Starting /dee2/code/volunteer_pipeline.sh SRR12919388 current disk space = 3050495942656 free memory = 1580498220 SRR12919388 SRAfilesize 696a4f79d3cf9d0c10680791a713ea6f SRR12919388.sra SRR12919388.sra file validated SRR12919388 is paired end SRR12919388 is conventional basespace SRR12919388 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919388_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.664 37.0 37.0 37.0 37.0 37.0 2 36.3045 37.0 37.0 37.0 37.0 37.0 3 36.6625 37.0 37.0 37.0 37.0 37.0 4 36.6625 37.0 37.0 37.0 37.0 37.0 5 36.69 37.0 37.0 37.0 37.0 37.0 6 36.6635 37.0 37.0 37.0 37.0 37.0 7 36.628 37.0 37.0 37.0 37.0 37.0 8 36.6795 37.0 37.0 37.0 37.0 37.0 9 36.616 37.0 37.0 37.0 37.0 37.0 10-14 36.69199999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.6908 37.0 37.0 37.0 37.0 37.0 20-24 36.6584 37.0 37.0 37.0 37.0 37.0 25-29 36.6147 37.0 37.0 37.0 37.0 37.0 30-34 36.59740000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.5793 37.0 37.0 37.0 37.0 37.0 40-44 36.574 37.0 37.0 37.0 37.0 37.0 45-49 36.544200000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.516999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.473 37.0 37.0 37.0 37.0 37.0 60-64 36.3757 37.0 37.0 37.0 37.0 37.0 65-69 36.4244 37.0 37.0 37.0 37.0 37.0 70-74 36.3871 37.0 37.0 37.0 37.0 37.0 75-79 36.350100000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3851 37.0 37.0 37.0 37.0 37.0 85-89 36.279399999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.289 37.0 37.0 37.0 37.0 37.0 95-99 36.2813 37.0 37.0 37.0 37.0 37.0 100-104 36.25070000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.2519 37.0 37.0 37.0 37.0 37.0 110-114 36.108 37.0 37.0 37.0 37.0 37.0 115-119 36.1303 37.0 37.0 37.0 37.0 37.0 120-124 36.1038 37.0 37.0 37.0 37.0 37.0 125-129 36.0515 37.0 37.0 37.0 37.0 37.0 130-134 36.0407 37.0 37.0 37.0 37.0 37.0 135-139 35.9118 37.0 37.0 37.0 37.0 37.0 140-144 35.8865 37.0 37.0 37.0 37.0 37.0 145-149 35.837 37.0 37.0 37.0 37.0 37.0 150-151 35.717 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 5.0 27 2.0 28 4.0 29 23.0 30 14.0 31 25.0 32 36.0 33 67.0 34 122.0 35 300.0 36 2989.0 37 409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.55 13.05 6.075 36.325 2 20.770392749244714 12.789526686807653 35.04531722054381 31.394763343403824 3 17.424999999999997 18.025 28.225 36.325 4 21.9 25.074999999999996 23.625 29.4 5 22.125 30.025000000000002 25.124999999999996 22.725 6 20.05 32.925 26.05 20.974999999999998 7 15.9 28.65 38.625 16.825000000000003 8 16.900000000000002 26.400000000000002 32.45 24.25 9 15.625 25.650000000000002 34.225 24.5 10-14 19.31 29.585 27.905 23.200000000000003 15-19 20.205000000000002 27.71 27.98 24.104999999999997 20-24 19.535 28.970000000000002 27.284999999999997 24.21 25-29 19.675 27.845 28.110000000000003 24.37 30-34 19.475 29.270000000000003 27.22 24.035 35-39 19.86 28.475 27.544999999999998 24.12 40-44 19.68 29.28 27.245 23.794999999999998 45-49 19.8 28.744999999999997 27.985 23.47 50-54 19.445 27.915 28.74 23.9 55-59 20.235 28.15 27.650000000000002 23.965 60-64 20.375 28.32 27.47 23.835 65-69 19.950000000000003 27.939999999999998 27.794999999999998 24.315 70-74 20.455000000000002 28.549999999999997 27.229999999999997 