Starting /dee2/code/volunteer_pipeline.sh SRR12919389 current disk space = 3050487558144 free memory = 1573570876 SRR12919389 SRAfilesize 85a3855a4dc5efd47bcc1b0830ebf32d SRR12919389.sra SRR12919389.sra file validated SRR12919389 is paired end SRR12919389 is conventional basespace SRR12919389 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919389_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6235 37.0 37.0 37.0 37.0 37.0 2 36.16625 37.0 37.0 37.0 37.0 37.0 3 36.579 37.0 37.0 37.0 37.0 37.0 4 36.6615 37.0 37.0 37.0 37.0 37.0 5 36.7485 37.0 37.0 37.0 37.0 37.0 6 36.704 37.0 37.0 37.0 37.0 37.0 7 36.632 37.0 37.0 37.0 37.0 37.0 8 36.6555 37.0 37.0 37.0 37.0 37.0 9 36.683 37.0 37.0 37.0 37.0 37.0 10-14 36.6753 37.0 37.0 37.0 37.0 37.0 15-19 36.6203 37.0 37.0 37.0 37.0 37.0 20-24 36.6163 37.0 37.0 37.0 37.0 37.0 25-29 36.5823 37.0 37.0 37.0 37.0 37.0 30-34 36.5113 37.0 37.0 37.0 37.0 37.0 35-39 36.525 37.0 37.0 37.0 37.0 37.0 40-44 36.4935 37.0 37.0 37.0 37.0 37.0 45-49 36.5016 37.0 37.0 37.0 37.0 37.0 50-54 36.4539 37.0 37.0 37.0 37.0 37.0 55-59 36.419799999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.404799999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3483 37.0 37.0 37.0 37.0 37.0 70-74 36.3438 37.0 37.0 37.0 37.0 37.0 75-79 36.295 37.0 37.0 37.0 37.0 37.0 80-84 36.3134 37.0 37.0 37.0 37.0 37.0 85-89 36.215999999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.234300000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.2141 37.0 37.0 37.0 37.0 37.0 100-104 36.19840000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.1094 37.0 37.0 37.0 37.0 37.0 110-114 36.0455 37.0 37.0 37.0 37.0 37.0 115-119 36.031099999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0338 37.0 37.0 37.0 37.0 37.0 125-129 35.9681 37.0 37.0 37.0 37.0 37.0 130-134 35.8625 37.0 37.0 37.0 37.0 37.0 135-139 35.8438 37.0 37.0 37.0 37.0 37.0 140-144 35.743700000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.743 37.0 37.0 37.0 37.0 37.0 150-151 35.59925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 0.0 25 2.0 26 5.0 27 16.0 28 16.0 29 19.0 30 26.0 31 31.0 32 37.0 33 51.0 34 103.0 35 310.0 36 2971.0 37 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.75 11.65 4.5249999999999995 40.075 2 18.01665404996215 12.919505425182942 38.5818824123139 30.481958112541 3 16.675 16.900000000000002 29.049999999999997 37.375 4 21.95 25.45 25.424999999999997 27.175 5 23.674999999999997 32.1 23.974999999999998 20.25 6 19.075 34.975 24.725 21.224999999999998 7 14.75 25.3 43.125 16.825000000000003 8 17.075000000000003 26.25 31.7 24.975 9 16.525000000000002 25.3 33.550000000000004 24.625 10-14 19.355 30.125 28.04 22.48 15-19 19.41 28.075 28.28 24.235 20-24 19.189999999999998 28.794999999999998 28.249999999999996 23.765 25-29 19.965 28.365000000000002 28.375 23.294999999999998 30-34 19.97 28.904999999999998 27.685 23.44 35-39 19.71 28.155 27.99 24.145 40-44 20.325 28.29 27.405 23.98 45-49 19.825 28.299999999999997 28.294999999999998 23.580000000000002 50-54 19.875 28.884999999999998 27.655 23.585 55-59 20.525 28.720000000000002 27.075 23.68 60-64 20.195 28.560000000000002 27.639999999999997 23.605 65-69 19.84 27.98 28.34 23.84 70-74 20.005 28.754999999999995 27.93 23.31 75-79 20.21 28.225 27.939999999999998 23.625 80-84 20.285 29.14 27.515 23.06 85-89 20.175 28.955 27.305 23.565 90-94 