Starting /dee2/code/volunteer_pipeline.sh SRR12919382 current disk space = 3050540441600 free memory = 1468379064 SRR12919382 SRAfilesize 0f4b02c4b08b6ae33cf1a741f4d6585f SRR12919382.sra SRR12919382.sra file validated SRR12919382 is paired end SRR12919382 is conventional basespace SRR12919382 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919382_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.553 37.0 37.0 37.0 37.0 37.0 2 36.31575 37.0 37.0 37.0 37.0 37.0 3 36.564 37.0 37.0 37.0 37.0 37.0 4 36.638 37.0 37.0 37.0 37.0 37.0 5 36.708 37.0 37.0 37.0 37.0 37.0 6 36.619 37.0 37.0 37.0 37.0 37.0 7 36.557 37.0 37.0 37.0 37.0 37.0 8 36.685 37.0 37.0 37.0 37.0 37.0 9 36.6635 37.0 37.0 37.0 37.0 37.0 10-14 36.658100000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.6041 37.0 37.0 37.0 37.0 37.0 20-24 36.6591 37.0 37.0 37.0 37.0 37.0 25-29 36.546 37.0 37.0 37.0 37.0 37.0 30-34 36.5274 37.0 37.0 37.0 37.0 37.0 35-39 36.520300000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.513299999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.5027 37.0 37.0 37.0 37.0 37.0 50-54 36.4216 37.0 37.0 37.0 37.0 37.0 55-59 36.472300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.4189 37.0 37.0 37.0 37.0 37.0 65-69 36.368 37.0 37.0 37.0 37.0 37.0 70-74 36.35359999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.337 37.0 37.0 37.0 37.0 37.0 80-84 36.349199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2691 37.0 37.0 37.0 37.0 37.0 90-94 36.2504 37.0 37.0 37.0 37.0 37.0 95-99 36.237700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.265100000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1896 37.0 37.0 37.0 37.0 37.0 110-114 36.1237 37.0 37.0 37.0 37.0 37.0 115-119 36.095299999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0695 37.0 37.0 37.0 37.0 37.0 125-129 36.0175 37.0 37.0 37.0 37.0 37.0 130-134 35.97 37.0 37.0 37.0 37.0 37.0 135-139 35.825199999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.75449999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7341 37.0 37.0 37.0 37.0 37.0 150-151 35.509 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 0.0 24 1.0 25 4.0 26 7.0 27 6.0 28 8.0 29 9.0 30 20.0 31 27.0 32 36.0 33 64.0 34 127.0 35 315.0 36 3020.0 37 354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.3 11.825 5.8999999999999995 39.975 2 20.04521477015825 12.961567445365485 36.95051494599347 30.042702838482793 3 17.125 16.650000000000002 28.175 38.05 4 22.1 24.575 24.125 29.2 5 23.575 31.45 24.95 20.025000000000002 6 20.0 35.55 24.275 20.175 7 16.1 26.6 41.05 16.25 8 17.75 25.900000000000002 32.074999999999996 24.275 9 17.175 24.95 33.650000000000006 24.224999999999998 10-14 19.475 30.115 27.43 22.98 15-19 20.315 27.975 27.825 23.885 20-24 19.675 28.365000000000002 28.134999999999998 23.825 25-29 19.875 28.444999999999997 27.57 24.11 30-34 20.365 27.935 27.950000000000003 23.75 35-39 19.465 28.365000000000002 28.42 23.75 40-44 19.985 28.294999999999998 28.144999999999996 23.575 45-49 19.89 28.835 27.915 23.36 50-54 19.81 28.735 27.939999999999998 23.515 55-59 19.55 28.244999999999997 27.6 24.605 60-64 20.23 28.54 27.51 23.72 65-69 19.67 28.475 28.285 23.57 70-74 19.765 27.76 28.22 24.255 75-79 20.235 27.875 27.87 24.02 80-84 20.345 29.409999999999997 27.26 22.985 85-89 19.919999999999998 28.335 27.250000000000004 24.495 90-94 19.85 28.24 27.939999999999998 23.97 95-99 20.625 28.075 27.555000000000003 23.745 100-104 20.119999999999997 28.410000000000004 27.965 23.505000000000003 105-109 20.705000000000002 