Starting /dee2/code/volunteer_pipeline.sh SRR12919381 current disk space = 3050648666112 free memory = 1414183300 SRR12919381 SRAfilesize 18d90deeec78f3ad7a745a995201155e SRR12919381.sra SRR12919381.sra file validated SRR12919381 is paired end SRR12919381 is conventional basespace SRR12919381 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919381_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6165 37.0 37.0 37.0 37.0 37.0 2 36.2815 37.0 37.0 37.0 37.0 37.0 3 36.617 37.0 37.0 37.0 37.0 37.0 4 36.701 37.0 37.0 37.0 37.0 37.0 5 36.687 37.0 37.0 37.0 37.0 37.0 6 36.652 37.0 37.0 37.0 37.0 37.0 7 36.6 37.0 37.0 37.0 37.0 37.0 8 36.702 37.0 37.0 37.0 37.0 37.0 9 36.7035 37.0 37.0 37.0 37.0 37.0 10-14 36.700900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.611200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.6192 37.0 37.0 37.0 37.0 37.0 25-29 36.5797 37.0 37.0 37.0 37.0 37.0 30-34 36.581 37.0 37.0 37.0 37.0 37.0 35-39 36.5585 37.0 37.0 37.0 37.0 37.0 40-44 36.5487 37.0 37.0 37.0 37.0 37.0 45-49 36.5338 37.0 37.0 37.0 37.0 37.0 50-54 36.479200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.523399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.4756 37.0 37.0 37.0 37.0 37.0 65-69 36.434900000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.4247 37.0 37.0 37.0 37.0 37.0 75-79 36.3087 37.0 37.0 37.0 37.0 37.0 80-84 36.3529 37.0 37.0 37.0 37.0 37.0 85-89 36.299400000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.27759999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.32040000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.2438 37.0 37.0 37.0 37.0 37.0 105-109 36.1802 37.0 37.0 37.0 37.0 37.0 110-114 36.170899999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1648 37.0 37.0 37.0 37.0 37.0 120-124 36.097300000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0462 37.0 37.0 37.0 37.0 37.0 130-134 35.959999999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.904199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8553 37.0 37.0 37.0 37.0 37.0 145-149 35.7803 37.0 37.0 37.0 37.0 37.0 150-151 35.676249999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 0.0 27 5.0 28 7.0 29 14.0 30 24.0 31 34.0 32 25.0 33 66.0 34 117.0 35 334.0 36 2972.0 37 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.375 13.225000000000001 5.775 34.625 2 19.395465994962215 13.173803526448363 38.085642317380355 29.345088161209066 3 16.625 20.225 29.325000000000003 33.825 4 22.125 26.5 23.825 27.55 5 21.65 33.15 24.3 20.9 6 19.55 35.05 24.25 21.15 7 15.575 26.400000000000002 41.275 16.75 8 17.224999999999998 26.75 32.550000000000004 23.474999999999998 9 17.2 22.975 34.425 25.4 10-14 20.02 29.825000000000003 26.505000000000003 23.65 15-19 20.18 28.360000000000003 27.18 24.279999999999998 20-24 19.465 28.720000000000002 27.71 24.104999999999997 25-29 20.849999999999998 28.42 27.355 23.375 30-34 19.785 28.425 28.444999999999997 23.345 35-39 20.275000000000002 28.58 27.805000000000003 23.34 40-44 20.41 28.050000000000004 27.195000000000004 24.345 45-49 20.085 28.26 27.555000000000003 24.099999999999998 50-54 20.455000000000002 28.499999999999996 27.750000000000004 23.294999999999998 55-59 20.265 28.64 27.24 23.855 60-64 20.595 27.939999999999998 27.595 23.87 65-69 20.505000000000003 28.52 27.295 23.68 70-74 20.77 28.65 27.450000000000003 23.13 75-79 20.44 28.03 27.315 24.215 80-84 20.169999999999998 