 19.705000000000002 28.48 27.779999999999998 24.035 60-64 20.51 28.455000000000002 27.785 23.25 65-69 20.025000000000002 28.405 27.775 23.794999999999998 70-74 19.97 28.945 27.76 23.325000000000003 75-79 20.06 28.42 28.115000000000002 23.405 80-84 19.985 28.910000000000004 27.639999999999997 23.465 85-89 20.04 28.03 28.395 23.535 90-94 20.49 28.1 27.575 23.835 95-99 20.41 28.735 27.134999999999998 23.72 100-104 20.355 28.175 27.689999999999998 23.78 105-109 20.65 28.360000000000003 27.644999999999996 23.345 110-114 20.625 28.355000000000004 28.13 22.89 115-119 20.515 28.775000000000002 26.88 23.830000000000002 120-124 20.835 28.799999999999997 27.089999999999996 23.275000000000002 125-129 20.415 28.884999999999998 26.979999999999997 23.72 130-134 20.365 28.675 27.224999999999998 23.735 135-139 21.27 28.199999999999996 26.56 23.97 140-144 20.53 28.605000000000004 27.375 23.49 145-149 20.97 28.425 26.355 24.25 150-151 21.425 28.6375 26.375 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 1.5 25 3.5 26 3.5 27 4.0 28 8.0 29 11.0 30 19.0 31 29.5 32 36.0 33 49.5 34 64.5 35 66.5 36 89.5 37 118.0 38 138.5 39 173.0 40 197.0 41 211.5 42 239.0 43 268.5 44 279.0 45 276.0 46 255.5 47 230.5 48 210.5 49 186.5 50 151.0 51 138.5 52 119.0 53 87.5 54 91.0 55 77.0 56 51.5 57 39.5 58 25.5 59 19.0 60 12.5 61 3.5 62 2.0 63 1.5 64 2.0 65 1.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.05219552609776 82.425 2 7.67743717205192 13.900000000000002 3 1.1046672190002762 3.0 4 0.11046672190002761 0.4 5 0.027616680475006903 0.125 6 0.027616680475006903 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTTCTTAACCTTCTCTTCTCACTGTCATAAGGTTGGCCGCAGGGGTCAT 6 0.15 No Hit CGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.425 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.2750000000000004 0.0 0.0 0.0 0.0 116-117 3.6125 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.2625 0.0 0.0 0.0 0.0 122-123 4.6625 0.0 0.0 0.0 0.0 124-125 4.987500000000001 0.0 0.0 0.0 0.0 126-127 5.425 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.512499999999999 0.0 0.0 0.0 0.0 136-137 8.025 0.0 0.0 0.0 0.0 138-139 8.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCAA 10 0.006830828 145.0 8 TTTTTCA 10 0.006830828 145.0 6 GATCTCA 10 0.006830828 145.0 7 GTGATCT 10 0.006830828 145.0 5 GGTGGTG 10 0.006830828 145.0 1 GTGGTGA 10 0.006830828 145.0 2 TCTCAAG 10 0.006830828 145.0 9 >>END_MODULE SRR12919380 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919380_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.024 37.0 37.0 37.0 37.0 37.0 2 35.6825 37.0 37.0 37.0 37.0 37.0 3 35.854 37.0 37.0 37.0 37.0 37.0 4 36.1 37.0 37.0 37.0 37.0 37.0 5 36.114 37.0 37.0 37.0 37.0 37.0 6 35.994 37.0 37.0 37.0 37.0 37.0 7 36.077 37.0 37.0 37.0 37.0 37.0 8 36.034 37.0 37.0 37.0 37.0 37.0 9 36.123 37.0 37.0 37.0 37.0 37.0 10-14 36.0755 37.0 37.0 37.0 37.0 37.0 15-19 36.1127 37.0 37.0 37.0 37.0 37.0 20-24 36.06949999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.0199 37.0 37.0 37.0 37.0 37.0 30-34 36.0235 37.0 37.0 37.0 37.0 37.0 35-39 35.9738 37.0 37.0 37.0 37.0 37.0 40-44 35.9911 37.0 37.0 37.0 37.0 37.0 45-49 35.9257 37.0 37.0 37.0 37.0 37.0 50-54 35.8534 37.0 37.0 37.0 37.0 37.0 55-59 35.9064 37.0 37.0 37.0 37.0 37.0 60-64 35.86 37.0 37.0 37.0 37.0 37.0 65-69 35.8039 37.0 37.0 37.0 37.0 37.0 70-74 35.724599999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.7156 37.0 37.0 37.0 37.0 37.0 80-84 35.740899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.785900000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.6221 