23.765 75-79 20.369999999999997 28.134999999999998 28.055000000000003 23.44 80-84 20.549999999999997 28.095 27.775 23.580000000000002 85-89 19.62 28.225 27.950000000000003 24.205 90-94 20.25 27.73 27.900000000000002 24.12 95-99 20.549999999999997 28.48 27.21 23.76 100-104 20.445 28.549999999999997 27.224999999999998 23.78 105-109 21.14 27.91 27.62 23.330000000000002 110-114 20.09 28.249999999999996 27.52 24.14 115-119 19.915 28.425 27.575 24.085 120-124 20.64 28.189999999999998 27.205000000000002 23.965 125-129 20.565 27.975 27.735 23.724999999999998 130-134 20.674999999999997 28.655 26.765 23.905 135-139 20.45 28.449999999999996 27.11 23.990000000000002 140-144 20.895 27.195000000000004 27.415 24.495 145-149 20.585 28.055000000000003 27.01 24.349999999999998 150-151 21.224999999999998 27.287499999999998 26.974999999999998 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.5 22 2.5 23 2.5 24 4.0 25 4.5 26 3.0 27 5.5 28 8.5 29 14.5 30 21.0 31 26.0 32 33.0 33 44.0 34 59.5 35 69.0 36 90.5 37 116.5 38 131.0 39 163.0 40 182.5 41 204.0 42 222.5 43 219.0 44 253.5 45 264.0 46 246.5 47 247.0 48 227.5 49 211.5 50 185.5 51 157.5 52 126.5 53 94.0 54 87.5 55 73.5 56 57.5 57 40.0 58 27.0 59 23.0 60 17.0 61 11.0 62 7.0 63 4.0 64 2.5 65 0.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.875 #Duplication Level Percentage of deduplicated Percentage of total 1 90.26425591098747 81.125 2 8.400556328233657 15.1 3 1.1404728789986092 3.075 4 0.19471488178025034 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.2750000000000004 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.5125 0.0 0.0 0.0 0.0 122-123 4.975 0.0 0.0 0.0 0.0 124-125 5.375 0.0 0.0 0.0 0.0 126-127 5.8125 0.0 0.0 0.0 0.0 128-129 6.512499999999999 0.0 0.0 0.0 0.0 130-131 7.074999999999999 0.0 0.0 0.0 0.0 132-133 7.4625 0.0 0.0 0.0 0.0 134-135 8.175 0.0 0.0 0.0 0.0 136-137 8.8 0.0 0.0 0.0 0.0 138-139 9.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919388 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919388_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2065 37.0 37.0 37.0 37.0 37.0 2 36.3345 37.0 37.0 37.0 37.0 37.0 3 36.35 37.0 37.0 37.0 37.0 37.0 4 36.356 37.0 37.0 37.0 37.0 37.0 5 36.3565 37.0 37.0 37.0 37.0 37.0 6 36.363 37.0 37.0 37.0 37.0 37.0 7 36.3905 37.0 37.0 37.0 37.0 37.0 8 36.27 37.0 37.0 37.0 37.0 37.0 9 36.325 37.0 37.0 37.0 37.0 37.0 10-14 36.3673 37.0 37.0 37.0 37.0 37.0 15-19 36.347899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3341 37.0 37.0 37.0 37.0 37.0 25-29 36.2568 37.0 37.0 37.0 37.0 37.0 30-34 36.167100000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.22280000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.2161 37.0 37.0 37.0 37.0 37.0 45-49 36.1702 37.0 37.0 37.0 37.0 37.0 50-54 36.1289 37.0 37.0 37.0 37.0 37.0 55-59 36.1654 37.0 37.0 37.0 37.0 37.0 60-64 36.104 37.0 37.0 37.0 37.0 37.0 65-69 36.107099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.053 37.0 37.0 37.0 37.0 37.0 75-79 36.0281 37.0 37.0 37.0 37.0 37.0 80-84 35.9698 37.0 37.0 37.0 37.0 37.0 85-89 35.9799 37.0 37.0 37.0 37.0 37.0 90-94 35.957499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.96640000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.876200000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.8806 