Starting /dee2/code/volunteer_pipeline.sh SRR12919387 current disk space = 3050526363648 free memory = 1418317632 SRR12919387 SRAfilesize a2234bf32c524367803529466311f96a SRR12919387.sra SRR12919387.sra file validated SRR12919387 is paired end SRR12919387 is conventional basespace SRR12919387 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919387_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.462 37.0 37.0 37.0 37.0 37.0 2 36.07525 37.0 37.0 37.0 37.0 37.0 3 36.615 37.0 37.0 37.0 37.0 37.0 4 36.5635 37.0 37.0 37.0 37.0 37.0 5 36.6435 37.0 37.0 37.0 37.0 37.0 6 36.6505 37.0 37.0 37.0 37.0 37.0 7 36.6085 37.0 37.0 37.0 37.0 37.0 8 36.5965 37.0 37.0 37.0 37.0 37.0 9 36.7005 37.0 37.0 37.0 37.0 37.0 10-14 36.6425 37.0 37.0 37.0 37.0 37.0 15-19 36.6409 37.0 37.0 37.0 37.0 37.0 20-24 36.6374 37.0 37.0 37.0 37.0 37.0 25-29 36.5326 37.0 37.0 37.0 37.0 37.0 30-34 36.5326 37.0 37.0 37.0 37.0 37.0 35-39 36.503499999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4832 37.0 37.0 37.0 37.0 37.0 45-49 36.491 37.0 37.0 37.0 37.0 37.0 50-54 36.48950000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.4399 37.0 37.0 37.0 37.0 37.0 60-64 36.4097 37.0 37.0 37.0 37.0 37.0 65-69 36.384499999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3208 37.0 37.0 37.0 37.0 37.0 75-79 36.3342 37.0 37.0 37.0 37.0 37.0 80-84 36.2906 37.0 37.0 37.0 37.0 37.0 85-89 36.2215 37.0 37.0 37.0 37.0 37.0 90-94 36.273 37.0 37.0 37.0 37.0 37.0 95-99 36.272200000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1766 37.0 37.0 37.0 37.0 37.0 105-109 36.1743 37.0 37.0 37.0 37.0 37.0 110-114 36.120799999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0815 37.0 37.0 37.0 37.0 37.0 120-124 36.054700000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0909 37.0 37.0 37.0 37.0 37.0 130-134 35.944399999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.861900000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.820100000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.786500000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.6215 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 0.0 24 0.0 25 1.0 26 5.0 27 4.0 28 15.0 29 8.0 30 27.0 31 29.0 32 44.0 33 61.0 34 119.0 35 339.0 36 2943.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.074999999999996 12.225 8.275 41.425 2 20.69399044505909 12.672868996731204 35.73045008800603 30.90269047020367 3 16.6 19.325 28.349999999999998 35.725 4 21.075 25.45 24.8 28.675 5 22.525000000000002 29.775000000000002 25.85 21.85 6 20.125 34.375 24.95 20.549999999999997 7 15.475 25.974999999999998 40.949999999999996 17.599999999999998 8 18.15 25.674999999999997 31.474999999999998 24.7 9 17.775 24.8 34.175 23.25 10-14 19.63 29.57 27.875 22.925 15-19 19.72 28.310000000000002 27.415 24.555 20-24 19.655 28.28 28.285 23.78 25-29 19.91 27.72 28.035 24.335 30-34 19.220000000000002 28.415000000000003 27.865000000000002 24.5 35-39 19.509999999999998 28.439999999999998 27.965 24.085 40-44 19.580000000000002 28.810000000000002 27.71 23.9 45-49 20.365 27.91 27.685 24.04 50-54 20.655 28.749999999999996 27.0 23.595 55-59 20.474999999999998 27.765 27.935 23.825 60-64 20.369999999999997 28.305000000000003 27.68 23.645 65-69 20.145 28.294999999999998 27.465 