Starting /dee2/code/volunteer_pipeline.sh SRR12919386 current disk space = 3050540421120 free memory = 1576576600 SRR12919386 SRAfilesize 2dcde8bd0f3eea0179b22909f670d5c3 SRR12919386.sra SRR12919386.sra file validated SRR12919386 is paired end SRR12919386 is conventional basespace SRR12919386 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919386_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6005 37.0 37.0 37.0 37.0 37.0 2 36.519 37.0 37.0 37.0 37.0 37.0 3 36.6385 37.0 37.0 37.0 37.0 37.0 4 36.679 37.0 37.0 37.0 37.0 37.0 5 36.6665 37.0 37.0 37.0 37.0 37.0 6 36.6605 37.0 37.0 37.0 37.0 37.0 7 36.6165 37.0 37.0 37.0 37.0 37.0 8 36.6265 37.0 37.0 37.0 37.0 37.0 9 36.6715 37.0 37.0 37.0 37.0 37.0 10-14 36.6911 37.0 37.0 37.0 37.0 37.0 15-19 36.6555 37.0 37.0 37.0 37.0 37.0 20-24 36.6137 37.0 37.0 37.0 37.0 37.0 25-29 36.5853 37.0 37.0 37.0 37.0 37.0 30-34 36.5846 37.0 37.0 37.0 37.0 37.0 35-39 36.563900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.5658 37.0 37.0 37.0 37.0 37.0 45-49 36.5084 37.0 37.0 37.0 37.0 37.0 50-54 36.517399999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.50019999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.4087 37.0 37.0 37.0 37.0 37.0 65-69 36.4228 37.0 37.0 37.0 37.0 37.0 70-74 36.3695 37.0 37.0 37.0 37.0 37.0 75-79 36.3432 37.0 37.0 37.0 37.0 37.0 80-84 36.37230000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2838 37.0 37.0 37.0 37.0 37.0 90-94 36.287400000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.2285 37.0 37.0 37.0 37.0 37.0 100-104 36.2117 37.0 37.0 37.0 37.0 37.0 105-109 36.1695 37.0 37.0 37.0 37.0 37.0 110-114 36.0962 37.0 37.0 37.0 37.0 37.0 115-119 36.1604 37.0 37.0 37.0 37.0 37.0 120-124 36.1716 37.0 37.0 37.0 37.0 37.0 125-129 36.025800000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0203 37.0 37.0 37.0 37.0 37.0 135-139 35.8981 37.0 37.0 37.0 37.0 37.0 140-144 35.8938 37.0 37.0 37.0 37.0 37.0 145-149 35.860400000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.778999999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 2.0 25 2.0 26 3.0 27 2.0 28 8.0 29 20.0 30 24.0 31 20.0 32 37.0 33 56.0 34 103.0 35 298.0 36 3008.0 37 412.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.25 13.850000000000001 7.8 40.1 2 20.62062062062062 14.68968968968969 36.38638638638639 28.303303303303302 3 18.224999999999998 16.025 27.975 37.775 4 20.375 25.650000000000002 24.3 29.675 5 21.975 30.875000000000004 25.124999999999996 22.025 6 20.175 31.674999999999997 25.7 22.45 7 14.625 27.750000000000004 40.25 17.375 8 17.125 25.525 32.775 24.575 9 17.150000000000002 23.425 35.425000000000004 24.0 10-14 19.38 29.955 27.395000000000003 23.27 15-19 19.794999999999998 27.755000000000003 27.865000000000002 24.585 20-24 19.875 28.505000000000003 27.639999999999997 23.98 25-29 20.080000000000002 28.24 27.575 24.104999999999997 30-34 19.71 28.060000000000002 27.639999999999997 24.59 35-39 20.07 28.465 26.950000000000003 24.515 40-44 19.78 29.25 27.435 23.535 45-49 20.275000000000002 28.02 27.589999999999996 24.115000000000002 50-54 19.885 28.03 27.900000000000002 24.185000000000002 55-59 20.330000000000002 27.855 28.205000000000002 23.61 60-64 