28.060000000000002 27.61 23.625 110-114 20.02 28.225 27.46 24.295 115-119 20.905 27.575 27.35 24.169999999999998 120-124 20.810000000000002 27.88 27.055 24.255 125-129 20.715 28.23 27.065 23.990000000000002 130-134 20.57 27.67 27.955000000000002 23.805 135-139 21.66 28.15 26.44 23.75 140-144 21.355 28.48 26.290000000000003 23.875 145-149 20.745 27.529999999999998 27.435 24.29 150-151 21.8 28.037499999999998 26.2875 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 2.5 26 4.0 27 5.5 28 6.5 29 10.5 30 20.5 31 30.0 32 32.0 33 34.0 34 44.0 35 66.5 36 96.0 37 117.5 38 131.5 39 152.5 40 184.0 41 231.0 42 250.0 43 245.5 44 257.0 45 271.5 46 258.0 47 248.5 48 246.5 49 217.0 50 187.0 51 147.0 52 114.5 53 90.5 54 69.5 55 55.0 56 47.0 57 43.0 58 24.5 59 14.5 60 15.0 61 9.5 62 4.0 63 2.0 64 2.0 65 2.5 66 2.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.25 #Duplication Level Percentage of deduplicated Percentage of total 1 90.47091412742382 81.65 2 8.448753462603879 15.25 3 0.9418282548476453 2.55 4 0.110803324099723 0.4 5 0.0 0.0 6 0.02770083102493075 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGTATCCAATGTAATTATCCACGGCCCATTCTCAGCAGTTGCGTCTGC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.075 0.0 0.0 0.0 16-17 0.0 0.075 0.0 0.0 0.0 18-19 0.0 0.075 0.0 0.0 0.0 20-21 0.0 0.075 0.0 0.0 0.0 22-23 0.0 0.075 0.0 0.0 0.0 24-25 0.0 0.075 0.0 0.0 0.0 26-27 0.0 0.075 0.0 0.0 0.0 28-29 0.0 0.075 0.0 0.0 0.0 30-31 0.0 0.075 0.0 0.0 0.0 32-33 0.0 0.075 0.0 0.0 0.0 34-35 0.0 0.075 0.0 0.0 0.0 36-37 0.0 0.075 0.0 0.0 0.0 38-39 0.0 0.075 0.0 0.0 0.0 40-41 0.0 0.075 0.0 0.0 0.0 42-43 0.0 0.075 0.0 0.0 0.0 44-45 0.0 0.075 0.0 0.0 0.0 46-47 0.0 0.075 0.0 0.0 0.0 48-49 0.0 0.075 0.0 0.0 0.0 50-51 0.0 0.075 0.0 0.0 0.0 52-53 0.0 0.075 0.0 0.0 0.0 54-55 0.0 0.075 0.0 0.0 0.0 56-57 0.0 0.075 0.0 0.0 0.0 58-59 0.025 0.075 0.0 0.0 0.0 60-61 0.05 0.075 0.0 0.0 0.0 62-63 0.05 0.075 0.0 0.0 0.0 64-65 0.05 0.075 0.0 0.0 0.0 66-67 0.05 0.075 0.0 0.0 0.0 68-69 0.05 0.075 0.0 0.0 0.0 70-71 0.0625 0.075 0.0 0.0 0.0 72-73 0.075 0.075 0.0 0.0 0.0 74-75 0.075 0.075 0.0 0.0 0.0 76-77 0.075 0.075 0.0 0.0 0.0 78-79 0.075 0.075 0.0 0.0 0.0 80-81 0.1 0.075 0.0 0.0 0.0 82-83 0.1 0.075 0.0 0.0 0.0 84-85 0.125 0.075 0.0 0.0 0.0 86-87 0.175 0.075 0.0 0.0 0.0 88-89 0.30000000000000004 0.075 0.0 0.0 0.0 90-91 0.375 0.075 0.0 0.0 0.0 92-93 0.4375 0.075 0.0 0.0 0.0 94-95 0.55 0.075 0.0 0.0 0.0 96-97 0.625 0.075 0.0 0.0 0.0 98-99 0.8999999999999999 0.075 0.0 0.0 0.0 100-101 1.0625 0.075 0.0 0.0 0.0 102-103 1.1875 0.075 0.0 0.0 0.0 104-105 1.2875 0.075 0.0 0.0 0.0 106-107 1.35 0.075 0.0 0.0 0.0 108-109 1.475 0.075 0.0 0.0 0.0 110-111 1.5750000000000002 0.075 0.0 0.0 0.0 112-113 1.8624999999999998 0.075 0.0 0.0 0.0 114-115 2.1125 0.075 0.0 0.0 0.0 116-117 2.375 0.075 0.0 0.0 0.0 118-119 2.6375 0.075 0.0 0.0 0.0 120-121 2.825 0.075 0.0 0.0 0.0 122-123 3.2249999999999996 0.075 0.0 0.0 0.0 124-125 3.5250000000000004 0.075 0.0 0.0 0.0 126-127 3.9250000000000003 0.075 0.0 0.0 0.0 128-129 4.35 0.075 0.0 0.0 0.0 130-131 4.8625 0.075 0.0 0.0 0.0 132-133 5.375 0.075 0.0 0.0 0.0 134-135 5.85 0.075 0.0 0.0 0.0 136-137 6.35 0.075 0.0 0.0 0.0 138-139 6.8875 0.075 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCAGT 10 0.006830828 145.0 3 GCAGTTG 10 0.006830828 145.0 5 TGCAGTT 10 0.006830828 145.0 4 >>END_MODULE SRR12919382 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919382_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.288 37.0 37.0 37.0 37.0 37.0 2 36.1025 37.0 37.0 37.0 37.0 37.0 3 36.1715 37.0 37.0 