Starting /dee2/code/volunteer_pipeline.sh SRR12919385 current disk space = 3050523332608 free memory = 1571681876 SRR12919385 SRAfilesize 3e9b8ef06b922da65026a8e80d7cd70f SRR12919385.sra SRR12919385.sra file validated SRR12919385 is paired end SRR12919385 is conventional basespace SRR12919385 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919385_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5435 37.0 37.0 37.0 37.0 37.0 2 36.28075 37.0 37.0 37.0 37.0 37.0 3 36.6795 37.0 37.0 37.0 37.0 37.0 4 36.6825 37.0 37.0 37.0 37.0 37.0 5 36.667 37.0 37.0 37.0 37.0 37.0 6 36.694 37.0 37.0 37.0 37.0 37.0 7 36.658 37.0 37.0 37.0 37.0 37.0 8 36.6465 37.0 37.0 37.0 37.0 37.0 9 36.684 37.0 37.0 37.0 37.0 37.0 10-14 36.6606 37.0 37.0 37.0 37.0 37.0 15-19 36.6523 37.0 37.0 37.0 37.0 37.0 20-24 36.620400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5868 37.0 37.0 37.0 37.0 37.0 30-34 36.5221 37.0 37.0 37.0 37.0 37.0 35-39 36.5775 37.0 37.0 37.0 37.0 37.0 40-44 36.5107 37.0 37.0 37.0 37.0 37.0 45-49 36.535900000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.5064 37.0 37.0 37.0 37.0 37.0 55-59 36.5118 37.0 37.0 37.0 37.0 37.0 60-64 36.437400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.43 37.0 37.0 37.0 37.0 37.0 70-74 36.4128 37.0 37.0 37.0 37.0 37.0 75-79 36.376400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3745 37.0 37.0 37.0 37.0 37.0 85-89 36.2843 37.0 37.0 37.0 37.0 37.0 90-94 36.2525 37.0 37.0 37.0 37.0 37.0 95-99 36.2986 37.0 37.0 37.0 37.0 37.0 100-104 36.2602 37.0 37.0 37.0 37.0 37.0 105-109 36.1513 37.0 37.0 37.0 37.0 37.0 110-114 36.13629999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.11559999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0723 37.0 37.0 37.0 37.0 37.0 125-129 36.0096 37.0 37.0 37.0 37.0 37.0 130-134 35.9617 37.0 37.0 37.0 37.0 37.0 135-139 35.8976 37.0 37.0 37.0 37.0 37.0 140-144 35.8228 37.0 37.0 37.0 37.0 37.0 145-149 35.7793 37.0 37.0 37.0 37.0 37.0 150-151 35.556250000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 1.0 25 2.0 26 2.0 27 7.0 28 7.0 29 20.0 30 23.0 31 32.0 32 37.0 33 62.0 34 108.0 35 305.0 36 2951.0 37 440.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.1 11.725 8.649999999999999 43.525000000000006 2 18.984158913754086 13.653507669097309 36.86195624842846 30.50037716872014 3 15.475 18.075 28.425 38.025 4 21.5 24.5 25.8 28.199999999999996 5 22.7 30.75 24.825 21.725 6 22.025 35.425000000000004 23.575 18.975 7 15.425 26.775 40.225 17.575 8 17.025000000000002 26.400000000000002 31.724999999999998 24.85 9 16.05 24.675 35.75 23.525 10-14 19.285 29.835 27.765 23.115 15-19 19.045 27.860000000000003 28.315 24.779999999999998 20-24 19.485 28.904999999999998 27.544999999999998 24.065 25-29 19.455 28.535 27.715 24.295 30-34 19.35 27.805000000000003 28.775000000000002 24.07 35-39 20.06 28.21 27.565 24.165 40-44 19.485 29.365000000000002 27.305 23.845 45-49 20.169999999999998 28.345 28.1 23.385 50-54 19.86 28.435 27.529999999999998 24.175 55-59 19.96 28.48 27.575 23.985 60-64 20.34 28.27 27.35 24.04 65-69 20.49 28.32 27.400000000000002 23.79 70-74 20.21 28.285 28.060000000000002 23.445 75-79 20.255000000000003 28.599999999999998 27.68 23.465 80-84 20.135 