Starting /dee2/code/volunteer_pipeline.sh SRR12919384 current disk space = 3050493730816 free memory = 1581612672 SRR12919384 SRAfilesize ce4cc558612be07f5aab6c3700891499 SRR12919384.sra SRR12919384.sra file validated SRR12919384 is paired end SRR12919384 is conventional basespace SRR12919384 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919384_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.557 37.0 37.0 37.0 37.0 37.0 2 36.2315 37.0 37.0 37.0 37.0 37.0 3 36.5605 37.0 37.0 37.0 37.0 37.0 4 36.625 37.0 37.0 37.0 37.0 37.0 5 36.6075 37.0 37.0 37.0 37.0 37.0 6 36.6095 37.0 37.0 37.0 37.0 37.0 7 36.5355 37.0 37.0 37.0 37.0 37.0 8 36.5895 37.0 37.0 37.0 37.0 37.0 9 36.6455 37.0 37.0 37.0 37.0 37.0 10-14 36.6171 37.0 37.0 37.0 37.0 37.0 15-19 36.6059 37.0 37.0 37.0 37.0 37.0 20-24 36.572300000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.580799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5075 37.0 37.0 37.0 37.0 37.0 35-39 36.4783 37.0 37.0 37.0 37.0 37.0 40-44 36.4741 37.0 37.0 37.0 37.0 37.0 45-49 36.4798 37.0 37.0 37.0 37.0 37.0 50-54 36.465700000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.4185 37.0 37.0 37.0 37.0 37.0 60-64 36.3784 37.0 37.0 37.0 37.0 37.0 65-69 36.3749 37.0 37.0 37.0 37.0 37.0 70-74 36.315999999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.2901 37.0 37.0 37.0 37.0 37.0 80-84 36.323800000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.2171 37.0 37.0 37.0 37.0 37.0 90-94 36.237899999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2359 37.0 37.0 37.0 37.0 37.0 100-104 36.200900000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1003 37.0 37.0 37.0 37.0 37.0 110-114 36.1164 37.0 37.0 37.0 37.0 37.0 115-119 36.085300000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0706 37.0 37.0 37.0 37.0 37.0 125-129 35.9889 37.0 37.0 37.0 37.0 37.0 130-134 35.936699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.842200000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7582 37.0 37.0 37.0 37.0 37.0 145-149 35.736000000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.585499999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 1.0 26 8.0 27 6.0 28 9.0 29 13.0 30 23.0 31 34.0 32 50.0 33 72.0 34 103.0 35 331.0 36 2962.0 37 384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.9 12.825000000000001 5.6000000000000005 39.675 2 19.008056394763344 13.36858006042296 35.54884189325277 32.07452165156093 3 17.724999999999998 17.150000000000002 28.050000000000004 37.075 4 22.05 25.7 24.45 27.800000000000004 5 21.7 30.625000000000004 26.0 21.675 6 20.275000000000002 35.025 24.55 20.150000000000002 7 16.05 25.724999999999998 40.300000000000004 17.925 8 16.7 26.775 31.35 25.174999999999997 9 16.900000000000002 24.55 33.675 24.875 10-14 19.265 29.675 27.685 23.375 15-19 19.62 28.18 28.29 23.91 20-24 19.564999999999998 28.360000000000003 28.555000000000003 23.52 25-29 19.265 28.23 28.355000000000004 24.15 30-34 19.715 29.439999999999998 27.215 23.630000000000003 35-39 19.82 29.125 27.639999999999997 23.415 40-44 20.044999999999998 28.98 27.58 23.395 45-49 19.585 28.57 27.48 24.365000000000002 50-54 20.205000000000002 28.525 27.634999999999998 23.635 55-59 19.585 28.825 27.52 24.07 60-64 20.32 28.660000000000004 27.47 23.549999999999997 65-69 20.16 28.175 27.595 24.07 70-74 19.735 28.71 27.74 