20.044999999999998 29.205 27.389999999999997 23.36 95-99 20.41 28.095 28.12 23.375 100-104 20.075000000000003 28.875 27.800000000000004 23.25 105-109 20.45 28.384999999999998 27.66 23.505000000000003 110-114 20.474999999999998 28.249999999999996 27.67 23.605 115-119 20.46 28.815 27.51 23.215 120-124 20.325 28.255000000000003 27.445000000000004 23.974999999999998 125-129 20.36 28.34 27.075 24.224999999999998 130-134 20.415 28.165000000000003 27.584999999999997 23.835 135-139 20.445 28.134999999999998 27.51 23.91 140-144 20.495 28.51 26.47 24.525 145-149 20.595 28.67 26.75 23.985 150-151 20.525 28.6375 26.6625 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 2.5 23 2.5 24 1.5 25 3.5 26 3.5 27 4.0 28 7.5 29 16.5 30 27.0 31 29.5 32 32.5 33 41.0 34 47.5 35 62.5 36 91.0 37 111.5 38 136.5 39 172.0 40 203.5 41 232.5 42 237.5 43 247.5 44 290.5 45 294.5 46 258.5 47 235.0 48 209.0 49 191.5 50 170.0 51 128.5 52 115.5 53 104.5 54 82.5 55 61.5 56 40.0 57 25.0 58 17.0 59 18.5 60 15.5 61 9.5 62 5.0 63 2.5 64 1.5 65 2.0 66 1.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.9249999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.99198673666758 82.325 2 7.8198397347333515 14.149999999999999 3 0.9394860458690245 2.55 4 0.19342359767891684 0.7000000000000001 5 0.027631942525559547 0.125 6 0.027631942525559547 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTCGTCTCTTTGCTCTACCTGAAAAACAAACACCAGACAGGGTCGCTT 6 0.15 No Hit GTACGTACGAAGACCTTGACTGAGATACTCATAAGAATTCAAAACGGGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 0.9125000000000001 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.3250000000000002 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 1.9874999999999998 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.5875 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.9375 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.55 0.0 0.0 0.0 0.0 122-123 4.8875 0.0 0.0 0.0 0.0 124-125 5.387499999999999 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.4 0.0 0.0 0.0 0.0 130-131 7.05 0.0 0.0 0.0 0.0 132-133 7.6125 0.0 0.0 0.0 0.0 134-135 8.212499999999999 0.0 0.0 0.0 0.0 136-137 8.662500000000001 0.0 0.0 0.0 0.0 138-139 9.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919389 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919389_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2915 37.0 37.0 37.0 37.0 37.0 2 36.1745 37.0 37.0 37.0 37.0 37.0 3 36.2575 37.0 37.0 37.0 37.0 37.0 4 36.3075 37.0 37.0 37.0 37.0 37.0 5 36.3575 37.0 37.0 37.0 37.0 37.0 6 36.421 37.0 37.0 37.0 37.0 37.0 7 36.4005 37.0 37.0 37.0 37.0 37.0 8 36.29 37.0 37.0 37.0 37.0 37.0 9 36.3955 37.0 37.0 37.0 37.0 37.0 10-14 36.4039 37.0 37.0 37.0 37.0 37.0 15-19 36.35 37.0 37.0 37.0 37.0 37.0 20-24 36.3513 37.0 37.0 37.0 37.0 37.0 25-29 36.2928 37.0 37.0 37.0 37.0 37.0 30-34 36.221799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.2427 37.0 37.0 37.0 37.0 37.0 40-44 36.2143 37.0 37.0 37.0 37.0 37.0 45-49 36.202999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.1645 37.0 37.0 37.0 37.0 37.0 55-59 36.127300000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.10450000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1033 37.0 37.0 37.0 37.0 37.0 70-74 36.011700000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.9816 37.0 37.0 37.0 37.0 37.0 80-84 