24.095 70-74 20.395 28.685 27.015 23.905 75-79 19.18 28.37 28.275 24.175 80-84 21.015 27.97 27.425 23.59 85-89 20.169999999999998 28.110000000000003 27.425 24.295 90-94 20.369999999999997 28.57 27.21 23.849999999999998 95-99 21.240000000000002 28.17 27.22 23.369999999999997 100-104 20.695 28.52 27.245 23.54 105-109 20.990000000000002 27.79 27.155 24.065 110-114 20.775 28.485 27.215 23.525 115-119 20.49 28.43 27.54 23.54 120-124 20.44 27.865000000000002 27.43 24.265 125-129 20.849999999999998 28.060000000000002 27.02 24.07 130-134 20.9 27.925 27.01 24.165 135-139 21.37 28.185 26.63 23.815 140-144 20.925 27.939999999999998 27.089999999999996 24.044999999999998 145-149 21.305 27.755000000000003 26.96 23.98 150-151 20.424999999999997 27.725 27.4125 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 0.5 25 3.0 26 5.5 27 5.5 28 10.5 29 14.5 30 21.5 31 28.5 32 33.5 33 41.5 34 53.5 35 68.5 36 82.5 37 102.0 38 134.5 39 156.5 40 182.5 41 215.5 42 218.5 43 242.5 44 263.5 45 267.0 46 253.0 47 229.0 48 228.0 49 223.5 50 184.0 51 143.5 52 126.0 53 101.5 54 82.5 55 62.5 56 55.0 57 52.0 58 34.5 59 21.5 60 15.0 61 11.5 62 8.0 63 3.5 64 2.0 65 1.0 66 1.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.8823208934895 84.325 2 7.43666575864887 13.65 3 0.5448106782892944 1.5 4 0.1089621356578589 0.4 5 0.027240533914464723 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCAAGGCGAGCGTGCTTGATCTCTGCCAATTGAAGGGTAGCCTTCTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 2.8499999999999996 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.5999999999999996 0.0 0.0 0.0 0.0 122-123 3.9749999999999996 0.0 0.0 0.0 0.0 124-125 4.325 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.275 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.3125 0.0 0.0 0.0 0.0 134-135 6.775 0.0 0.0 0.0 0.0 136-137 7.2125 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919387 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919387_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.223 37.0 37.0 37.0 37.0 37.0 2 36.086 37.0 37.0 37.0 37.0 37.0 3 36.204 37.0 37.0 37.0 37.0 37.0 4 36.205 37.0 37.0 37.0 37.0 37.0 5 36.1805 37.0 37.0 37.0 37.0 37.0 6 36.2045 37.0 37.0 37.0 37.0 37.0 7 36.126 37.0 37.0 37.0 37.0 37.0 8 36.248 37.0 37.0 37.0 37.0 37.0 9 36.233 37.0 37.0 37.0 37.0 37.0 10-14 36.283699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.200900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2482 37.0 37.0 37.0 37.0 37.0 25-29 36.1418 37.0 37.0 37.0 37.0 37.0 30-34 36.115500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.088 37.0 37.0 37.0 37.0 37.0 40-44 36.0535 37.0 37.0 37.0 37.0 37.0 45-49 36.0319 37.0 37.0 37.0 37.0 37.0 50-54 36.0381 37.0 37.0 37.0 37.0 37.0 55-59 36.0005 37.0 37.0 37.0 37.0 37.0 60-64 35.9764 37.0 37.0 37.0 37.0 37.0 65-69 35.945499999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.950500000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.8631 37.0 37.0 37.0 37.0 37.0 80-84 35.89020000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8685 37.0 37.0 37.0 37.0 37.0 90-94 35.7704 37.0 37.0 37.0 37.0 37.0 95-99 35.7846 37.0 37.0 37.0 37.0 37.0 100-104 35.7931 37.0 37.0 37.0 37.0 37.0 105-109 35.648399999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.6157 