23.815 75-79 20.255000000000003 28.625 27.250000000000004 23.87 80-84 19.91 29.735 27.084999999999997 23.27 85-89 20.150000000000002 29.054999999999996 27.115000000000002 23.68 90-94 20.549999999999997 27.925 27.21 24.315 95-99 20.150000000000002 28.64 27.57 23.64 100-104 20.57 28.475 27.310000000000002 23.645 105-109 20.51 28.89 27.21 23.39 110-114 20.919999999999998 29.04 26.834999999999997 23.205000000000002 115-119 19.82 28.23 27.689999999999998 24.26 120-124 20.745 28.16 27.439999999999998 23.655 125-129 20.465 28.235 27.83 23.47 130-134 21.125 28.43 26.950000000000003 23.494999999999997 135-139 21.34 27.644999999999996 27.63 23.385 140-144 20.48 28.645 26.715 24.16 145-149 21.05 28.68 26.685 23.585 150-151 21.8125 28.525 26.637499999999996 23.025000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 1.0 23 3.0 24 3.0 25 3.5 26 3.5 27 4.5 28 10.0 29 15.0 30 18.0 31 23.0 32 29.5 33 44.0 34 55.5 35 68.0 36 85.0 37 95.0 38 127.0 39 164.0 40 184.5 41 218.5 42 252.0 43 248.0 44 252.5 45 279.5 46 289.0 47 261.5 48 222.5 49 199.5 50 175.5 51 158.5 52 133.0 53 96.0 54 73.0 55 55.0 56 39.0 57 28.0 58 18.5 59 13.5 60 10.5 61 9.0 62 7.5 63 5.5 64 4.0 65 1.5 66 2.0 67 2.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 91.94119248570651 84.425 2 7.242036482439423 13.3 3 0.7895453307922679 2.175 4 0.027225701061802342 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8625 0.0125 0.0 0.0 0.0 100-101 1.0125 0.025 0.0 0.0 0.0 102-103 1.0625 0.025 0.0 0.0 0.0 104-105 1.3125 0.025 0.0 0.0 0.0 106-107 1.5 0.025 0.0 0.0 0.0 108-109 1.65 0.025 0.0 0.0 0.0 110-111 2.0 0.025 0.0 0.0 0.0 112-113 2.2625 0.025 0.0 0.0 0.0 114-115 2.5625 0.025 0.0 0.0 0.0 116-117 2.7874999999999996 0.025 0.0 0.0 0.0 118-119 3.0125 0.025 0.0 0.0 0.0 120-121 3.3625 0.025 0.0 0.0 0.0 122-123 3.625 0.025 0.0 0.0 0.0 124-125 3.9 0.025 0.0 0.0 0.0 126-127 4.375 0.025 0.0 0.0 0.0 128-129 4.775 0.025 0.0 0.0 0.0 130-131 5.3125 0.025 0.0 0.0 0.0 132-133 5.7875 0.025 0.0 0.0 0.0 134-135 6.2375 0.025 0.0 0.0 0.0 136-137 6.6875 0.025 0.0 0.0 0.0 138-139 7.1 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCGGC 10 0.006830828 145.0 8 >>END_MODULE SRR12919384 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919384_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.152 37.0 37.0 37.0 37.0 37.0 2 36.008 37.0 37.0 37.0 37.0 37.0 3 35.9635 37.0 37.0 37.0 37.0 37.0 4 36.1525 37.0 37.0 37.0 37.0 37.0 5 36.285 37.0 37.0 37.0 37.0 37.0 6 36.204 37.0 37.0 37.0 37.0 37.0 7 36.071 37.0 37.0 37.0 37.0 37.0 8 36.2275 37.0 37.0 37.0 37.0 37.0 9 36.2345 37.0 37.0 37.0 37.0 37.0 10-14 36.190200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1672 37.0 37.0 37.0 37.0 37.0 20-24 36.1849 37.0 37.0 37.0 37.0 37.0 25-29 36.0971 37.0 37.0 37.0 37.0 37.0 30-34 36.1042 37.0 37.0 37.0 37.0 37.0 35-39 36.0649 37.0 37.0 37.0 37.0 37.0 40-44 36.032399999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0215 37.0 37.0 37.0 37.0 37.0 50-54 35.99499999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.932599999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9336 37.0 37.0 37.0 37.0 37.0 65-69 35.9156 37.0 37.0 37.0 37.0 37.0 70-74 35.8696 37.0 37.0 37.0 37.0 37.0 75-79 35.8553 37.0 37.0 37.0 37.0 37.0 80-84 35.7663 37.0 37.0 37.0 37.0 37.0 85-89 35.808 37.0 37.0 37.0 37.0 37.0 90-94 35.7332 37.0 37.0 37.0 37.0 