28.405 27.894999999999996 23.565 85-89 19.785 28.82 27.650000000000002 23.745 90-94 19.755 28.115000000000002 28.07 24.060000000000002 95-99 20.49 28.355000000000004 27.88 23.275000000000002 100-104 20.810000000000002 28.155 27.375 23.66 105-109 20.385 27.925 28.525 23.165 110-114 20.7 28.4 27.38 23.52 115-119 20.385 27.915 27.58 24.12 120-124 20.805 28.27 27.33 23.595 125-129 21.044999999999998 27.694999999999997 27.77 23.49 130-134 20.905 28.48 26.889999999999997 23.724999999999998 135-139 21.16 28.01 27.395000000000003 23.435 140-144 21.525 27.884999999999998 26.474999999999998 24.115000000000002 145-149 21.15 27.51 27.224999999999998 24.115000000000002 150-151 21.224999999999998 28.225 26.9625 23.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 3.5 26 9.5 27 9.5 28 11.0 29 15.5 30 17.5 31 24.5 32 26.5 33 30.0 34 46.5 35 71.5 36 94.5 37 110.5 38 136.0 39 166.5 40 195.0 41 223.5 42 253.5 43 259.0 44 282.5 45 294.5 46 246.5 47 217.5 48 218.5 49 208.5 50 162.0 51 130.5 52 127.5 53 101.0 54 80.5 55 62.0 56 37.0 57 30.0 58 22.0 59 16.0 60 14.0 61 12.0 62 7.5 63 4.0 64 2.5 65 4.0 66 3.0 67 2.5 68 3.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 90.98901098901099 82.8 2 8.269230769230768 15.049999999999999 3 0.6593406593406593 1.7999999999999998 4 0.054945054945054944 0.2 5 0.0 0.0 6 0.027472527472527472 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGGAAGCTTGTAAGATGCCCTGATCTTGATTAACTTTCCTCCTGTTGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.9875 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.4 0.0 0.0 0.0 0.0 118-119 3.7125 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 6.0875 0.0 0.0 0.0 0.0 130-131 6.55 0.0 0.0 0.0 0.0 132-133 7.0625 0.0 0.0 0.0 0.0 134-135 7.512499999999999 0.0 0.0 0.0 0.0 136-137 8.075 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACACA 10 0.006830828 145.0 9 AGTTACA 10 0.006830828 145.0 6 >>END_MODULE SRR12919385 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919385_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2545 37.0 37.0 37.0 37.0 37.0 2 36.302 37.0 37.0 37.0 37.0 37.0 3 36.3445 37.0 37.0 37.0 37.0 37.0 4 36.1695 37.0 37.0 37.0 37.0 37.0 5 36.3955 37.0 37.0 37.0 37.0 37.0 6 36.3865 37.0 37.0 37.0 37.0 37.0 7 36.416 37.0 37.0 37.0 37.0 37.0 8 36.4145 37.0 37.0 37.0 37.0 37.0 9 36.383 37.0 37.0 37.0 37.0 37.0 10-14 36.3463 37.0 37.0 37.0 37.0 37.0 15-19 36.3158 37.0 37.0 37.0 37.0 37.0 20-24 36.3189 37.0 37.0 37.0 37.0 37.0 25-29 36.2822 37.0 37.0 37.0 37.0 37.0 30-34 36.2498 37.0 37.0 37.0 37.0 37.0 35-39 36.2587 37.0 37.0 37.0 37.0 37.0 40-44 36.1511 37.0 37.0 37.0 37.0 37.0 45-49 36.20140000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.1656 37.0 37.0 37.0 37.0 37.0 55-59 36.1634 37.0 37.0 37.0 37.0 37.0 60-64 36.1524 37.0 37.0 37.0 37.0 37.0 65-69 36.076600000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.0877 37.0 37.0 37.0 37.0 37.0 75-79 35.9829 37.0 37.0 37.0 37.0 37.0 80-84 36.02539999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.001 37.0 37.0 37.0 37.0 37.0 90-94 35.9594 37.0 37.0 37.0 37.0 37.0 95-99 35.968 37.0 37.0 37.0 37.0 37.0 100-104 35.9162 37.0 37.0 37.0 37.0 37.0 105-109 35.8289 37.0 37.0 37.0 37.0 37.0 110-114 35.7909 