37.0 37.0 37.0 4 36.295 37.0 37.0 37.0 37.0 37.0 5 36.274 37.0 37.0 37.0 37.0 37.0 6 36.3015 37.0 37.0 37.0 37.0 37.0 7 36.257 37.0 37.0 37.0 37.0 37.0 8 36.2525 37.0 37.0 37.0 37.0 37.0 9 36.323 37.0 37.0 37.0 37.0 37.0 10-14 36.315999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.356700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2879 37.0 37.0 37.0 37.0 37.0 25-29 36.248599999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.153800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2076 37.0 37.0 37.0 37.0 37.0 40-44 36.1511 37.0 37.0 37.0 37.0 37.0 45-49 36.1333 37.0 37.0 37.0 37.0 37.0 50-54 36.0823 37.0 37.0 37.0 37.0 37.0 55-59 36.044200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0556 37.0 37.0 37.0 37.0 37.0 65-69 35.990300000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9634 37.0 37.0 37.0 37.0 37.0 75-79 35.9751 37.0 37.0 37.0 37.0 37.0 80-84 35.9036 37.0 37.0 37.0 37.0 37.0 85-89 35.925200000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.8435 37.0 37.0 37.0 37.0 37.0 95-99 35.829 37.0 37.0 37.0 37.0 37.0 100-104 35.7558 37.0 37.0 37.0 37.0 37.0 105-109 35.751 37.0 37.0 37.0 37.0 37.0 110-114 35.7004 37.0 37.0 37.0 37.0 37.0 115-119 35.661500000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.601600000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.658300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.5526 37.0 37.0 37.0 37.0 37.0 135-139 35.3671 37.0 37.0 37.0 34.6 37.0 140-144 35.421099999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.184799999999996 37.0 37.0 37.0 29.8 37.0 150-151 35.176 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 6.0 16 1.0 17 0.0 18 1.0 19 1.0 20 1.0 21 2.0 22 3.0 23 2.0 24 9.0 25 9.0 26 14.0 27 4.0 28 16.0 29 14.0 30 37.0 31 33.0 32 58.0 33 85.0 34 213.0 35 574.0 36 2653.0 37 261.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.449999999999996 22.25 9.4 26.900000000000002 2 26.325 27.875 30.575000000000003 15.225 3 20.775 28.499999999999996 32.45 18.275 4 23.599999999999998 33.800000000000004 22.525000000000002 20.075000000000003 5 23.925 37.225 21.825 17.025000000000002 6 21.175 38.65 22.7 17.474999999999998 7 20.125 22.325 38.375 19.175 8 21.075 25.15 28.65 25.124999999999996 9 22.725 23.25 30.55 23.474999999999998 10-14 23.305 29.035 26.795 20.865000000000002 15-19 22.915 28.43 27.834999999999997 20.82 20-24 23.585 28.515 27.37 20.53 25-29 23.635 28.549999999999997 27.725 20.09 30-34 23.06 27.97 28.415000000000003 20.555 35-39 23.7 27.965 28.09 20.244999999999997 40-44 23.56 28.310000000000002 27.55 20.580000000000002 45-49 23.46 27.88 27.725 20.935000000000002 50-54 23.27 28.04 28.09 20.599999999999998 55-59 23.615 28.285 27.474999999999998 20.625 60-64 23.24 27.689999999999998 27.77 21.3 65-69 23.48 27.715 28.384999999999998 20.419999999999998 70-74 23.47 29.2 26.945000000000004 20.385 75-79 23.5 28.035 27.47 20.995 80-84 23.685000000000002 28.22 27.705000000000002 20.39 85-89 22.875 28.249999999999996 27.689999999999998 21.185000000000002 90-94 24.185000000000002 27.860000000000003 27.07 20.885 95-99 23.830000000000002 28.43 27.08 20.66 100-104 23.7 27.76 27.41 21.13 105-109 23.685000000000002 27.57 28.15 20.595 110-114 23.955000000000002 28.07 26.935 21.04 115-119 23.79 28.59 27.35 20.27 120-124 24.235 27.994999999999997 27.61 20.16 125-129 24.32 27.865000000000002 27.800000000000004 20.015 130-134 24.279999999999998 27.384999999999998 28.285 20.05 135-139 25.264999999999997 28.084999999999997 26.465 20.185 140-144 25.465 28.499999999999996 26.51 19.525000000000002 145-149 25.665 27.76 26.674999999999997 19.900000000000002 150-151 26.5125 27.6375 26.787499999999998 19.