37.0 95-99 35.6711 37.0 37.0 37.0 37.0 37.0 100-104 35.705 37.0 37.0 37.0 37.0 37.0 105-109 35.6269 37.0 37.0 37.0 37.0 37.0 110-114 35.6879 37.0 37.0 37.0 37.0 37.0 115-119 35.548500000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.4963 37.0 37.0 37.0 37.0 37.0 125-129 35.4744 37.0 37.0 37.0 37.0 37.0 130-134 35.3368 37.0 37.0 37.0 34.6 37.0 135-139 35.2255 37.0 37.0 37.0 32.2 37.0 140-144 35.169 37.0 37.0 37.0 29.8 37.0 145-149 35.0694 37.0 37.0 37.0 27.4 37.0 150-151 34.89775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 2.0 15 2.0 16 0.0 17 0.0 18 1.0 19 3.0 20 1.0 21 3.0 22 3.0 23 6.0 24 5.0 25 8.0 26 4.0 27 14.0 28 19.0 29 18.0 30 28.0 31 49.0 32 71.0 33 129.0 34 240.0 35 608.0 36 2549.0 37 231.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.025 24.2 9.325 25.45 2 27.125 25.8 31.2 15.875 3 19.400000000000002 27.875 33.074999999999996 19.650000000000002 4 22.325 35.575 23.474999999999998 18.625 5 24.075 38.125 21.925 15.875 6 20.1 39.65 22.375 17.875 7 20.25 24.25 36.575 18.925 8 21.7 26.224999999999998 27.224999999999998 24.85 9 21.575 25.074999999999996 31.45 21.9 10-14 22.96 29.955 26.314999999999998 20.77 15-19 23.36 28.46 27.62 20.560000000000002 20-24 23.255 28.689999999999998 27.0 21.055 25-29 23.26 28.139999999999997 27.845 20.755000000000003 30-34 22.93 28.199999999999996 28.115000000000002 20.755000000000003 35-39 23.085 28.075 28.055000000000003 20.785 40-44 22.585 28.48 27.905 21.029999999999998 45-49 22.945 27.915 28.27 20.87 50-54 22.41 27.92 28.27 21.4 55-59 23.465 28.02 27.584999999999997 20.93 60-64 23.474999999999998 28.075 27.589999999999996 20.86 65-69 22.900000000000002 27.900000000000002 28.299999999999997 20.9 70-74 23.974999999999998 28.22 27.134999999999998 20.669999999999998 75-79 23.03 27.98 27.939999999999998 21.05 80-84 23.355 28.335 27.925 20.385 85-89 23.21 27.455000000000002 28.67 20.665 90-94 23.735 27.27 28.494999999999997 20.5 95-99 24.145 27.715 28.22 19.919999999999998 100-104 23.625 27.87 27.735 20.77 105-109 23.805 27.66 28.065 20.47 110-114 24.085 27.305 28.000000000000004 20.61 115-119 23.56 28.365000000000002 27.785 20.29 120-124 24.23 27.77 27.650000000000002 20.349999999999998 125-129 24.285 27.87 27.505000000000003 20.34 130-134 24.145 27.794999999999998 27.255000000000003 20.805 135-139 25.385 27.66 26.855 20.1 140-144 25.11 27.96 27.229999999999997 19.7 145-149 25.679999999999996 28.08 26.740000000000002 19.5 150-151 26.187500000000004 26.487500000000004 27.075 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 2.0 17 1.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 2.0 24 5.5 25 6.0 26 5.0 27 6.0 28 8.0 29 14.5 30 17.0 31 23.0 32 29.0 33 41.5 34 49.0 35 58.5 36 81.0 37 104.0 38 138.5 39 175.0 40 201.0 41 226.5 42 265.5 43 281.0 44 267.5 45 264.5 46 267.0 47 255.0 48 226.0 49 195.0 50 168.0 51 136.5 52 103.5 53 88.5 54 73.5 55 49.0 56 38.5 57 29.0 58 20.0 59 15.0 60 11.0 61 9.0 62 9.0 63 7.0 64 4.5 65 2.5 66 0.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.31813246471226 85.02499999999999 2 6.813246471226927 12.55 3 0.8414766558089034 2.325 4 0.02714440825190011 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.0875000000000004 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 3.975 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.8875 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.8875 0.0 0.0 0.0 0.0 134-135 6.35 0.0 0.0 0.0 0.0 136-137 6.8125 0.0 0.0 0.0 0.0 138-139 7.