37.0 37.0 37.0 37.0 37.0 115-119 35.8085 37.0 37.0 37.0 37.0 37.0 120-124 35.7451 37.0 37.0 37.0 37.0 37.0 125-129 35.7232 37.0 37.0 37.0 37.0 37.0 130-134 35.5777 37.0 37.0 37.0 37.0 37.0 135-139 35.51129999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.4462 37.0 37.0 37.0 34.6 37.0 145-149 35.3283 37.0 37.0 37.0 34.6 37.0 150-151 35.2 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 2.0 15 3.0 16 2.0 17 1.0 18 2.0 19 1.0 20 1.0 21 0.0 22 3.0 23 8.0 24 8.0 25 2.0 26 5.0 27 11.0 28 14.0 29 10.0 30 25.0 31 42.0 32 57.0 33 77.0 34 173.0 35 508.0 36 2731.0 37 311.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.125 25.474999999999998 11.275 28.125 2 29.225 26.200000000000003 29.95 14.625 3 19.775000000000002 29.925 31.35 18.95 4 23.075000000000003 33.875 23.974999999999998 19.075 5 24.025 36.85 21.6 17.525 6 21.525 38.5 22.95 17.025000000000002 7 20.849999999999998 21.375 38.2 19.575 8 20.95 27.6 26.05 25.4 9 22.025 25.174999999999997 29.275000000000002 23.525 10-14 23.244999999999997 29.945 25.995 20.815 15-19 23.78 28.04 27.250000000000004 20.93 20-24 23.485 28.634999999999998 27.250000000000004 20.630000000000003 25-29 23.23 28.18 27.77 20.82 30-34 22.7 28.49 27.73 21.08 35-39 23.04 28.050000000000004 27.950000000000003 20.96 40-44 23.369999999999997 28.555000000000003 27.765 20.31 45-49 23.830000000000002 27.87 27.855 20.445 50-54 23.810000000000002 28.199999999999996 27.38 20.61 55-59 23.575 28.134999999999998 27.994999999999997 20.294999999999998 60-64 23.080000000000002 28.04 27.97 20.91 65-69 23.369999999999997 28.4 27.465 20.765 70-74 23.345 27.62 28.005000000000003 21.029999999999998 75-79 23.21 28.315 28.12 20.355 80-84 23.724999999999998 28.084999999999997 27.18 21.01 85-89 23.595 27.455000000000002 27.405 21.545 90-94 23.599999999999998 28.79 27.43 20.18 95-99 24.14 28.139999999999997 27.084999999999997 20.635 100-104 24.035 28.625 27.205000000000002 20.135 105-109 24.19 28.63 26.865 20.315 110-114 23.880000000000003 27.944999999999997 27.48 20.695 115-119 24.445 28.310000000000002 27.05 20.195 120-124 24.255 28.13 27.46 20.155 125-129 24.94 28.64 26.445 19.975 130-134 25.595000000000002 27.85 26.945000000000004 19.61 135-139 26.11 27.284999999999997 26.705000000000002 19.900000000000002 140-144 26.474999999999998 27.97 26.1 19.455 145-149 26.41 27.810000000000002 26.685 19.095000000000002 150-151 26.937499999999996 27.825 25.9875 19.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 1.0 24 2.0 25 3.0 26 2.5 27 3.5 28 4.0 29 8.5 30 17.5 31 21.5 32 24.0 33 33.5 34 50.0 35 62.0 36 81.5 37 115.5 38 138.5 39 169.0 40 193.0 41 216.0 42 262.5 43 281.5 44 285.0 45 289.5 46 258.5 47 228.0 48 220.5 49 207.0 50 180.0 51 148.5 52 110.0 53 80.0 54 63.0 55 50.5 56 43.5 57 28.5 58 18.5 59 15.0 60 15.0 61 13.0 62 12.0 63 11.5 64 7.0 65 3.0 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.01648351648352 82.825 2 8.214285714285714 14.95 3 0.6868131868131868 1.875 4 0.054945054945054944 0.2 5 0.0 0.0 6 0.027472527472527472 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTCTTCAATCCTTTTGTTGTGTGTTTTCTACTCTGCCTGATCACCATG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.0125000000000002 