37.0 37.0 37.0 37.0 37.0 95-99 35.6276 37.0 37.0 37.0 37.0 37.0 100-104 35.5891 37.0 37.0 37.0 37.0 37.0 105-109 35.5789 37.0 37.0 37.0 37.0 37.0 110-114 35.5589 37.0 37.0 37.0 37.0 37.0 115-119 35.429899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.4082 37.0 37.0 37.0 37.0 37.0 125-129 35.38680000000001 37.0 37.0 37.0 34.6 37.0 130-134 35.2173 37.0 37.0 37.0 29.8 37.0 135-139 35.1601 37.0 37.0 37.0 25.0 37.0 140-144 35.135200000000005 37.0 37.0 37.0 27.4 37.0 145-149 34.9942 37.0 37.0 37.0 25.0 37.0 150-151 34.738749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 0.0 16 2.0 17 2.0 18 0.0 19 1.0 20 2.0 21 2.0 22 4.0 23 6.0 24 5.0 25 11.0 26 9.0 27 15.0 28 16.0 29 27.0 30 38.0 31 60.0 32 85.0 33 140.0 34 239.0 35 661.0 36 2463.0 37 207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45 24.85 8.4 27.3 2 25.7 28.000000000000004 30.625000000000004 15.675 3 18.15 29.375 33.25 19.225 4 23.5 34.075 23.974999999999998 18.45 5 23.375 37.25 22.5 16.875 6 20.225 38.7 22.925 18.15 7 19.925 23.1 38.025 18.95 8 19.85 26.0 29.299999999999997 24.85 9 20.674999999999997 25.224999999999998 30.875000000000004 23.225 10-14 23.455000000000002 28.88 26.810000000000002 20.855 15-19 23.22 28.07 27.839999999999996 20.87 20-24 22.939999999999998 28.610000000000003 27.750000000000004 20.7 25-29 22.345000000000002 28.125 28.73 20.8 30-34 23.064999999999998 27.91 28.33 20.695 35-39 22.96 27.775 28.215 21.05 40-44 22.485 28.449999999999996 27.965 21.099999999999998 45-49 21.990000000000002 28.544999999999998 28.625 20.84 50-54 22.36 28.244999999999997 27.944999999999997 21.45 55-59 23.06 27.665 28.04 21.235 60-64 22.81 27.295 28.76 21.135 65-69 23.294999999999998 27.534999999999997 28.04 21.13 70-74 23.13 28.275 27.67 20.925 75-79 22.869999999999997 27.560000000000002 28.53 21.04 80-84 23.015 28.78 27.034999999999997 21.17 85-89 22.935 28.04 27.98 21.044999999999998 90-94 22.89 27.83 28.065 21.215 95-99 23.155 27.800000000000004 27.99 21.055 100-104 24.03 27.925 27.650000000000002 20.395 105-109 23.805 28.075 27.750000000000004 20.369999999999997 110-114 23.935000000000002 28.075 27.529999999999998 20.46 115-119 24.02 28.389999999999997 27.155 20.435 120-124 24.615000000000002 27.98 27.279999999999998 20.125 125-129 24.48 27.944999999999997 26.895000000000003 20.68 130-134 25.005 28.15 26.525 20.32 135-139 25.905 27.794999999999998 27.295 19.005 140-144 25.705 27.935 27.145000000000003 19.215 145-149 25.52 27.58 27.189999999999998 19.71 150-151 26.424999999999997 28.125 26.6 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.0 20 1.5 21 0.5 22 0.5 23 1.0 24 2.0 25 5.5 26 8.5 27 6.5 28 5.5 29 8.5 30 12.5 31 17.0 32 26.5 33 45.0 34 62.5 35 73.5 36 90.5 37 130.5 38 160.0 39 158.0 40 196.0 41 240.0 42 255.5 43 274.5 44 276.0 45 259.5 46 247.5 47 224.0 48 208.0 49 204.5 50 170.5 51 137.5 52 112.5 53 91.0 54 75.0 55 54.0 56 37.5 57 30.0 58 24.0 59 18.5 60 10.5 61 8.0 62 6.0 63 2.5 64 3.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 1.