28.76 27.634999999999998 23.435 85-89 19.98 28.560000000000002 27.694999999999997 23.765 90-94 20.51 27.82 27.395000000000003 24.275 95-99 20.845 28.494999999999997 27.025 23.635 100-104 20.19 28.835 27.089999999999996 23.885 105-109 20.84 28.915000000000003 26.584999999999997 23.66 110-114 20.705000000000002 28.4 27.455000000000002 23.44 115-119 21.965 28.225 27.0 22.81 120-124 20.555 28.34 26.919999999999998 24.185000000000002 125-129 21.075 28.62 26.75 23.555 130-134 21.45 28.01 26.735 23.805 135-139 20.995 27.98 26.83 24.195 140-144 21.05 27.900000000000002 27.24 23.810000000000002 145-149 21.855 28.285 26.479999999999997 23.380000000000003 150-151 21.349999999999998 27.35 26.775 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 2.5 23 4.0 24 4.5 25 5.0 26 5.0 27 6.0 28 11.0 29 13.5 30 14.5 31 22.0 32 33.5 33 39.5 34 54.5 35 69.5 36 77.5 37 103.5 38 135.0 39 161.0 40 185.5 41 205.0 42 221.5 43 248.0 44 254.0 45 257.0 46 258.0 47 237.5 48 226.5 49 212.5 50 178.5 51 149.0 52 128.5 53 99.5 54 82.5 55 72.5 56 61.5 57 50.5 58 32.0 59 24.0 60 20.5 61 11.0 62 7.0 63 4.5 64 2.5 65 1.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.03056768558952 84.3 2 6.986899563318777 12.8 3 0.8460698689956333 2.325 4 0.08187772925764192 0.3 5 0.02729257641921397 0.125 6 0.02729257641921397 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GACGAAAACCCCCGTACCTTCTATCACCAGGTCGACCTCCATGTCCTTCC 6 0.15 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0999999999999996 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.7249999999999996 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.5875 0.0 0.0 0.0 0.0 112-113 3.95 0.0 0.0 0.0 0.0 114-115 4.1625 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 5.074999999999999 0.0 0.0 0.0 0.0 120-121 5.575 0.0 0.0 0.0 0.0 122-123 5.8875 0.0 0.0 0.0 0.0 124-125 6.5125 0.0 0.0 0.0 0.0 126-127 7.0 0.0 0.0 0.0 0.0 128-129 7.5625 0.0 0.0 0.0 0.0 130-131 8.175 0.0 0.0 0.0 0.0 132-133 8.649999999999999 0.0 0.0 0.0 0.0 134-135 9.1875 0.0 0.0 0.0 0.0 136-137 9.7625 0.0 0.0 0.0 0.0 138-139 10.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGGTG 10 0.006830828 145.0 4 TGGTGGT 10 0.006830828 145.0 3 >>END_MODULE SRR12919381 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919381_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.232 37.0 37.0 37.0 37.0 37.0 2 36.1605 37.0 37.0 37.0 37.0 37.0 3 36.233 37.0 37.0 37.0 37.0 37.0 4 36.25 37.0 37.0 37.0 37.0 37.0 5 36.3765 37.0 37.0 37.0 37.0 37.0 6 36.2105 37.0 37.0 37.0 37.0 37.0 7 36.287 37.0 37.0 37.0 37.0 37.0 8 36.238 37.0 37.0 37.0 37.0 37.0 9 36.326 37.0 37.0 37.0 37.0 37.0 10-14 36.259 37.0 37.0 37.0 37.0 37.0 15-19 36.2537 37.0 37.0 37.0 37.0 37.0 20-24 36.248900000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.1943 37.0 37.0 37.0 37.0 37.0 30-34 36.1713 37.0 37.0 37.0 37.0 37.0 35-39 36.179500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.13430000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.1423 37.0 37.0 37.0 37.0 37.0 50-54 36.1399 37.0 37.0 37.0 37.0 37.0 55-59 36.0958 37.0 37.0 37.0 37.0 37.0 60-64 36.062400000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9987 37.0 37.0 37.0 37.0 37.0 70-74 35.9602 37.0 37.0 37.0 37.0 37.0 75-79 35.9063 37.0 37.0 37.0 37.0 37.0 80-84 35.9283 37.0 37.0 37.0 37.0 37.0 85-89 35.8674 37.0 37.0 37.0 37.0 37.0 90-94 35.8231 37.0 37.0 37.0 37.0 37.0 95-99 