37.0 37.0 37.0 37.0 37.0 115-119 35.6252 37.0 37.0 37.0 37.0 37.0 120-124 35.5555 37.0 37.0 37.0 37.0 37.0 125-129 35.4481 37.0 37.0 37.0 37.0 37.0 130-134 35.3122 37.0 37.0 37.0 37.0 37.0 135-139 35.2522 37.0 37.0 37.0 32.2 37.0 140-144 35.096599999999995 37.0 37.0 37.0 29.8 37.0 145-149 34.9991 37.0 37.0 37.0 25.0 37.0 150-151 34.69925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 4.0 15 4.0 16 2.0 17 3.0 18 1.0 19 3.0 20 5.0 21 5.0 22 5.0 23 8.0 24 4.0 25 8.0 26 7.0 27 6.0 28 12.0 29 18.0 30 32.0 31 44.0 32 62.0 33 107.0 34 194.0 35 543.0 36 2658.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.65 23.65 12.8 26.900000000000002 2 28.875 25.0 29.775000000000002 16.35 3 20.549999999999997 27.900000000000002 32.4 19.15 4 22.900000000000002 33.7 23.0 20.4 5 24.9 36.95 20.549999999999997 17.599999999999998 6 23.45 37.5 20.25 18.8 7 20.325 22.625 37.325 19.725 8 22.3 25.474999999999998 26.224999999999998 26.0 9 21.45 24.525 30.025000000000002 24.0 10-14 23.26 29.43 25.915 21.395 15-19 23.335 28.444999999999997 27.1 21.12 20-24 23.665 28.849999999999998 26.985 20.5 25-29 23.165 28.299999999999997 27.355 21.18 30-34 23.16 27.939999999999998 27.61 21.29 35-39 23.16 27.82 27.91 21.11 40-44 23.535 26.965 28.26 21.240000000000002 45-49 23.830000000000002 27.089999999999996 27.76 21.32 50-54 23.165 27.855 27.700000000000003 21.279999999999998 55-59 23.47 27.42 27.939999999999998 21.17 60-64 23.244999999999997 28.335 27.375 21.044999999999998 65-69 23.69 27.650000000000002 27.395000000000003 21.265 70-74 23.265 27.565 27.725 21.445 75-79 22.869999999999997 27.525 27.88 21.725 80-84 23.315 28.315 26.669999999999998 21.7 85-89 24.085 27.775 27.175 20.965 90-94 23.825 27.560000000000002 27.575 21.04 95-99 23.64 27.845 26.974999999999998 21.54 100-104 23.76 27.805000000000003 27.395000000000003 21.04 105-109 23.810000000000002 27.779999999999998 27.355 21.055 110-114 23.785 27.944999999999997 27.060000000000002 21.21 115-119 24.84 27.800000000000004 26.724999999999998 20.635 120-124 24.385 27.755000000000003 27.42 20.44 125-129 24.39 27.395000000000003 27.384999999999998 20.830000000000002 130-134 24.834999999999997 27.560000000000002 27.11 20.495 135-139 25.369999999999997 27.534999999999997 26.825 20.27 140-144 25.040000000000003 27.834999999999997 26.619999999999997 20.505000000000003 145-149 26.064999999999998 27.05 26.985 19.900000000000002 150-151 25.775 26.937499999999996 27.575 19.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 1.0 14 1.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 1.5 21 2.0 22 1.0 23 3.5 24 3.5 25 2.5 26 3.5 27 4.5 28 4.5 29 8.5 30 17.0 31 19.5 32 26.5 33 40.0 34 51.5 35 58.0 36 65.5 37 89.5 38 125.0 39 155.5 40 198.0 41 221.5 42 228.0 43 242.0 44 242.0 45 255.5 46 281.5 47 272.0 48 223.0 49 206.0 50 189.5 51 150.0 52 126.5 53 105.5 54 84.0 55 67.5 56 54.5 57 42.0 58 33.5 59 22.0 60 14.5 61 10.5 62 6.5 63 5.0 64 2.0 65 0.5 66 1.5 67 1.5 68 2.5 69 2.0 70 0.5 71 1.