19.759999999999998 28.655 27.800000000000004 23.785 65-69 20.05 28.52 27.639999999999997 23.79 70-74 19.91 28.044999999999998 28.395 23.65 75-79 19.96 28.199999999999996 27.224999999999998 24.615000000000002 80-84 20.285 28.325 27.49 23.9 85-89 20.349999999999998 28.435 27.310000000000002 23.905 90-94 20.455000000000002 28.249999999999996 27.065 24.23 95-99 20.21 28.134999999999998 27.639999999999997 24.015 100-104 19.915 28.410000000000004 27.51 24.165 105-109 20.01 28.9 27.279999999999998 23.810000000000002 110-114 20.72 28.21 27.68 23.39 115-119 20.035 28.255000000000003 27.98 23.73 120-124 20.335 27.994999999999997 27.584999999999997 24.085 125-129 20.34 27.935 27.52 24.205 130-134 20.26 28.499999999999996 27.644999999999996 23.595 135-139 20.01 28.525 27.13 24.335 140-144 21.075 27.474999999999998 26.905 24.545 145-149 20.44 28.955 26.465 24.14 150-151 21.45 27.1 26.8 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 1.0 21 0.5 22 1.5 23 3.0 24 2.0 25 1.5 26 4.5 27 5.5 28 12.0 29 12.5 30 15.0 31 24.5 32 32.0 33 38.0 34 47.5 35 64.5 36 74.5 37 93.5 38 134.0 39 175.5 40 200.0 41 205.5 42 214.5 43 249.5 44 267.0 45 271.0 46 269.0 47 265.0 48 248.0 49 201.5 50 153.5 51 137.0 52 128.5 53 97.5 54 74.5 55 57.0 56 49.0 57 39.0 58 26.0 59 22.5 60 18.0 61 15.0 62 12.5 63 10.0 64 7.0 65 2.0 66 3.5 67 3.0 68 1.0 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.31631520532741 81.375 2 8.546059933407326 15.4 3 0.9711431742508323 2.625 4 0.1664816870144284 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.725 0.0 0.0 0.0 0.0 116-117 3.0875 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.6875 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.425000000000001 0.0 0.0 0.0 0.0 126-127 4.775 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.550000000000001 0.0 0.0 0.0 0.0 132-133 5.887499999999999 0.0 0.0 0.0 0.0 134-135 6.2375 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919386 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919386_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2445 37.0 37.0 37.0 37.0 37.0 2 35.9925 37.0 37.0 37.0 37.0 37.0 3 36.148 37.0 37.0 37.0 37.0 37.0 4 36.211 37.0 37.0 37.0 37.0 37.0 5 36.2675 37.0 37.0 37.0 37.0 37.0 6 36.4695 37.0 37.0 37.0 37.0 37.0 7 36.27 37.0 37.0 37.0 37.0 37.0 8 36.333 37.0 37.0 37.0 37.0 37.0 9 36.243 37.0 37.0 37.0 37.0 37.0 10-14 36.276799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.2859 37.0 37.0 37.0 37.0 37.0 20-24 36.2712 37.0 37.0 37.0 37.0 37.0 25-29 36.2261 37.0 37.0 37.0 37.0 37.0 30-34 36.2248 37.0 37.0 37.0 37.0 37.0 35-39 36.16930000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.140299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0876 37.0 37.0 37.0 37.0 37.0 50-54 36.0861 37.0 37.0 37.0 37.0 37.0 55-59 36.105599999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0538 37.0 37.0 37.0 37.0 37.0 65-69 36.015 37.0 37.0 37.0 37.0 37.0 70-74 35.9053 37.0 37.0 37.0 37.0 37.0 75-79 35.9409 37.0 37.0 37.0 37.0 37.0 80-84 35.9226 37.0 37.0 37.0 37.0 37.0 85-89 35.8747 37.0 37.0 37.0 37.0 37.0 90-94 35.8127 37.0 37.0 37.0 37.0 37.0 95-99 35.7831 37.0 37.0 37.0 37.0 37.0 100-104 35.7627 37.0 37.0 37.0 37.0 37.0 105-109 