Starting /dee2/code/volunteer_pipeline.sh SRR12919383 current disk space = 3050470739968 free memory = 1578757384 SRR12919383 SRAfilesize cadfd3dc3afb29d7e026338b0ee9b671 SRR12919383.sra SRR12919383.sra file validated SRR12919383 is paired end SRR12919383 is conventional basespace SRR12919383 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919383_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.567 37.0 37.0 37.0 37.0 37.0 2 36.2535 37.0 37.0 37.0 37.0 37.0 3 36.565 37.0 37.0 37.0 37.0 37.0 4 36.6875 37.0 37.0 37.0 37.0 37.0 5 36.7005 37.0 37.0 37.0 37.0 37.0 6 36.697 37.0 37.0 37.0 37.0 37.0 7 36.6445 37.0 37.0 37.0 37.0 37.0 8 36.6685 37.0 37.0 37.0 37.0 37.0 9 36.6865 37.0 37.0 37.0 37.0 37.0 10-14 36.6662 37.0 37.0 37.0 37.0 37.0 15-19 36.636300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.668600000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.586 37.0 37.0 37.0 37.0 37.0 30-34 36.5551 37.0 37.0 37.0 37.0 37.0 35-39 36.5236 37.0 37.0 37.0 37.0 37.0 40-44 36.521100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4792 37.0 37.0 37.0 37.0 37.0 50-54 36.4986 37.0 37.0 37.0 37.0 37.0 55-59 36.452099999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.380399999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3769 37.0 37.0 37.0 37.0 37.0 70-74 36.3278 37.0 37.0 37.0 37.0 37.0 75-79 36.327999999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3283 37.0 37.0 37.0 37.0 37.0 85-89 36.2576 37.0 37.0 37.0 37.0 37.0 90-94 36.27419999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.242200000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.22709999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1648 37.0 37.0 37.0 37.0 37.0 110-114 36.1091 37.0 37.0 37.0 37.0 37.0 115-119 36.1048 37.0 37.0 37.0 37.0 37.0 120-124 36.075 37.0 37.0 37.0 37.0 37.0 125-129 35.992200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.965500000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.8727 37.0 37.0 37.0 37.0 37.0 140-144 35.7978 37.0 37.0 37.0 37.0 37.0 145-149 35.7201 37.0 37.0 37.0 37.0 37.0 150-151 35.5275 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 2.0 25 3.0 26 8.0 27 10.0 28 13.0 29 16.0 30 13.0 31 17.0 32 47.0 33 58.0 34 115.0 35 323.0 36 2969.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.375 11.799999999999999 5.75 40.075 2 18.204740292486132 12.556732223903177 37.49369641956631 31.744831064044376 3 16.425 16.825000000000003 29.849999999999998 36.9 4 22.075 24.474999999999998 24.4 29.049999999999997 5 21.6 29.95 26.150000000000002 22.3 6 21.575 33.6 23.25 21.575 7 15.299999999999999 26.474999999999998 40.949999999999996 17.275 8 16.55 26.200000000000003 33.7 23.549999999999997 9 17.275 23.075000000000003 35.575 24.075 10-14 19.31 29.959999999999997 27.61 23.119999999999997 15-19 19.64 28.605000000000004 27.985 23.77 20-24 20.07 27.589999999999996 28.04 24.3 25-29 19.939999999999998 28.665000000000003 28.050000000000004 23.345 30-34 19.285 28.560000000000002 28.1 24.055 35-39 19.875 28.24 27.994999999999997 23.89 40-44 20.025000000000002 28.365000000000002 27.875 23.735 45-49 19.855 28.305000000000003 27.92 23.919999999999998 50-54 19.525000000000002 28.57 28.275 23.630000000000003 55-59 19.825 28.24 27.83 24.104999999999997 60-64 19.900000000000002 28.68 28.115000000000002 23.305 65-69 19.765 28.215 28.27 23.75 70-74 19.97 28.155 27.74 24.135 75-79 20.395 27.35 28.235 24.02 80-84 20.599999999999998 28.185 27.92 23.294999999999998 85-89 20.0 27.939999999999998 28.02 24.04 90-94 20.405 27.985 28.144999999999996 23.465 95-99 19.975 28.375 27.955000000000002 23.695 100-104 19.895 27.884999999999998 27.779999999999998 24.44 105-109 20.36 28.595 27.72 23.325000000000003 110-114 20.335 27.474999999999998 28.225 23.965 115-119 21.015 27.884999999999998 27.615000000000002 23.485 120-124 20.36 28.435 27.715 23.49 125-129 20.14 28.544999999999998 28.09 23.225 130-134 20.535 28.685 27.375 23.405 135-139 20.945 28.71 26.775 23.57 140-144 20.835 28.439999999999998 26.790000000000003 23.935000000000002 145-149 21.3 28.65 26.295 23.755000000000003 150-151 21.25 27.575 26.187500000000004 24.