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.5 23 1.5 24 1.5 25 5.5 26 7.0 27 7.5 28 8.0 29 9.0 30 19.0 31 26.0 32 23.5 33 33.5 34 53.0 35 64.5 36 85.5 37 109.5 38 123.5 39 155.0 40 189.0 41 229.0 42 247.0 43 244.5 44 283.0 45 291.5 46 258.5 47 241.0 48 230.5 49 212.0 50 173.0 51 151.0 52 127.0 53 82.0 54 69.5 55 67.5 56 53.5 57 34.0 58 21.5 59 18.0 60 12.5 61 8.0 62 4.5 63 4.0 64 3.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.55 #Duplication Level Percentage of deduplicated Percentage of total 1 90.86140254003313 82.27499999999999 2 8.089453340695748 14.649999999999999 3 0.8558807288790724 2.325 4 0.16565433462175594 0.6 5 0.0 0.0 6 0.02760905577029266 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTACATCACTTGGTTTGGCTGCGCAGACTGCAGTATCTAAGGGTCATGC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.35 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.5250000000000004 0.0 0.0 0.0 0.0 126-127 3.9250000000000003 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.8875 0.0 0.0 0.0 0.0 132-133 5.4 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 6.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra Read 817454 spots for SRR12919382.sra Written 817454 spots for SRR12919382.sra Read 817453 spots for SRR12919382.sra Written 817453 spots for SRR12919382.sra SRR ids: ['SRR12919382.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k2caohpq SRR12919382.sra spots: 16349061 blocks: [[1, 817453], [817454, 1634906], [1634907, 2452359], [2452360, 3269812], [3269813, 4087265], [4087266, 4904718], [4904719, 5722171], [5722172, 6539624], [6539625, 7357077], [7357078, 8174530], [8174531, 8991983], [8991984, 9809436], [9809437, 10626889], [10626890, 11444342], [11444343, 12261795], [12261796, 13079248], [13079249, 13896701], [13896702, 14714154], [14714155, 15531607], [15531608, 16349061]] SRR12919382 file size 5534425 SRR12919382 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919382 SRR12919382_1.fastq SRR12919382_2.fastq Input file: SRR12919382_1.fastq Paired file: SRR12919382_2.fastq trimmed: SRR12919382-trimmed-pair1.fastq, SRR12919382-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:01:38 2025 >> started Wed Feb 12 22:01:57 2025 >> done (18.663s) 16349061 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 1845 ( 0.01%) empty read pairs filtered out after trimming by size control 16347192 (99.99%) read pairs available; of these: 1869482 (11.44%) trimmed read pairs available after processing 14477710 (88.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 1 0.00% 21 4 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 3 0.00% 26 2 0.00% 27 3 0.00% 28 7 0.00% 29 2 0.00% 30 10 0.00% 31 6 0.00% 32 8 0.00% 33 9 0.00% 34 10 0.00% 35 14 0.00% 36 6 0.00% 37 16 0.00% 38 17 0.00% 39 18 0.00% 40 29 0.00% 41 21 0.00% 42 28 0.00% 43 20 0.00% 44 18 0.00% 45 26 0.00% 46 23 0.00% 47 28 0.00% 48 32 0.00% 49 51 0.00% 50 57 0.00% 51 55 0.00% 52 62 0.00% 53 76 0.00% 54 54 0.00% 55 94 0.00% 56 111 0.00% 57 124 0.00% 58 173 0.00% 59 180 0.00% 60 183 0.00% 61 205 0.00% 62 261 0.00% 63 290 0.00% 64 332 0.00% 65 377 0.00% 66 421 0.00% 67 432 0.00% 68 499 0.00% 69 623 0.00% 70 703 0.00% 71 826 0.01% 72 1021 0.01% 73 1125 0.01% 74 1241 0.01% 75 1357 0.01% 76 1484 0.01% 77 1665 0.01% 78 1914 0.01% 79 2173 0.01% 80 2425 0.01% 81 2882 0.02% 82 3284 0.02% 83 3567 0.02% 84 4166 0.03% 85 4352 0.03% 86 4858 0.03% 87 5109 0.03% 88 