35.712 37.0 37.0 37.0 37.0 37.0 110-114 35.7187 37.0 37.0 37.0 37.0 37.0 115-119 35.6691 37.0 37.0 37.0 37.0 37.0 120-124 35.624300000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.5783 37.0 37.0 37.0 37.0 37.0 130-134 35.4417 37.0 37.0 37.0 37.0 37.0 135-139 35.4246 37.0 37.0 37.0 37.0 37.0 140-144 35.3193 37.0 37.0 37.0 34.6 37.0 145-149 35.31869999999999 37.0 37.0 37.0 34.6 37.0 150-151 35.121 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 4.0 15 2.0 16 3.0 17 1.0 18 2.0 19 1.0 20 3.0 21 2.0 22 2.0 23 4.0 24 4.0 25 8.0 26 7.0 27 9.0 28 10.0 29 23.0 30 32.0 31 44.0 32 68.0 33 102.0 34 197.0 35 508.0 36 2657.0 37 305.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.550000000000004 24.625 11.025 23.799999999999997 2 28.849999999999998 26.075 29.575000000000003 15.5 3 20.175 27.200000000000003 33.525 19.1 4 23.35 33.5 24.65 18.5 5 23.225 38.224999999999994 22.325 16.225 6 21.8 37.45 22.375 18.375 7 21.9 22.75 35.825 19.525000000000002 8 21.375 25.924999999999997 28.575 24.125 9 21.7 24.7 30.55 23.05 10-14 23.665 29.04 27.005000000000003 20.29 15-19 24.04 27.98 27.060000000000002 20.919999999999998 20-24 23.625 27.43 27.85 21.095 25-29 23.605 28.505000000000003 27.36 20.53 30-34 22.875 28.660000000000004 27.794999999999998 20.669999999999998 35-39 22.865 28.615000000000002 27.845 20.674999999999997 40-44 23.62 28.285 27.525 20.57 45-49 23.335 28.71 27.229999999999997 20.724999999999998 50-54 23.895 28.444999999999997 27.315 20.345 55-59 23.905 28.310000000000002 27.450000000000003 20.335 60-64 23.425 27.650000000000002 27.99 20.935000000000002 65-69 23.93 28.544999999999998 27.3 20.225 70-74 24.115000000000002 27.96 27.450000000000003 20.474999999999998 75-79 23.57 28.005000000000003 27.985 20.44 80-84 23.685000000000002 27.52 28.275 20.52 85-89 23.995 27.41 28.335 20.26 90-94 24.69 27.125 28.065 20.119999999999997 95-99 23.86 27.91 27.74 20.49 100-104 23.48 28.405 27.71 20.405 105-109 23.64 27.27 28.29 20.8 110-114 23.79 27.675 27.79 20.745 115-119 25.235000000000003 27.875 26.815 20.075000000000003 120-124 24.305 27.62 27.235 20.84 125-129 24.03 27.985 27.655 20.330000000000002 130-134 25.345000000000002 27.150000000000002 27.400000000000002 20.105 135-139 24.83 27.575 27.060000000000002 20.535 140-144 25.900000000000002 27.534999999999997 26.87 19.695 145-149 26.290000000000003 27.435 26.465 19.81 150-151 25.587500000000002 28.1125 27.525 18.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.5 24 3.0 25 2.5 26 3.0 27 6.5 28 7.5 29 9.5 30 13.5 31 13.0 32 18.5 33 35.5 34 52.0 35 70.0 36 90.0 37 110.5 38 137.0 39 172.5 40 206.0 41 243.0 42 250.0 43 258.5 44 279.5 45 267.5 46 263.5 47 250.5 48 215.5 49 191.5 50 172.0 51 135.5 52 103.5 53 93.0 54 80.5 55 55.0 56 42.5 57 34.5 58 23.5 59 19.0 60 16.5 61 10.5 62 5.5 63 7.0 64 7.5 65 5.5 66 2.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 1.0 97 1.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.3 #Duplication Level Percentage of deduplicated Percentage of total 1 90.50387596899225 81.72500000000001 2 8.471760797342192 15.299999999999999 3 0.8305647840531563 2.25 4 0.16611295681063123 0.6 5 0.02768549280177187 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.4749999999999996 0.0 0.0 0.0 0.0 114-115 2.775 0.0 0.0 0.0 0.0 116-117 3.1375 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 4.0875 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.2875 0.0 0.0 0.0 0.0 136-137 6.7125 0.0 0.0 0.0 0.0 138-139 7.