37.0 37.0 37.0 37.0 37.0 110-114 35.873999999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.8215 37.0 37.0 37.0 37.0 37.0 120-124 35.7204 37.0 37.0 37.0 37.0 37.0 125-129 35.7395 37.0 37.0 37.0 37.0 37.0 130-134 35.6703 37.0 37.0 37.0 37.0 37.0 135-139 35.5226 37.0 37.0 37.0 37.0 37.0 140-144 35.4765 37.0 37.0 37.0 37.0 37.0 145-149 35.3232 37.0 37.0 37.0 29.8 37.0 150-151 35.195750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 6.0 15 2.0 16 2.0 17 0.0 18 2.0 19 7.0 20 1.0 21 3.0 22 4.0 23 7.0 24 4.0 25 5.0 26 10.0 27 8.0 28 14.0 29 12.0 30 18.0 31 23.0 32 42.0 33 79.0 34 169.0 35 493.0 36 2723.0 37 362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.05 23.5 8.799999999999999 23.65 2 27.250000000000004 26.900000000000002 28.975 16.875 3 20.424999999999997 28.175 33.0 18.4 4 24.15 33.2 22.825 19.825 5 25.775 36.525 21.475 16.225 6 21.05 37.325 23.425 18.2 7 21.224999999999998 21.9 37.65 19.225 8 21.325 26.1 28.7 23.875 9 23.400000000000002 24.025 28.799999999999997 23.775 10-14 24.015 29.4 26.125 20.46 15-19 23.875 27.91 27.08 21.135 20-24 23.27 28.735 27.005000000000003 20.990000000000002 25-29 23.005 28.53 27.49 20.974999999999998 30-34 22.93 27.88 28.375 20.815 35-39 23.799999999999997 28.22 27.575 20.405 40-44 22.825 27.99 27.900000000000002 21.285 45-49 22.95 27.99 27.425 21.634999999999998 50-54 23.035 28.16 27.655 21.15 55-59 23.79 28.105000000000004 27.12 20.985 60-64 23.09 27.200000000000003 28.205000000000002 21.505 65-69 23.255 28.199999999999996 27.235 21.310000000000002 70-74 23.849999999999998 27.529999999999998 27.3 21.32 75-79 23.605 28.08 27.3 21.015 80-84 23.89 28.825 26.445 20.84 85-89 23.669999999999998 28.349999999999998 27.175 20.805 90-94 23.965 28.23 27.47 20.335 95-99 23.880000000000003 28.360000000000003 27.229999999999997 20.53 100-104 24.36 28.68 26.534999999999997 20.424999999999997 105-109 23.66 28.299999999999997 27.58 20.46 110-114 23.915 28.125 27.834999999999997 20.125 115-119 24.46 28.515 26.889999999999997 20.135 120-124 24.615000000000002 27.779999999999998 27.310000000000002 20.294999999999998 125-129 24.825 27.83 27.02 20.325 130-134 26.040000000000003 27.875 26.77 19.314999999999998 135-139 25.52 28.265 26.58 19.634999999999998 140-144 26.555 27.810000000000002 26.39 19.245 145-149 26.445 28.044999999999998 26.08 19.43 150-151 27.0 27.8625 26.3125 18.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 1.0 11 1.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 2.5 23 1.5 24 1.0 25 3.0 26 5.0 27 4.0 28 4.5 29 11.5 30 16.0 31 21.5 32 30.5 33 35.0 34 42.5 35 59.0 36 86.5 37 103.5 38 122.5 39 155.5 40 196.0 41 227.0 42 238.0 43 245.5 44 253.5 45 273.0 46 267.5 47 242.5 48 224.0 49 200.0 50 184.5 51 156.0 52 129.5 53 114.5 54 85.0 55 60.5 56 46.5 57 38.5 58 28.5 59 16.0 60 13.5 61 11.0 62 4.0 63 2.5 64 3.0 65 1.5 66 0.5 67 2.0 68 2.0 69 0.5 70 1.5 71 2.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.775 #Duplication Level Percentage of deduplicated Percentage of total 1 90.42049568365358 81.175 2 8.242829295460874 14.799999999999999 3 1.0303536619326092 2.775 4 0.278473962684489 1.