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 5.0 27 9.0 28 11.5 29 14.5 30 24.0 31 27.5 32 24.5 33 29.5 34 44.5 35 78.5 36 99.5 37 112.5 38 137.0 39 161.0 40 178.5 41 202.5 42 235.5 43 265.5 44 268.5 45 274.0 46 264.0 47 238.0 48 224.0 49 217.0 50 199.0 51 153.0 52 116.0 53 97.0 54 80.0 55 52.0 56 38.5 57 29.0 58 22.0 59 19.0 60 13.0 61 9.5 62 6.5 63 2.5 64 2.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8500000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 90.95685840707965 82.22500000000001 2 7.660398230088496 13.850000000000001 3 1.1891592920353982 3.225 4 0.19358407079646017 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.9249999999999998 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.862500000000001 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCTT 10 0.006830828 145.0 8 GAAGTGA 10 0.006830828 145.0 9 GAATCCT 10 0.006830828 145.0 7 >>END_MODULE SRR12919383 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919383_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4025 37.0 37.0 37.0 37.0 37.0 2 36.2335 37.0 37.0 37.0 37.0 37.0 3 36.257 37.0 37.0 37.0 37.0 37.0 4 36.281 37.0 37.0 37.0 37.0 37.0 5 36.2795 37.0 37.0 37.0 37.0 37.0 6 36.3365 37.0 37.0 37.0 37.0 37.0 7 36.324 37.0 37.0 37.0 37.0 37.0 8 36.4015 37.0 37.0 37.0 37.0 37.0 9 36.45 37.0 37.0 37.0 37.0 37.0 10-14 36.3935 37.0 37.0 37.0 37.0 37.0 15-19 36.31229999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.3173 37.0 37.0 37.0 37.0 37.0 25-29 36.297700000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.2205 37.0 37.0 37.0 37.0 37.0 35-39 36.2099 37.0 37.0 37.0 37.0 37.0 40-44 36.1869 37.0 37.0 37.0 37.0 37.0 45-49 36.2357 37.0 37.0 37.0 37.0 37.0 50-54 36.147800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1148 37.0 37.0 37.0 37.0 37.0 60-64 36.0635 37.0 37.0 37.0 37.0 37.0 65-69 36.108999999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.0366 37.0 37.0 37.0 37.0 37.0 75-79 36.048500000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.99419999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.9665 37.0 37.0 37.0 37.0 37.0 90-94 36.018 37.0 37.0 37.0 37.0 37.0 95-99 35.943200000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.92059999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.9012 37.0 37.0 37.0 37.0 37.0 110-114 35.9114 37.0 37.0 37.0 37.0 37.0 115-119 35.839800000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.75769999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.7786 37.0 37.0 37.0 37.0 37.0 130-134 35.6539 37.0 37.0 37.0 37.0 37.0 135-139 35.5377 37.0 37.0 37.0 37.0 37.0 140-144 35.4971 37.0 37.0 37.0 37.0 37.0 145-149 35.3873 37.0 37.0 37.0 37.0 37.0 150-151 35.301500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 6.0 15 0.0 16 1.0 17 3.0 18 3.0 19 0.0 20 2.0 21 2.0 22 4.0 23 5.0 24 2.0 25 6.0 26 8.0 27 12.0 28 12.0 29 10.0 30 18.0 31 30.0 32 49.0 33 79.0 34 180.0 35 483.0 36 2759.0 37 323.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.675000000000004 23.75 8.725 25.85 2 27.175 26.5 31.225 15.1 3 20.175 26.375 33.6 19.85 4 23.1 34.675 23.425 18.8 5 25.3 35.675000000000004 22.675 16.35 6 19.025 39.35 23.674999999999997 17.95 7 20.275000000000002 22.6 37.0 20.125 8 20.200000000000003 25.95 29.299999999999997 24.55 9 21.4 24.0 30.275000000000002 24.325 10-14 23.145 29.43 26.135 21.29 15-19 23.335 28.225 27.560000000000002 20.880000000000003 20-24 23.880000000000003 28.970000000000002 26.63 20.52 25-29 23.075000000000003 27.235 28.77 20.919999999999998 30-34 23.445 27.779999999999998 27.785 20.990000000000002 35-39 23.18 28.24 27.77 20.810000000000002 40-44 23.11 28.449999999999996 27.925 20.515 45-49 23.275000000000002 28.64 27.900000000000002 20.185 50-54 22.595000000000002 28.22 27.965 21.22 55-59 23.69 27.939999999999998 27.595 20.775 60-64 23.155 