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 215 0.007287582 6.7441864 140-144 >>END_MODULE Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337008 spots for SRR12919386.sra Written 337008 spots for SRR12919386.sra Read 337015 spots for SRR12919386.sra Written 337015 spots for SRR12919386.sra SRR ids: ['SRR12919386.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yy1o0_bq SRR12919386.sra spots: 6740167 blocks: [[1, 337008], [337009, 674016], [674017, 1011024], [1011025, 1348032], [1348033, 1685040], [1685041, 2022048], [2022049, 2359056], [2359057, 2696064], [2696065, 3033072], [3033073, 3370080], [3370081, 3707088], [3707089, 4044096], [4044097, 4381104], [4381105, 4718112], [4718113, 5055120], [5055121, 5392128], [5392129, 5729136], [5729137, 6066144], [6066145, 6403152], [6403153, 6740167]] SRR12919386 file size 2275270 SRR12919386 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919386 SRR12919386_1.fastq SRR12919386_2.fastq Input file: SRR12919386_1.fastq Paired file: SRR12919386_2.fastq trimmed: SRR12919386-trimmed-pair1.fastq, SRR12919386-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:13:31 2025 >> started Wed Feb 12 22:13:39 2025 >> done (7.565s) 6740167 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 190 ( 0.00%) empty read pairs filtered out after trimming by size control 6739967 (100.00%) read pairs available; of these: 752439 (11.16%) trimmed read pairs available after processing 5987528 (88.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 5 0.00% 23 2 0.00% 24 2 0.00% 25 0 0.00% 26 6 0.00% 27 3 0.00% 28 4 0.00% 29 2 0.00% 30 4 0.00% 31 7 0.00% 32 9 0.00% 33 2 0.00% 34 11 0.00% 35 10 0.00% 36 3 0.00% 37 7 0.00% 38 7 0.00% 39 11 0.00% 40 7 0.00% 41 5 0.00% 42 16 0.00% 43 13 0.00% 44 15 0.00% 45 11 0.00% 46 8 0.00% 47 6 0.00% 48 22 0.00% 49 19 0.00% 50 21 0.00% 51 32 0.00% 52 26 0.00% 53 31 0.00% 54 26 0.00% 55 50 0.00% 56 33 0.00% 57 35 0.00% 58 66 0.00% 59 74 0.00% 60 76 0.00% 61 105 0.00% 62 102 0.00% 63 120 0.00% 64 128 0.00% 65 147 0.00% 66 132 0.00% 67 180 0.00% 68 199 0.00% 69 231 0.00% 70 269 0.00% 71 291 0.00% 72 376 0.01% 73 473 0.01% 74 496 0.01% 75 574 0.01% 76 566 0.01% 77 619 0.01% 78 707 0.01% 79 784 0.01% 80 915 0.01% 81 1051 0.02% 82 1327 0.02% 83 1378 0.02% 84 1585 0.02% 85 1753 0.03% 86 1886 0.03% 87 1988 0.03% 88 2140 0.03% 89 2329 0.03% 90 2607 0.04% 91 2924 0.04% 92 3113 0.05% 93 3536 0.05% 94 3887 0.06% 95 4314 0.06% 96 4389 0.07% 97 4465 0.07% 98 4799 0.07% 99 4906 0.07% 100 5321 0.08% 101 5684 0.08% 102 6118 0.09% 103 6460 0.10% 104 7074 0.10% 105 7378 0.11% 106 7608 0.11% 107 7938 0.12% 108 8091 0.12% 109 8247 0.12% 110 8628 0.13% 111 9020 0.13% 112 9336 0.14% 113 9762 0.14% 114 10491 0.16% 115 10596 0.16% 116 10873 0.16% 117 11241 0.17% 118 11570 0.17% 119 11347 0.17% 120 12025 0.18% 121 12183 0.18% 122 12246 0.18% 123 13249 0.20% 124 13421 0.20% 125 14091 0.21% 126 14421 