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0278473962684489 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.7125000000000004 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.6375 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.5375 0.0 0.0 0.0 0.0 122-123 5.0 0.0 0.0 0.0 0.0 124-125 5.4 0.0 0.0 0.0 0.0 126-127 5.824999999999999 0.0 0.0 0.0 0.0 128-129 6.512499999999999 0.0 0.0 0.0 0.0 130-131 7.074999999999999 0.0 0.0 0.0 0.0 132-133 7.4625 0.0 0.0 0.0 0.0 134-135 8.2 0.0 0.0 0.0 0.0 136-137 8.825 0.0 0.0 0.0 0.0 138-139 9.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTATAT 10 0.006830828 145.0 3 >>END_MODULE Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964063 spots for SRR12919388.sra Written 964063 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra Read 964048 spots for SRR12919388.sra Written 964048 spots for SRR12919388.sra SRR ids: ['SRR12919388.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a2y31jsa SRR12919388.sra spots: 19280975 blocks: [[1, 964048], [964049, 1928096], [1928097, 2892144], [2892145, 3856192], [3856193, 4820240], [4820241, 5784288], [5784289, 6748336], [6748337, 7712384], [7712385, 8676432], [8676433, 9640480], [9640481, 10604528], [10604529, 11568576], [11568577, 12532624], [12532625, 13496672], [13496673, 14460720], [14460721, 15424768], [15424769, 16388816], [16388817, 17352864], [17352865, 18316912], [18316913, 19280975]] SRR12919388 file size 6530818 SRR12919388 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919388 SRR12919388_1.fastq SRR12919388_2.fastq Input file: SRR12919388_1.fastq Paired file: SRR12919388_2.fastq trimmed: SRR12919388-trimmed-pair1.fastq, SRR12919388-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:30:10 2025 >> started Wed Feb 12 22:30:31 2025 >> done (20.915s) 19280975 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 3376 ( 0.02%) empty read pairs filtered out after trimming by size control 19277562 (99.98%) read pairs available; of these: 2567495 (13.32%) trimmed read pairs available after processing 16710067 (86.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 7 0.00% 21 3 0.00% 22 9 0.00% 23 3 0.00% 24 7 0.00% 25 8 0.00% 26 6 0.00% 27 4 0.00% 28 8 0.00% 29 11 0.00% 30 19 0.00% 31 19 0.00% 32 14 0.00% 33 14 0.00% 34 13 0.00% 35 19 0.00% 36 19 0.00% 37 25 0.00% 38 29 0.00% 39 27 0.00% 40 46 0.00% 41 33 0.00% 42 44 0.00% 43 34 0.00% 44 56 0.00% 45 43 0.00% 46 38 0.00% 47 73 0.00% 48 97 0.00% 49 84 0.00% 50 118 0.00% 51 111 0.00% 52 138 0.00% 53 146 0.00% 54 141 0.00% 55 144 0.00% 56 190 0.00% 57 227 0.00% 58 261 0.00% 59 314 0.00% 60 351 0.00% 61 422 0.00% 62 499 0.00% 63 590 0.00% 64 617 0.00% 65 631 0.00% 66 692 0.00% 67 747 0.00% 68 882 0.00% 69 1108 0.01% 70 1247 0.01% 71 1414 0.01% 72 1792 0.01% 73 1980 0.01% 74 2096 0.01% 75 2319 0.01% 76 2519 0.01% 77 2774 0.01% 78 3001 0.02% 79 3469 0.02% 80 3850 0.02% 81 4471 0.02% 82 5274 0.03% 83 5780 0.03% 84 6366 0.03% 85 7240 0.04% 86 7673 0.04% 87 8052 0.04% 88 8860 0.05% 89 9252 0.05% 90 10166 0.05% 91 11114 0.06% 92 12494 0.06% 93 13656 0.07% 94 15017 0.08% 95 15859 0.08% 96 16520 0.09% 97 17143 0.09% 98 17718 0.09% 99 18659 0.10% 100 19358 0.10% 101 20328 0.11% 102 22068 0.11% 103 23551 0.12% 104 25394 0.13% 105 26150 0.14% 106 27157 