5676 0.03% 89 6020 0.04% 90 6618 0.04% 91 7348 0.04% 92 8087 0.05% 93 8761 0.05% 94 9694 0.06% 95 10386 0.06% 96 10940 0.07% 97 11329 0.07% 98 12028 0.07% 99 12866 0.08% 100 13436 0.08% 101 14126 0.09% 102 15101 0.09% 103 16062 0.10% 104 16925 0.10% 105 17872 0.11% 106 18776 0.11% 107 19217 0.12% 108 19680 0.12% 109 20624 0.13% 110 20994 0.13% 111 22200 0.14% 112 22838 0.14% 113 24018 0.15% 114 25409 0.16% 115 26098 0.16% 116 26941 0.16% 117 27960 0.17% 118 28481 0.17% 119 29006 0.18% 120 29677 0.18% 121 30170 0.18% 122 31000 0.19% 123 32251 0.20% 124 33673 0.21% 125 33738 0.21% 126 35573 0.22% 127 36023 0.22% 128 36153 0.22% 129 37077 0.23% 130 37687 0.23% 131 38079 0.23% 132 38857 0.24% 133 39631 0.24% 134 40779 0.25% 135 41602 0.25% 136 42679 0.26% 137 43401 0.27% 138 44010 0.27% 139 44945 0.27% 140 45429 0.28% 141 45914 0.28% 142 46285 0.28% 143 46912 0.29% 144 48397 0.30% 145 48489 0.30% 146 49693 0.30% 147 50693 0.31% 148 51692 0.32% 149 51558 0.32% 150 52713 0.32% 151 14477710 88.56% 16347192 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.34 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=22 fanout-score=23.51 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.0 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=2.0 sequence=AACCGCACCCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=16.28 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.3 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12919382 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:02:38 Started mapping on | Feb 12 22:02:38 Finished on | Feb 12 22:04:26 Mapping speed, Million of reads per hour | 544.91 Number of input reads | 16347192 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15282822 Uniquely mapped reads % | 93.49% Average mapped length | 294.98 Number of splices: Total | 14884202 Number of splices: Annotated (sjdb) | 14533266 Number of splices: GT/AG | 14563766 Number of splices: GC/AG | 253106 Number of splices: AT/AC | 12617 Number of splices: Non-canonical | 54713 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403321 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 28917 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.73% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 661049 661049 661049 N_multimapping 403321 403321 403321 N_noFeature 597165 15058616 692742 N_ambiguous 223517 1150 94106 UnstrandedReadsAssigned:14462140 PositiveStrandReadsAssigned:223056 NegativeStrandReadsAssigned:14495974 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919382 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919382-trimmed-pair1.fastq SRR12919382-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,347,192 reads, 14,533,867 reads pseudoaligned [quant] estimated average fragment length: 253.705 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR12919382.ke.tsv 34699 SRR12919382.se.tsv 87100 total ==> SRR12919382.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.29 796 29.3151 Potri.005G024800.1.v4.1 1035 782.295 232 19.2803 Potri.004G059700.1.v4.1 961 708.422 69 6.33217 Potri.007G009000.2.v4.1 1416 1163.29 0 0 Potri.003G141000.2.v4.1 2943 2690.29 588 14.2093 Potri.016G087400.1.v4.1 270 85.3167 954 726.958 Potri.015G069301.1.v4.1 564 324.512 0 0 Potri.010G195200.1.v4.1 1773 1520.29 119 5.08879 Potri.012G127500.1.v4.1 977 724.375 582 52.2342 ==> SRR12919382.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 123 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 28 SRR12919382 completed mapping pipeline successfully