0.21% 127 14534 0.22% 128 14704 0.22% 129 14875 0.22% 130 15068 0.22% 131 15029 0.22% 132 15740 0.23% 133 16217 0.24% 134 16501 0.24% 135 17115 0.25% 136 17609 0.26% 137 17446 0.26% 138 17830 0.26% 139 17714 0.26% 140 18099 0.27% 141 18228 0.27% 142 18579 0.28% 143 18615 0.28% 144 19733 0.29% 145 20138 0.30% 146 20117 0.30% 147 20230 0.30% 148 20356 0.30% 149 20323 0.30% 150 20739 0.31% 151 5987528 88.84% 6739967 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=12.10 fanout-score-rank=17 prefix-density=0.31 prefix-fanout=6.2 sequence=TTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=76.11 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=11.6 sequence=ACAAAATCATCTAAGATGCATGTTTTGCTGCTATGATCCTTGAATATTTTTATCAATTTAAGCCCTTGCTCTAACTTGACCTCTTGAGTGTCTCTGCTGTTGGTGACTGGTTTGTTCTCGTTGTTCTCGAGGGTAATATGCTTCAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=11.45 fanout-score-rank=15 prefix-density=0.38 prefix-fanout=6.0 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=94.27 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.7 sequence=AGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12919386 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:14:22 Started mapping on | Feb 12 22:14:23 Finished on | Feb 12 22:15:20 Mapping speed, Million of reads per hour | 425.68 Number of input reads | 6739967 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 6187395 Uniquely mapped reads % | 91.80% Average mapped length | 295.21 Number of splices: Total | 5860233 Number of splices: Annotated (sjdb) | 5723813 Number of splices: GT/AG | 5748269 Number of splices: GC/AG | 87423 Number of splices: AT/AC | 8364 Number of splices: Non-canonical | 16177 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 164251 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 41906 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.94% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 388321 388321 388321 N_multimapping 164251 164251 164251 N_noFeature 227562 6112847 264782 N_ambiguous 73232 485 35578 UnstrandedReadsAssigned:5886601 PositiveStrandReadsAssigned:74063 NegativeStrandReadsAssigned:5887035 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919386 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919386-trimmed-pair1.fastq SRR12919386-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,739,967 reads, 5,938,790 reads pseudoaligned [quant] estimated average fragment length: 254.573 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR12919386.ke.tsv 34699 SRR12919386.se.tsv 87100 total ==> SRR12919386.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.43 281 27.8774 Potri.005G024800.1.v4.1 1035 781.427 78 17.4725 Potri.004G059700.1.v4.1 961 707.482 6 1.48452 Potri.007G009000.2.v4.1 1416 1162.43 0 0 Potri.003G141000.2.v4.1 2943 2689.43 234.205 15.2435 Potri.016G087400.1.v4.1 270 86.7411 409 825.369 Potri.015G069301.1.v4.1 564 322.581 0 0 Potri.010G195200.1.v4.1 1773 1519.43 47 5.41461 Potri.012G127500.1.v4.1 977 723.438 3828 926.232 ==> SRR12919386.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 87 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12919386 completed mapping pipeline successfully