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.4124999999999996 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.4124999999999996 0.0 0.0 0.0 0.0 118-119 3.7125 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 6.0875 0.0 0.0 0.0 0.0 130-131 6.55 0.0 0.0 0.0 0.0 132-133 7.05 0.0 0.0 0.0 0.0 134-135 7.512499999999999 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 41.428574 145 >>END_MODULE Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra Read 802711 spots for SRR12919385.sra Written 802711 spots for SRR12919385.sra Read 802694 spots for SRR12919385.sra Written 802694 spots for SRR12919385.sra SRR ids: ['SRR12919385.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1zmi7uq4 SRR12919385.sra spots: 16053897 blocks: [[1, 802694], [802695, 1605388], [1605389, 2408082], [2408083, 3210776], [3210777, 4013470], [4013471, 4816164], [4816165, 5618858], [5618859, 6421552], [6421553, 7224246], [7224247, 8026940], [8026941, 8829634], [8829635, 9632328], [9632329, 10435022], [10435023, 11237716], [11237717, 12040410], [12040411, 12843104], [12843105, 13645798], [13645799, 14448492], [14448493, 15251186], [15251187, 16053897]] SRR12919385 file size 5434116 SRR12919385 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919385 SRR12919385_1.fastq SRR12919385_2.fastq Input file: SRR12919385_1.fastq Paired file: SRR12919385_2.fastq trimmed: SRR12919385-trimmed-pair1.fastq, SRR12919385-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:38:07 2025 >> started Wed Feb 12 22:38:24 2025 >> done (17.773s) 16053897 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 300 ( 0.00%) empty read pairs filtered out after trimming by size control 16053572 (100.00%) read pairs available; of these: 1937840 (12.07%) trimmed read pairs available after processing 14115732 (87.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 4 0.00% 22 3 0.00% 23 6 0.00% 24 5 0.00% 25 3 0.00% 26 4 0.00% 27 3 0.00% 28 5 0.00% 29 1 0.00% 30 3 0.00% 31 3 0.00% 32 5 0.00% 33 11 0.00% 34 10 0.00% 35 11 0.00% 36 5 0.00% 37 9 0.00% 38 9 0.00% 39 13 0.00% 40 17 0.00% 41 20 0.00% 42 24 0.00% 43 23 0.00% 44 21 0.00% 45 30 0.00% 46 21 0.00% 47 28 0.00% 48 32 0.00% 49 40 0.00% 50 57 0.00% 51 65 0.00% 52 78 0.00% 53 80 0.00% 54 80 0.00% 55 75 0.00% 56 101 0.00% 57 133 0.00% 58 123 0.00% 59 162 0.00% 60 235 0.00% 61 237 0.00% 62 271 0.00% 63 308 0.00% 64 330 0.00% 65 371 0.00% 66 357 0.00% 67 467 0.00% 68 533 0.00% 69 624 0.00% 70 748 0.00% 71 859 0.01% 72 1019 0.01% 73 1159 0.01% 74 1287 0.01% 75 1453 0.01% 76 1588 0.01% 77 1707 0.01% 78 1951 0.01% 79 2266 0.01% 80 2500 0.02% 81 2966 0.02% 82 3383 0.02% 83 3989 0.02% 84 4262 0.03% 85 4900 0.03% 86 5094 0.03% 87 5213 0.03% 88 5832 0.04% 89 6391 0.04% 90 7008 0.04% 91 7936 0.05% 92 8760 0.05% 93 9564 0.06% 94 10377 0.06% 95 11177 0.07% 96 11789 0.07% 97 11968 0.07% 98 12610 0.08% 99 13332 0.08% 100 14195 0.09% 101 14896 0.09% 102 16389 0.10% 103 17418 0.11% 104 18762 0.12% 105 19251 0.12% 106 20263 0.13% 107 20707 0.13% 108 21114 0.13% 109 21430 0.13% 110 22200 0.14% 111 23417 0.15% 112 24636 0.15% 113 25554 0.16% 114 26907 0.17% 115 28193 0.18% 116 29131 0.18% 117 29639 0.18% 118 29404 0.18% 119 30068 0.19% 120 30718 0.19% 121 31698 0.20% 122 32241 