28.18 28.155 20.51 65-69 23.965 27.72 27.72 20.595 70-74 23.23 28.15 27.74 20.880000000000003 75-79 22.295 28.405 27.860000000000003 21.44 80-84 23.665 28.144999999999996 27.325 20.865000000000002 85-89 23.799999999999997 27.525 28.04 20.635 90-94 23.330000000000002 28.49 26.97 21.21 95-99 22.884999999999998 28.355000000000004 28.09 20.669999999999998 100-104 23.685000000000002 27.785 27.860000000000003 20.669999999999998 105-109 23.93 27.625 27.900000000000002 20.544999999999998 110-114 24.205 27.889999999999997 27.525 20.380000000000003 115-119 23.905 28.675 27.389999999999997 20.03 120-124 23.765 27.810000000000002 27.605 20.82 125-129 23.86 27.865000000000002 27.52 20.755000000000003 130-134 24.23 28.384999999999998 26.985 20.4 135-139 24.62 28.64 26.245 20.495 140-144 24.91 28.285 26.56 20.244999999999997 145-149 25.374999999999996 28.475 26.674999999999997 19.475 150-151 26.437500000000004 27.8625 26.174999999999997 19.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 2.0 23 2.5 24 4.0 25 4.0 26 4.0 27 5.5 28 9.5 29 14.0 30 15.5 31 24.0 32 33.0 33 38.0 34 50.0 35 63.5 36 80.5 37 96.0 38 127.0 39 170.0 40 198.5 41 234.0 42 261.5 43 256.5 44 277.5 45 280.5 46 262.5 47 256.0 48 223.5 49 201.0 50 174.5 51 134.0 52 92.5 53 76.5 54 77.0 55 57.0 56 45.5 57 36.0 58 25.5 59 22.0 60 14.0 61 9.5 62 7.5 63 4.5 64 2.0 65 1.5 66 0.5 67 1.0 68 2.5 69 2.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.35 #Duplication Level Percentage of deduplicated Percentage of total 1 90.97952407304926 82.19999999999999 2 7.6923076923076925 13.900000000000002 3 1.0514665190924184 2.85 4 0.24903154399557276 0.8999999999999999 5 0.0 0.0 6 0.02767017155506364 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.025 0.0 110-111 1.625 0.0 0.0 0.025 0.0 112-113 1.75 0.0 0.0 0.025 0.0 114-115 1.9625000000000001 0.0 0.0 0.025 0.0 116-117 2.2125 0.0 0.0 0.025 0.0 118-119 2.575 0.0 0.0 0.025 0.0 120-121 2.85 0.0 0.0 0.025 0.0 122-123 3.0875 0.0 0.0 0.025 0.0 124-125 3.425 0.0 0.0 0.025 0.0 126-127 3.625 0.0 0.0 0.025 0.0 128-129 3.9375 0.0 0.0 0.025 0.0 130-131 4.4 0.0 0.0 0.025 0.0 132-133 4.9625 0.0 0.0 0.025 0.0 134-135 5.35 0.0 0.0 0.025 0.0 136-137 6.0125 0.0 0.0 0.025 0.0 138-139 6.737500000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937687 spots for SRR12919383.sra Written 937687 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra Read 937682 spots for SRR12919383.sra Written 937682 spots for SRR12919383.sra SRR ids: ['SRR12919383.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uxsor78n SRR12919383.sra spots: 18753645 blocks: [[1, 937682], [937683, 1875364], [1875365, 2813046], [2813047, 3750728], [3750729, 4688410], [4688411, 5626092], [5626093, 6563774], [6563775, 7501456], [7501457, 8439138], [8439139, 9376820], [9376821, 10314502], [10314503, 11252184], [11252185, 12189866], [12189867, 13127548], [13127549, 14065230], [14065231, 15002912], [15002913, 15940594], [15940595, 16878276], [16878277, 17815958], [17815959, 18753645]] SRR12919383 file size 6351608 SRR12919383 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919383 SRR12919383_1.fastq SRR12919383_2.fastq Input file: SRR12919383_1.fastq Paired file: SRR12919383_2.fastq trimmed: SRR12919383-trimmed-pair1.fastq, SRR12919383-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:33:53 2025 >> started Wed Feb 12 22:34:14 2025 >> done (20.952s) 18753645 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 138 ( 0.00%) empty read pairs filtered out after trimming by size control 18753482 (100.00%) read pairs available; of these: 2213949 (11.81%) trimmed read pairs available after processing 16539533 (88.