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.71711612548157 83.325 2 6.989543203082003 12.7 3 1.1007154650522841 3.0 4 0.0825536598789213 0.3 5 0.0 0.0 6 0.0550357732526142 0.3 7 0.0275178866263071 0.17500000000000002 8 0.0275178866263071 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit GCAAAGAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATC 6 0.15 No Hit CCTGTTTATCTCAACGTGTATGACTTGACGCCAATGAATGGCTACGCCTA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.9375 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.6625 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.3125 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.0375 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 5.95 0.0 0.0 0.0 0.0 130-131 6.487500000000001 0.0 0.0 0.0 0.0 132-133 7.0125 0.0 0.0 0.0 0.0 134-135 7.550000000000001 0.0 0.0 0.0 0.0 136-137 8.05 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGGAT 10 0.006830828 145.0 1 TTGAGAG 10 0.006830828 145.0 7 TTTTAGC 10 0.006830828 145.0 145 GATTGAG 10 0.006830828 145.0 5 ATTGAGA 10 0.006830828 145.0 6 GGGGATT 10 0.006830828 145.0 2 TGAGAGT 10 0.006830828 145.0 8 >>END_MODULE Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987838 spots for SRR12919380.sra Written 987838 spots for SRR12919380.sra Read 987843 spots for SRR12919380.sra Written 987843 spots for SRR12919380.sra SRR ids: ['SRR12919380.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3q15s7mk SRR12919380.sra spots: 19756765 blocks: [[1, 987838], [987839, 1975676], [1975677, 2963514], [2963515, 3951352], [3951353, 4939190], [4939191, 5927028], [5927029, 6914866], [6914867, 7902704], [7902705, 8890542], [8890543, 9878380], [9878381, 10866218], [10866219, 11854056], [11854057, 12841894], [12841895, 13829732], [13829733, 14817570], [14817571, 15805408], [15805409, 16793246], [16793247, 17781084], [17781085, 18768922], [18768923, 19756765]] SRR12919380 file size 6692512 SRR12919380 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919380 SRR12919380_1.fastq SRR12919380_2.fastq Input file: SRR12919380_1.fastq Paired file: SRR12919380_2.fastq trimmed: SRR12919380-trimmed-pair1.fastq, SRR12919380-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:59:39 2025 >> started Wed Feb 12 22:00:05 2025 >> done (25.540s) 19756765 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 786 ( 0.00%) empty read pairs filtered out after trimming by size control 19755937 (100.00%) read pairs available; of these: 2638827 (13.36%) trimmed read pairs available after processing 17117110 (86.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 4 0.00% 21 6 0.00% 22 3 0.00% 23 7 0.00% 24 2 0.00% 25 8 0.00% 26 8 0.00% 27 6 0.00% 28 20 0.00% 29 11 0.00% 30 12 0.00% 31 6 0.00% 32 10 0.00% 33 20 0.00% 34 18 0.00% 35 9 0.00% 36 22 0.00% 37 25 0.00% 38 21 0.00% 39 24 0.00% 40 22 0.00% 41 30 0.00% 42 41 0.00% 43 37 0.00% 44 49 0.00% 45 33 0.00% 46 60 0.00% 47 42 0.00% 48 65 0.00% 49 80 0.00% 50 92 0.00% 51 103 0.00% 52 88 0.00% 53 96 0.00% 54 134 0.00% 55 114 0.00% 56 166 0.00% 57 209 0.00% 58 212 0.00% 59 246 0.00% 60 299 0.00% 61 357 0.00% 62 461 0.00% 63 437 0.00% 64 528 0.00% 65 495 0.00% 66 526 0.00% 67 680 0.00% 68 698 0.00% 69 914 0.00% 70 1071 0.01% 71 1309 0.01% 72 1523 0.01% 73 1737 0.01% 74 1892 0.01% 75 2067 0.01% 76 2370 0.01% 77 2498 0.01% 78 2840 0.01% 79 3073 0.02% 80 3665 0.02% 81 4202 0.02% 82 4762 0.02% 83 5327 0.03% 84 6036 0.03% 85 6552 0.03% 86 7208 0.04% 87 7754 0.04% 88 8335 0.04% 89 8913 0.05% 90 9920 0.05% 91 11029 0.06% 92 11737 0.06% 93 13186 0.07% 94 14359 0.07% 95 15262 0.08% 96 16418 0.08% 97 17000 0.09% 98 17763 0.09% 99 18756 0.09% 100 19997 0.10% 101 20883 0.11% 102 22450 0.11% 103 23533 0.12% 104 25231 0.13% 105 26470 0.13% 106 27489 0.14% 107 28125 0.14% 108 29258 0.15% 109 29751 0.15% 110 30878 0.16% 111 32215 0.16% 112 33876 0.17% 113 34731 0.18% 114 36910 0.19% 115 38679 0.20% 116 38897 0.20% 117 40018 0.20% 118 40893 0.21% 119 41430 0.21% 120 