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.81942544459645 83.89999999999999 2 7.277701778385773 13.3 3 0.7113543091655267 1.95 4 0.13679890560875513 0.5 5 0.027359781121751026 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027359781121751026 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GTGAGCTCATTCATGGAAGGTGGGCTATGTTGGCTACTCTTGGTGCACTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 2.8499999999999996 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 4.0 0.0 0.0 0.0 0.0 124-125 4.35 0.0 0.0 0.0 0.0 126-127 4.7375 0.0 0.0 0.0 0.0 128-129 5.300000000000001 0.0 0.0 0.0 0.0 130-131 5.7125 0.0 0.0 0.0 0.0 132-133 6.3375 0.0 0.0 0.0 0.0 134-135 6.8125 0.0 0.0 0.0 0.0 136-137 7.25 0.0 0.0 0.0 0.0 138-139 7.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAACCC 10 0.006830828 145.0 9 AAAAAAA 40 0.0076550315 18.125 15-19 >>END_MODULE Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922822 spots for SRR12919387.sra Written 922822 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra Read 922804 spots for SRR12919387.sra Written 922804 spots for SRR12919387.sra SRR ids: ['SRR12919387.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ldbakcxu SRR12919387.sra spots: 18456098 blocks: [[1, 922804], [922805, 1845608], [1845609, 2768412], [2768413, 3691216], [3691217, 4614020], [4614021, 5536824], [5536825, 6459628], [6459629, 7382432], [7382433, 8305236], [8305237, 9228040], [9228041, 10150844], [10150845, 11073648], [11073649, 11996452], [11996453, 12919256], [12919257, 13842060], [13842061, 14764864], [14764865, 15687668], [15687669, 16610472], [16610473, 17533276], [17533277, 18456098]] SRR12919387 file size 6250489 SRR12919387 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919387 SRR12919387_1.fastq SRR12919387_2.fastq Input file: SRR12919387_1.fastq Paired file: SRR12919387_2.fastq trimmed: SRR12919387-trimmed-pair1.fastq, SRR12919387-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:56:44 2025 >> started Wed Feb 12 21:57:18 2025 >> done (33.792s) 18456098 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 6347 ( 0.03%) empty read pairs filtered out after trimming by size control 18449727 (99.97%) read pairs available; of these: 2037523 (11.04%) trimmed read pairs available after processing 16412204 (88.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 1 0.00% 21 4 0.00% 22 5 0.00% 23 3 0.00% 24 7 0.00% 25 4 0.00% 26 3 0.00% 27 2 0.00% 28 3 0.00% 29 9 0.00% 30 13 0.00% 31 12 0.00% 32 6 0.00% 33 8 0.00% 34 11 0.00% 35 8 0.00% 36 15 0.00% 37 20 0.00% 38 19 0.00% 39 13 0.00% 40 23 0.00% 41 29 0.00% 42 29 0.00% 43 21 0.00% 44 29 0.00% 45 28 0.00% 46 30 0.00% 47 45 0.00% 48 45 0.00% 49 47 0.00% 50 70 0.00% 51 94 0.00% 52 89 0.00% 53 94 0.00% 54 87 0.00% 55 99 0.00% 56 117 0.00% 57 132 0.00% 58 177 0.00% 59 213 0.00% 60 273 0.00% 61 323 0.00% 62 361 0.00% 63 379 0.00% 64 400 0.00% 65 445 0.00% 66 517 0.00% 67 597 0.00% 68 670 0.00% 69 754 0.00% 70 946 0.01% 71 1109 0.01% 72 1319 0.01% 73 1513 0.01% 74 1736 0.01% 75 1752 0.01% 76 1976 0.01% 77 2098 0.01% 78 2338 0.01% 79 2756 0.01% 80 3116 0.02% 81 3622 0.02% 82 4207 0.02% 83 4972 0.03% 84 5298 0.03% 85 5720 0.03% 86 6148 0.03% 87 6356 0.03% 88 6667 0.04% 89 7135 0.04% 90 7896 0.04% 91 8889 0.05% 92 9867 0.05% 93 10770 0.06% 94 11789 0.06% 95 12401 0.07% 96 12883 0.07% 97 13198 0.07% 98 13514 0.07% 99 14165 0.08% 100 14951 0.08% 101 15813 0.09% 102 17516 0.09% 103 18579 0.10% 104 19585 0.11% 105 20201 0.11% 106 20892 0.11% 107 21203 0.11% 