35.844300000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8378 37.0 37.0 37.0 37.0 37.0 105-109 35.75789999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.680600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.713 37.0 37.0 37.0 37.0 37.0 120-124 35.6272 37.0 37.0 37.0 37.0 37.0 125-129 35.596 37.0 37.0 37.0 37.0 37.0 130-134 35.533100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.3364 37.0 37.0 37.0 37.0 37.0 140-144 35.182500000000005 37.0 37.0 37.0 29.8 37.0 145-149 35.119299999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.95675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 2.0 15 3.0 16 1.0 17 2.0 18 3.0 19 0.0 20 3.0 21 4.0 22 2.0 23 5.0 24 4.0 25 7.0 26 8.0 27 11.0 28 13.0 29 16.0 30 35.0 31 42.0 32 49.0 33 110.0 34 202.0 35 525.0 36 2660.0 37 288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.525 24.349999999999998 6.825 22.3 2 27.075 25.95 30.85 16.125 3 20.525 27.800000000000004 32.574999999999996 19.1 4 24.725 34.25 23.875 17.150000000000002 5 24.85 37.35 21.375 16.425 6 21.4 39.45 21.224999999999998 17.925 7 20.724999999999998 22.725 36.975 19.575 8 20.150000000000002 25.974999999999998 27.975 25.900000000000002 9 21.825 24.2 30.125 23.849999999999998 10-14 23.674999999999997 28.82 26.419999999999998 21.085 15-19 23.305 27.85 27.775 21.07 20-24 23.05 28.599999999999998 27.839999999999996 20.51 25-29 22.905 28.305000000000003 28.095 20.695 30-34 22.55 28.68 28.095 20.674999999999997 35-39 23.244999999999997 28.194999999999997 27.54 21.02 40-44 22.884999999999998 28.505000000000003 27.55 21.060000000000002 45-49 22.465 28.375 27.975 21.185000000000002 50-54 22.845 28.065 27.634999999999998 21.455 55-59 23.055 28.77 27.245 20.93 60-64 22.564999999999998 28.189999999999998 27.935 21.310000000000002 65-69 23.415 27.855 28.16 20.57 70-74 22.845 28.410000000000004 27.694999999999997 21.05 75-79 22.985 27.21 28.33 21.475 80-84 23.385 27.415 27.495000000000005 21.705 85-89 23.630000000000003 28.299999999999997 27.250000000000004 20.82 90-94 23.685000000000002 27.694999999999997 27.529999999999998 21.09 95-99 23.41 27.54 27.939999999999998 21.11 100-104 24.23 27.375 27.474999999999998 20.919999999999998 105-109 24.235 28.12 27.889999999999997 19.755 110-114 24.4 28.349999999999998 26.924999999999997 20.325 115-119 24.545 28.215 26.965 20.275000000000002 120-124 24.855 28.375 26.945000000000004 19.825 125-129 25.385 28.215 26.63 19.77 130-134 25.595000000000002 27.834999999999997 26.369999999999997 20.200000000000003 135-139 26.515 27.400000000000002 26.695 19.39 140-144 26.6 26.229999999999997 27.055 20.115 145-149 27.375 27.08 26.400000000000002 19.145 150-151 28.1 27.1375 26.150000000000002 18.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 1.0 12 2.0 13 1.5 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 3.0 23 2.5 24 1.0 25 4.0 26 7.0 27 6.0 28 5.0 29 9.0 30 15.5 31 25.0 32 36.5 33 42.0 34 49.0 35 68.0 36 91.0 37 109.5 38 126.0 39 150.5 40 187.0 41 215.5 42 240.0 43 267.0 44 271.5 45 269.5 46 266.5 47 245.5 48 225.0 49 199.5 50 173.0 51 142.0 52 106.0 53 91.0 54 85.5 55 65.5 56 44.5 57 37.0 58 28.0 59 22.0 60 15.5 61 10.0 62 8.5 63 6.0 64 4.0 65 1.0 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.12684527063969 84.25 2 6.779661016949152 12.4 3 0.9021323127392018 2.475 4 0.08201202843083652 0.3 5 0.054674685620557675 0.25 6 0.027337342810278838 0.15 7 0.027337342810278838 