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 0 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 7 0.00% 25 8 0.00% 26 6 0.00% 27 5 0.00% 28 8 0.00% 29 4 0.00% 30 10 0.00% 31 10 0.00% 32 7 0.00% 33 17 0.00% 34 8 0.00% 35 7 0.00% 36 12 0.00% 37 20 0.00% 38 18 0.00% 39 8 0.00% 40 13 0.00% 41 25 0.00% 42 20 0.00% 43 23 0.00% 44 31 0.00% 45 39 0.00% 46 24 0.00% 47 38 0.00% 48 41 0.00% 49 58 0.00% 50 49 0.00% 51 80 0.00% 52 77 0.00% 53 66 0.00% 54 86 0.00% 55 97 0.00% 56 116 0.00% 57 126 0.00% 58 129 0.00% 59 197 0.00% 60 202 0.00% 61 264 0.00% 62 292 0.00% 63 377 0.00% 64 368 0.00% 65 448 0.00% 66 488 0.00% 67 538 0.00% 68 579 0.00% 69 712 0.00% 70 870 0.00% 71 1034 0.01% 72 1171 0.01% 73 1362 0.01% 74 1510 0.01% 75 1752 0.01% 76 1964 0.01% 77 2048 0.01% 78 2337 0.01% 79 2660 0.01% 80 3139 0.02% 81 3486 0.02% 82 3977 0.02% 83 4397 0.02% 84 5057 0.03% 85 5421 0.03% 86 5920 0.03% 87 6382 0.03% 88 6827 0.04% 89 7382 0.04% 90 8156 0.04% 91 9065 0.05% 92 9667 0.05% 93 10684 0.06% 94 11836 0.06% 95 12711 0.07% 96 13472 0.07% 97 14068 0.08% 98 14191 0.08% 99 15013 0.08% 100 16084 0.09% 101 16815 0.09% 102 17987 0.10% 103 19121 0.10% 104 20454 0.11% 105 21307 0.11% 106 22513 0.12% 107 22635 0.12% 108 23670 0.13% 109 24286 0.13% 110 24845 0.13% 111 26174 0.14% 112 26941 0.14% 113 28345 0.15% 114 29862 0.16% 115 31069 0.17% 116 31528 0.17% 117 33130 0.18% 118 33750 0.18% 119 34145 0.18% 120 34895 0.19% 121 35833 0.19% 122 36713 0.20% 123 38008 0.20% 124 39529 0.21% 125 40518 0.22% 126 41550 0.22% 127 42608 0.23% 128 42552 0.23% 129 43749 0.23% 130 44393 0.24% 131 44369 0.24% 132 45985 0.25% 133 47450 0.25% 134 48248 0.26% 135 49241 0.26% 136 50290 0.27% 137 51288 0.27% 138 51857 0.28% 139 52751 0.28% 140 52977 0.28% 141 53985 0.29% 142 54960 0.29% 143 55794 0.30% 144 56942 0.30% 145 57628 0.31% 146 58721 0.31% 147 59666 0.32% 148 61032 0.33% 149 60972 0.33% 150 61451 0.33% 151 16539533 88.19% 18753482 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=27 prefix-density=0.28 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=460.45 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.42 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.15 sequence-density-rank=22 fanout-score=17.79 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=7.9 sequence=AAGAAAGCTTACCCTAAC SRR12919383 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:34:58 Started mapping on | Feb 12 22:34:58 Finished on | Feb 12 22:37:17 Mapping speed, Million of reads per hour | 485.70 Number of input reads | 18753482 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17468574 Uniquely mapped reads % | 93.15% Average mapped length | 294.89 Number of splices: Total | 17356655 Number of splices: Annotated (sjdb) | 16961268 Number of splices: GT/AG | 17006187 Number of splices: GC/AG | 274370 Number of splices: AT/AC | 13921 Number of splices: Non-canonical | 62177 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 448726 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 49653 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 836182 836182 836182 N_multimapping 448726 448726 448726 N_noFeature 661230 17210837 767832 N_ambiguous 255582 1268 103618 UnstrandedReadsAssigned:16551762 PositiveStrandReadsAssigned:256469 NegativeStrandReadsAssigned:16597124 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919383 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919383-trimmed-pair1.fastq SRR12919383-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,753,482 reads, 16,651,525 reads pseudoaligned [quant] estimated average fragment length: 253.562 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR12919383.ke.tsv 34699 SRR12919383.se.tsv 87100 total ==> SRR12919383.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.44 793 26.0522 Potri.005G024800.1.v4.1 1035 782.438 505 37.4339 Potri.004G059700.1.v4.1 961 708.577 2 0.163707 Potri.007G009000.2.v4.1 1416 1163.44 0 0 Potri.003G141000.2.v4.1 2943 2690.44 731.515 15.7697 Potri.016G087400.1.v4.1 270 86.1772 887 596.973 Potri.015G069301.1.v4.1 564 324.677 0 0 Potri.010G195200.1.v4.1 1773 1520.44 423 16.136 Potri.012G127500.1.v4.1 977 724.53 605 48.4309 ==> SRR12919383.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12919383 completed mapping pipeline successfully