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra Read 1016048 spots for SRR12919384.sra Written 1016048 spots for SRR12919384.sra Read 1016038 spots for SRR12919384.sra Written 1016038 spots for SRR12919384.sra SRR ids: ['SRR12919384.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uv8ckwth SRR12919384.sra spots: 20320770 blocks: [[1, 1016038], [1016039, 2032076], [2032077, 3048114], [3048115, 4064152], [4064153, 5080190], [5080191, 6096228], [6096229, 7112266], [7112267, 8128304], [8128305, 9144342], [9144343, 10160380], [10160381, 11176418], [11176419, 12192456], [12192457, 13208494], [13208495, 14224532], [14224533, 15240570], [15240571, 16256608], [16256609, 17272646], [17272647, 18288684], [18288685, 19304722], [19304723, 20320770]] SRR12919384 file size 6884186 SRR12919384 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919384 SRR12919384_1.fastq SRR12919384_2.fastq Input file: SRR12919384_1.fastq Paired file: SRR12919384_2.fastq trimmed: SRR12919384-trimmed-pair1.fastq, SRR12919384-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:33:18 2025 >> started Wed Feb 12 22:33:41 2025 >> done (22.560s) 20320770 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 615 ( 0.00%) empty read pairs filtered out after trimming by size control 20320133 (100.00%) read pairs available; of these: 2121250 (10.44%) trimmed read pairs available after processing 18198883 (89.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 10 0.00% 21 7 0.00% 22 5 0.00% 23 5 0.00% 24 8 0.00% 25 9 0.00% 26 7 0.00% 27 9 0.00% 28 9 0.00% 29 14 0.00% 30 6 0.00% 31 21 0.00% 32 11 0.00% 33 15 0.00% 34 13 0.00% 35 20 0.00% 36 11 0.00% 37 30 0.00% 38 32 0.00% 39 32 0.00% 40 24 0.00% 41 22 0.00% 42 22 0.00% 43 23 0.00% 44 39 0.00% 45 32 0.00% 46 33 0.00% 47 38 0.00% 48 52 0.00% 49 46 0.00% 50 60 0.00% 51 83 0.00% 52 99 0.00% 53 71 0.00% 54 84 0.00% 55 89 0.00% 56 101 0.00% 57 103 0.00% 58 128 0.00% 59 156 0.00% 60 199 0.00% 61 266 0.00% 62 288 0.00% 63 314 0.00% 64 333 0.00% 65 342 0.00% 66 357 0.00% 67 452 0.00% 68 457 0.00% 69 589 0.00% 70 720 0.00% 71 825 0.00% 72 899 0.00% 73 1147 0.01% 74 1269 0.01% 75 1336 0.01% 76 1478 0.01% 77 1658 0.01% 78 1773 0.01% 79 2084 0.01% 80 2426 0.01% 81 2725 0.01% 82 3208 0.02% 83 3804 0.02% 84 4246 0.02% 85 4719 0.02% 86 4928 0.02% 87 5259 0.03% 88 5727 0.03% 89 6239 0.03% 90 6954 0.03% 91 7736 0.04% 92 8384 0.04% 93 9608 0.05% 94 10202 0.05% 95 10869 0.05% 96 11718 0.06% 97 12440 0.06% 98 12902 0.06% 99 13536 0.07% 100 14546 0.07% 101 15082 0.07% 102 16507 0.08% 103 17789 0.09% 104 19063 0.09% 105 20064 0.10% 106 20909 0.10% 107 21578 0.11% 108 22251 0.11% 109 22770 0.11% 110 23593 0.12% 111 24578 0.12% 112 26024 0.13% 113 27169 0.13% 114 28415 0.14% 115 29742 0.15% 116 30496 0.15% 117 31626 0.16% 118 32322 0.16% 119 32867 0.16% 120 33412 0.16% 121 34678 0.17% 122 35135 0.17% 123 36612 0.18% 124 38250 0.19% 125 38858 0.19% 126 40526 0.20% 127 41736 0.21% 128 41926 0.21% 129 42490 0.21% 130 42936 0.21% 131 43396 0.21% 132 44302 0.22% 133 45917 0.23% 134 46667 0.23% 135 48620 0.24% 136 49335 0.24% 137 50458 0.25% 138 51028 0.25% 139 51592 0.25% 140 51564 0.25% 141 52281 0.26% 142 53484 0.26% 143 53701 0.26% 144 56509 0.28% 145 56931 0.28% 146 57644 0.28% 147 58734 0.29% 148 59691 0.29% 149 59035 0.29% 150 60408 0.30% 151 18198883 89.56% 20320133 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=10.99 fanout-score-rank=16 prefix-density=0.29 prefix-fanout=5.0 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=396.24 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=33.