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GCCAAACCATCTCTTCAGGCAAGTGGAAAGGGATTTACAGATTTCTCAGG 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.7999999999999998 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.4625 0.0 0.0 0.0 0.0 106-107 2.7750000000000004 0.0 0.0 0.0 0.0 108-109 3.2875 0.0 0.0 0.0 0.0 110-111 3.6375 0.0 0.0 0.0 0.0 112-113 4.0 0.0 0.0 0.0 0.0 114-115 4.25 0.0 0.0 0.0 0.0 116-117 4.75 0.0 0.0 0.0 0.0 118-119 5.225 0.0 0.0 0.0 0.0 120-121 5.737500000000001 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.6375 0.0 0.0 0.0 0.0 126-127 7.1 0.0 0.0 0.0 0.0 128-129 7.6625 0.0 0.0 0.0 0.0 130-131 8.275 0.0 0.0 0.0 0.0 132-133 8.825 0.0 0.0 0.0 0.0 134-135 9.337499999999999 0.0 0.0 0.0 0.0 136-137 9.9375 0.0 0.0 0.0 0.0 138-139 10.850000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGAT 10 0.006830828 145.0 1 TTCAACA 10 0.006830828 145.0 7 AAAAAAA 30 0.0014437955 24.166668 40-44 GGGGGGG 125 4.26335E-4 10.440001 135-139 >>END_MODULE Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815592 spots for SRR12919381.sra Written 815592 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra Read 815576 spots for SRR12919381.sra Written 815576 spots for SRR12919381.sra SRR ids: ['SRR12919381.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1uo8g_0p SRR12919381.sra spots: 16311536 blocks: [[1, 815576], [815577, 1631152], [1631153, 2446728], [2446729, 3262304], [3262305, 4077880], [4077881, 4893456], [4893457, 5709032], [5709033, 6524608], [6524609, 7340184], [7340185, 8155760], [8155761, 8971336], [8971337, 9786912], [9786913, 10602488], [10602489, 11418064], [11418065, 12233640], [12233641, 13049216], [13049217, 13864792], [13864793, 14680368], [14680369, 15495944], [15495945, 16311536]] SRR12919381 file size 5521673 SRR12919381 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919381 SRR12919381_1.fastq SRR12919381_2.fastq Input file: SRR12919381_1.fastq Paired file: SRR12919381_2.fastq trimmed: SRR12919381-trimmed-pair1.fastq, SRR12919381-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:41:29 2025 >> started Wed Feb 12 21:41:57 2025 >> done (27.892s) 16311536 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 880 ( 0.01%) empty read pairs filtered out after trimming by size control 16310639 (99.99%) read pairs available; of these: 2409409 (14.77%) trimmed read pairs available after processing 13901230 (85.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 1 0.00% 21 3 0.00% 22 5 0.00% 23 1 0.00% 24 7 0.00% 25 5 0.00% 26 3 0.00% 27 5 0.00% 28 8 0.00% 29 12 0.00% 30 14 0.00% 31 7 0.00% 32 7 0.00% 33 14 0.00% 34 12 0.00% 35 17 0.00% 36 18 0.00% 37 8 0.00% 38 24 0.00% 39 18 0.00% 40 33 0.00% 41 32 0.00% 42 29 0.00% 43 31 0.00% 44 36 0.00% 45 42 0.00% 46 47 0.00% 47 48 0.00% 48 59 0.00% 49 75 0.00% 50 94 0.00% 51 96 0.00% 52 131 0.00% 53 121 0.00% 54 119 0.00% 55 163 0.00% 56 162 0.00% 57 187 0.00% 58 238 0.00% 59 275 0.00% 60 312 0.00% 61 461 0.00% 62 505 0.00% 63 551 0.00% 64 562 0.00% 65 595 0.00% 66 644 0.00% 67 692 0.00% 68 842 0.01% 69 929 0.01% 70 1194 0.01% 71 1466 0.01% 72 1657 0.01% 73 2014 0.01% 74 2268 0.01% 75 2319 0.01% 76 2375 0.01% 77 2694 0.02% 78 2938 0.02% 79 3354 0.02% 80 3954 0.02% 81 4680 0.03% 82 5427 0.03% 83 5990 0.04% 84 6696 0.04% 85 7135 0.04% 86 7443 0.05% 87 7746 0.05% 88 8196 0.05% 89 8827 0.05% 90 9860 0.06% 91 11105 0.07% 92 12424 0.08% 93 14085 