0.20% 123 33963 0.21% 124 35120 0.22% 125 36415 0.23% 126 37209 0.23% 127 37792 0.24% 128 37877 0.24% 129 38102 0.24% 130 38431 0.24% 131 38932 0.24% 132 40031 0.25% 133 41307 0.26% 134 42859 0.27% 135 43845 0.27% 136 44530 0.28% 137 45529 0.28% 138 45336 0.28% 139 45300 0.28% 140 45667 0.28% 141 46183 0.29% 142 46618 0.29% 143 46991 0.29% 144 48391 0.30% 145 49396 0.31% 146 50492 0.31% 147 50845 0.32% 148 51362 0.32% 149 51452 0.32% 150 51484 0.32% 151 14115732 87.93% 16053572 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=29 prefix-density=0.30 prefix-fanout=2.5 sequence=TTAGCATTCTCAGGCAACACAAACTTCCTCATAAACTTACCAACCCTCCTTTCCATTCTCACATACTTGGCCCCTTCTTTCTCCTCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=105.30 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=17.4 sequence=TCCTTCTTCACAATG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=32 prefix-density=0.23 prefix-fanout=2.5 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=268.39 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=15.1 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCG SRR12919385 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:39:07 Started mapping on | Feb 12 22:39:07 Finished on | Feb 12 22:40:49 Mapping speed, Million of reads per hour | 566.60 Number of input reads | 16053572 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14956688 Uniquely mapped reads % | 93.17% Average mapped length | 294.63 Number of splices: Total | 13681020 Number of splices: Annotated (sjdb) | 13323204 Number of splices: GT/AG | 13418314 Number of splices: GC/AG | 204204 Number of splices: AT/AC | 16316 Number of splices: Non-canonical | 42186 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.21 Insertion rate per base | 0.03% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 432512 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 67644 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 664372 664372 664372 N_multimapping 432512 432512 432512 N_noFeature 512400 14766084 604671 N_ambiguous 180916 961 82148 UnstrandedReadsAssigned:14263372 PositiveStrandReadsAssigned:189643 NegativeStrandReadsAssigned:14269869 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919385 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919385-trimmed-pair1.fastq SRR12919385-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,053,572 reads, 14,355,532 reads pseudoaligned [quant] estimated average fragment length: 256.589 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR12919385.ke.tsv 34699 SRR12919385.se.tsv 87100 total ==> SRR12919385.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.41 508 19.1526 Potri.005G024800.1.v4.1 1035 779.411 127 10.827 Potri.004G059700.1.v4.1 961 705.585 30 2.82516 Potri.007G009000.2.v4.1 1416 1160.41 0 0 Potri.003G141000.2.v4.1 2943 2687.41 427 10.5576 Potri.016G087400.1.v4.1 270 87.8012 1157 875.595 Potri.015G069301.1.v4.1 564 322.601 0 0 Potri.010G195200.1.v4.1 1773 1517.41 28 1.2261 Potri.012G127500.1.v4.1 977 721.519 12954 1192.96 ==> SRR12919385.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 70 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR12919385 completed mapping pipeline successfully