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=41 prefix-density=0.30 prefix-fanout=2.0 sequence=GTTCAACTAGGCATACCAGATGTGATCCAAAAACATGGCAAACCCATGACCCTCTCTGAGCTTGTTTCTGCCCTACCAATCCACCCATCAAAAGCTCAATATGTCCACCGCCTTATGCGTATTCTCGTGCACTCTGGTTTCTTTTCCCAGCAAAATCTTAATGACATTCACAACCAAGATGCCTATTCCCTTACCCAATCCACTCGTCTCCTACTCAAGGACAATCCCTGGAGTATGAGACCTCTTTTACTTGTGTTTCTCGACCCAGTTCTGACAAAACCATGGGATTGCTTGAGCACTTGGTTCCAAAATGATGATCGCAATGCATTTAGTGTTGCCCATGAAAATACATTTTGGGAGTACGCTGGCCAAGATCCAAGAATCAACAATCTCTTTAATGATGCCATGGCTAGAGATAGCATACTAGTTAGTAAGGTGGTTGTATGCAAATGTAAAGGCATCTTTGATGGGGTGAATTCTTTGGTGGATGTCGGGGGAGGCTTAGGAACTA criterion=fanout-score sequence-density=0.09 sequence-density-rank=6 fanout-score=358.07 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=33.1 sequence=AAGAAGAAGAAA SRR12919384 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:34:24 Started mapping on | Feb 12 22:34:25 Finished on | Feb 12 22:36:42 Mapping speed, Million of reads per hour | 533.96 Number of input reads | 20320133 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18668979 Uniquely mapped reads % | 91.87% Average mapped length | 295.55 Number of splices: Total | 18382837 Number of splices: Annotated (sjdb) | 18036281 Number of splices: GT/AG | 18065989 Number of splices: GC/AG | 252496 Number of splices: AT/AC | 14342 Number of splices: Non-canonical | 50010 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 653704 % of reads mapped to multiple loci | 3.22% Number of reads mapped to too many loci | 59318 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.50% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 997450 997450 997450 N_multimapping 653704 653704 653704 N_noFeature 568887 18384799 720190 N_ambiguous 241428 1352 107722 UnstrandedReadsAssigned:17858664 PositiveStrandReadsAssigned:282828 NegativeStrandReadsAssigned:17841067 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919384 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919384-trimmed-pair1.fastq SRR12919384-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,320,133 reads, 18,046,221 reads pseudoaligned [quant] estimated average fragment length: 265.621 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR12919384.ke.tsv 34699 SRR12919384.se.tsv 87100 total ==> SRR12919384.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.38 736 22.0914 Potri.005G024800.1.v4.1 1035 770.379 324 22.134 Potri.004G059700.1.v4.1 961 696.624 13 0.982122 Potri.007G009000.2.v4.1 1416 1151.38 0 0 Potri.003G141000.2.v4.1 2943 2678.38 707.475 13.9014 Potri.016G087400.1.v4.1 270 85.2823 1480.04 913.347 Potri.015G069301.1.v4.1 564 317.77 0 0 Potri.010G195200.1.v4.1 1773 1508.38 138 4.81492 Potri.012G127500.1.v4.1 977 712.49 7709 569.429 ==> SRR12919384.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 236 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 429 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12919384 completed mapping pipeline successfully