0.09% 94 14894 0.09% 95 16082 0.10% 96 16170 0.10% 97 16371 0.10% 98 16939 0.10% 99 17651 0.11% 100 18490 0.11% 101 19930 0.12% 102 22015 0.13% 103 23993 0.15% 104 25585 0.16% 105 26242 0.16% 106 26618 0.16% 107 26543 0.16% 108 27047 0.17% 109 27158 0.17% 110 27650 0.17% 111 29501 0.18% 112 31433 0.19% 113 33137 0.20% 114 34924 0.21% 115 36175 0.22% 116 36951 0.23% 117 37385 0.23% 118 36561 0.22% 119 36763 0.23% 120 37734 0.23% 121 38527 0.24% 122 39904 0.24% 123 42152 0.26% 124 44841 0.27% 125 45495 0.28% 126 47059 0.29% 127 46413 0.28% 128 46104 0.28% 129 46157 0.28% 130 45416 0.28% 131 46161 0.28% 132 47560 0.29% 133 49593 0.30% 134 51929 0.32% 135 53843 0.33% 136 54321 0.33% 137 54369 0.33% 138 54076 0.33% 139 53627 0.33% 140 53200 0.33% 141 53915 0.33% 142 54258 0.33% 143 55529 0.34% 144 58689 0.36% 145 59611 0.37% 146 60619 0.37% 147 60973 0.37% 148 61254 0.38% 149 59558 0.37% 150 60161 0.37% 151 13901230 85.23% 16310639 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=11.85 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=3.6 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=26 prefix-density=0.62 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=18.55 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.8 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACC SRR12919381 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:43:00 Started mapping on | Feb 12 21:43:01 Finished on | Feb 12 21:45:14 Mapping speed, Million of reads per hour | 441.49 Number of input reads | 16310639 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15213162 Uniquely mapped reads % | 93.27% Average mapped length | 292.89 Number of splices: Total | 14660579 Number of splices: Annotated (sjdb) | 14333443 Number of splices: GT/AG | 14346508 Number of splices: GC/AG | 252052 Number of splices: AT/AC | 12280 Number of splices: Non-canonical | 49739 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366128 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 18181 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.21% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 731349 731349 731349 N_multimapping 366128 366128 366128 N_noFeature 582150 14994363 671502 N_ambiguous 221639 984 91524 UnstrandedReadsAssigned:14409373 PositiveStrandReadsAssigned:217815 NegativeStrandReadsAssigned:14450136 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919381 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919381-trimmed-pair1.fastq SRR12919381-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,310,639 reads, 14,514,982 reads pseudoaligned [quant] estimated average fragment length: 246.785 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR12919381.ke.tsv 34699 SRR12919381.se.tsv 87100 total ==> SRR12919381.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.22 611 23.0773 Potri.005G024800.1.v4.1 1035 789.215 508 43.0852 Potri.004G059700.1.v4.1 961 715.446 15 1.40338 Potri.007G009000.2.v4.1 1416 1170.22 0 0 Potri.003G141000.2.v4.1 2943 2697.22 571.478 14.1822 Potri.016G087400.1.v4.1 270 92.6712 634.755 458.48 Potri.015G069301.1.v4.1 564 333.748 0 0 Potri.010G195200.1.v4.1 1773 1527.22 49 2.14761 Potri.012G127500.1.v4.1 977 731.342 194 17.7558 ==> SRR12919381.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 92 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12919381 completed mapping pipeline successfully