108 21560 0.12% 109 21906 0.12% 110 22668 0.12% 111 23629 0.13% 112 24947 0.14% 113 26532 0.14% 114 27940 0.15% 115 29258 0.16% 116 29582 0.16% 117 30089 0.16% 118 30411 0.16% 119 30939 0.17% 120 31299 0.17% 121 32741 0.18% 122 33348 0.18% 123 34725 0.19% 124 36410 0.20% 125 37281 0.20% 126 38654 0.21% 127 39099 0.21% 128 38814 0.21% 129 39489 0.21% 130 39905 0.22% 131 40578 0.22% 132 41098 0.22% 133 42713 0.23% 134 44492 0.24% 135 45142 0.24% 136 46326 0.25% 137 46673 0.25% 138 47307 0.26% 139 47728 0.26% 140 47564 0.26% 141 48581 0.26% 142 49034 0.27% 143 50043 0.27% 144 51726 0.28% 145 53149 0.29% 146 53671 0.29% 147 54470 0.30% 148 55058 0.30% 149 54460 0.30% 150 55198 0.30% 151 16412204 88.96% 18449727 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.58 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=270.58 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=13.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=22 prefix-density=0.85 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.23 sequence-density-rank=18 fanout-score=10.68 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=5.2 sequence=GTGCCAAGGTCT SRR12919387 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:58:22 Started mapping on | Feb 12 21:58:22 Finished on | Feb 12 22:01:29 Mapping speed, Million of reads per hour | 355.18 Number of input reads | 18449727 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17116061 Uniquely mapped reads % | 92.77% Average mapped length | 295.17 Number of splices: Total | 16863327 Number of splices: Annotated (sjdb) | 16522492 Number of splices: GT/AG | 16499193 Number of splices: GC/AG | 294734 Number of splices: AT/AC | 11235 Number of splices: Non-canonical | 58165 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 458934 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 44396 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.37% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 874732 874732 874732 N_multimapping 458934 458934 458934 N_noFeature 587138 16834559 683094 N_ambiguous 287505 1069 101306 UnstrandedReadsAssigned:16241418 PositiveStrandReadsAssigned:280433 NegativeStrandReadsAssigned:16331661 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919387 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919387-trimmed-pair1.fastq SRR12919387-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,449,727 reads, 16,388,636 reads pseudoaligned [quant] estimated average fragment length: 262.444 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR12919387.ke.tsv 34699 SRR12919387.se.tsv 87100 total ==> SRR12919387.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.56 926 28.2448 Potri.005G024800.1.v4.1 1035 773.556 409 28.3284 Potri.004G059700.1.v4.1 961 699.753 55 4.21122 Potri.007G009000.2.v4.1 1416 1154.56 0 0 Potri.003G141000.2.v4.1 2943 2681.56 595 11.8883 Potri.016G087400.1.v4.1 270 86.4039 813 504.135 Potri.015G069301.1.v4.1 564 318.468 0 0 Potri.010G195200.1.v4.1 1773 1511.56 68 2.41032 Potri.012G127500.1.v4.1 977 715.65 267 19.9894 ==> SRR12919387.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 76 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 26 SRR12919387 completed mapping pipeline successfully