42521 0.22% 121 43369 0.22% 122 44372 0.22% 123 46042 0.23% 124 47820 0.24% 125 48872 0.25% 126 49852 0.25% 127 51552 0.26% 128 51570 0.26% 129 52139 0.26% 130 52375 0.27% 131 53572 0.27% 132 54172 0.27% 133 55288 0.28% 134 56982 0.29% 135 57661 0.29% 136 59317 0.30% 137 59437 0.30% 138 60560 0.31% 139 61962 0.31% 140 61202 0.31% 141 63399 0.32% 142 63465 0.32% 143 64095 0.32% 144 65840 0.33% 145 67546 0.34% 146 68511 0.35% 147 68411 0.35% 148 69482 0.35% 149 68437 0.35% 150 71164 0.36% 151 17117110 86.64% 19755937 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=15 prefix-density=0.76 prefix-fanout=2.4 sequence=ACCTCCATGACT criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=120.02 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=18.3 sequence=ATTTCATCAAAAAAGGAACGTACGTACATGTGGATGATATACACCCCAGTTTATTTAAATTAGGAGGCCATTTATGACATATAATTTATTCTAGTACAATATTAGGGCATCCTTTATTATCATAGCACTCAAAAGACTCACGATCGAGGAGATTCATCTTCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAGTAGCTAACTCCTGAGTCTGAACTTGTTTTACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTTGTTGCATTAAAATTATCGTTAAGGAAGTCTCCGTATGCTTTATTTCGAACGTAAAAATCAGAAGTAGAACCCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATTCATCAGAATAGCATTGTCTTAACTTCAAATCCT criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=26 prefix-density=1.08 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=33.94 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12919380 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:00:50 Started mapping on | Feb 12 22:00:50 Finished on | Feb 12 22:02:59 Mapping speed, Million of reads per hour | 551.33 Number of input reads | 19755937 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18261134 Uniquely mapped reads % | 92.43% Average mapped length | 293.75 Number of splices: Total | 17925407 Number of splices: Annotated (sjdb) | 17466891 Number of splices: GT/AG | 17579175 Number of splices: GC/AG | 271233 Number of splices: AT/AC | 14526 Number of splices: Non-canonical | 60473 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.42 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 533060 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 31473 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 961743 961743 961743 N_multimapping 533060 533060 533060 N_noFeature 736209 17982211 860909 N_ambiguous 253082 1088 98313 UnstrandedReadsAssigned:17271843 PositiveStrandReadsAssigned:277835 NegativeStrandReadsAssigned:17301912 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919380 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919380-trimmed-pair1.fastq SRR12919380-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,755,937 reads, 17,445,127 reads pseudoaligned [quant] estimated average fragment length: 250.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR12919380.ke.tsv 34699 SRR12919380.se.tsv 87100 total ==> SRR12919380.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.45 556 15.5596 Potri.005G024800.1.v4.1 1035 785.454 580 36.5448 Potri.004G059700.1.v4.1 961 711.603 2 0.139095 Potri.007G009000.2.v4.1 1416 1166.45 0 0 Potri.003G141000.2.v4.1 2943 2693.45 931.465 17.1149 Potri.016G087400.1.v4.1 270 89.137 1235 685.689 Potri.015G069301.1.v4.1 564 328.932 0 0 Potri.010G195200.1.v4.1 1773 1523.45 71 2.30647 Potri.012G127500.1.v4.1 977 727.525 705 47.9578 ==> SRR12919380.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 165 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12919380 completed mapping pipeline successfully