0.14% 107 27895 0.14% 108 28509 0.15% 109 29297 0.15% 110 29551 0.15% 111 31055 0.16% 112 32371 0.17% 113 33550 0.17% 114 35575 0.18% 115 36799 0.19% 116 38115 0.20% 117 39016 0.20% 118 39371 0.20% 119 39901 0.21% 120 40794 0.21% 121 41462 0.22% 122 42295 0.22% 123 44064 0.23% 124 45904 0.24% 125 46656 0.24% 126 48521 0.25% 127 49204 0.26% 128 49932 0.26% 129 50571 0.26% 130 50438 0.26% 131 50918 0.26% 132 52047 0.27% 133 53318 0.28% 134 55144 0.29% 135 55934 0.29% 136 57296 0.30% 137 58306 0.30% 138 58622 0.30% 139 59303 0.31% 140 59390 0.31% 141 59955 0.31% 142 60987 0.32% 143 61385 0.32% 144 63274 0.33% 145 64823 0.34% 146 65197 0.34% 147 66721 0.35% 148 67917 0.35% 149 67292 0.35% 150 67891 0.35% 151 16710067 86.68% 19277562 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=18 prefix-density=0.57 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=36.27 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=2.4 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=24 prefix-density=0.63 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=94.63 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12919388 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:31:12 Started mapping on | Feb 12 22:31:13 Finished on | Feb 12 22:33:00 Mapping speed, Million of reads per hour | 648.59 Number of input reads | 19277562 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18079001 Uniquely mapped reads % | 93.78% Average mapped length | 293.88 Number of splices: Total | 17557210 Number of splices: Annotated (sjdb) | 17175069 Number of splices: GT/AG | 17188550 Number of splices: GC/AG | 298448 Number of splices: AT/AC | 14699 Number of splices: Non-canonical | 55513 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431722 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 47926 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.54% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 766839 766839 766839 N_multimapping 431722 431722 431722 N_noFeature 641086 17816874 747590 N_ambiguous 269013 1449 112427 UnstrandedReadsAssigned:17168902 PositiveStrandReadsAssigned:260678 NegativeStrandReadsAssigned:17218984 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919388 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919388-trimmed-pair1.fastq SRR12919388-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,277,562 reads, 17,312,971 reads pseudoaligned [quant] estimated average fragment length: 246.811 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52401 SRR12919388.ke.tsv 34699 SRR12919388.se.tsv 87100 total ==> SRR12919388.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.19 607 18.7741 Potri.005G024800.1.v4.1 1035 789.189 362 25.1425 Potri.004G059700.1.v4.1 961 715.3 36 2.75865 Potri.007G009000.2.v4.1 1416 1170.19 0 0 Potri.003G141000.2.v4.1 2943 2697.19 776.505 15.7803 Potri.016G087400.1.v4.1 270 89.3605 992.209 608.61 Potri.015G069301.1.v4.1 564 330.404 0 0 Potri.010G195200.1.v4.1 1773 1527.19 61 2.18937 Potri.012G127500.1.v4.1 977 731.267 1181 88.5228 ==> SRR12919388.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 231 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 7 SRR12919388 completed mapping pipeline successfully