35.933099999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.95119999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.90410000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9139 37.0 37.0 37.0 37.0 37.0 100-104 35.7983 37.0 37.0 37.0 37.0 37.0 105-109 35.8337 37.0 37.0 37.0 37.0 37.0 110-114 35.7993 37.0 37.0 37.0 37.0 37.0 115-119 35.734899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7091 37.0 37.0 37.0 37.0 37.0 125-129 35.6634 37.0 37.0 37.0 37.0 37.0 130-134 35.4666 37.0 37.0 37.0 37.0 37.0 135-139 35.3964 37.0 37.0 37.0 37.0 37.0 140-144 35.410000000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.186699999999995 37.0 37.0 37.0 29.8 37.0 150-151 35.033500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 2.0 15 2.0 16 2.0 17 0.0 18 2.0 19 2.0 20 0.0 21 4.0 22 2.0 23 5.0 24 1.0 25 8.0 26 6.0 27 8.0 28 19.0 29 24.0 30 30.0 31 29.0 32 52.0 33 115.0 34 197.0 35 482.0 36 2675.0 37 331.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.375 23.674999999999997 8.125 27.825 2 26.375 26.775 30.875000000000004 15.975 3 18.625 28.249999999999996 33.475 19.650000000000002 4 23.775 33.925 24.2 18.099999999999998 5 24.6 37.4 23.0 15.0 6 22.25 37.875 23.225 16.650000000000002 7 19.8 23.425 36.6 20.175 8 20.075000000000003 26.0 30.3 23.625 9 21.475 25.324999999999996 30.875000000000004 22.325 10-14 23.015 29.43 26.695 20.86 15-19 22.52 28.005000000000003 28.645 20.830000000000002 20-24 22.79 29.375 27.155 20.68 25-29 22.805 28.64 27.935 20.62 30-34 22.75 27.98 28.57 20.7 35-39 22.625 28.24 28.189999999999998 20.945 40-44 22.765 27.575 28.384999999999998 21.275 45-49 22.564999999999998 28.165000000000003 27.785 21.485000000000003 50-54 22.650000000000002 27.834999999999997 28.21 21.305 55-59 23.175 27.655 27.925 21.245 60-64 23.105 28.384999999999998 28.155 20.355 65-69 23.115 28.249999999999996 27.96 20.674999999999997 70-74 23.21 27.425 28.725 20.64 75-79 22.935 28.095 28.305000000000003 20.665 80-84 23.43 27.375 28.375 20.82 85-89 23.565 28.499999999999996 27.805000000000003 20.13 90-94 23.375 28.15 28.000000000000004 20.474999999999998 95-99 23.72 27.725 28.000000000000004 20.555 100-104 23.724999999999998 27.49 27.61 21.175 105-109 24.03 27.905 27.889999999999997 20.175 110-114 24.305 28.42 27.13 20.145 115-119 24.05 28.435 26.965 20.549999999999997 120-124 24.125 28.455000000000002 27.55 19.869999999999997 125-129 24.82 28.04 26.93 20.21 130-134 25.040000000000003 28.360000000000003 27.150000000000002 19.45 135-139 24.79 28.42 26.950000000000003 19.84 140-144 25.474999999999998 27.805000000000003 27.0 19.72 145-149 25.64 27.875 26.700000000000003 19.785 150-151 26.5625 27.987499999999997 26.875 18.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.5 10 1.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.0 24 1.0 25 4.5 26 5.5 27 5.5 28 9.5 29 15.5 30 24.5 31 30.5 32 33.5 33 40.5 34 58.5 35 69.0 36 84.0 37 105.0 38 137.0 39 182.0 40 209.5 41 234.5 42 246.5 43 263.5 44 274.0 45 272.5 46 269.0 47 242.5 48 224.5 49 195.5 50 158.0 51 132.5 52 104.0 53 81.0 54 64.5 55 53.0 56 39.0 57 28.0 58 25.0 59 17.5 60 8.5 61 8.0 62 10.0 63 7.0 64 4.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.97433066519459 82.39999999999999 2 7.976814794369306 14.45 3 0.8280430582390284 2.25 4 0.1380071763731714 0.5 5 0.05520287054926856 0.25 6 0.02760143527463428 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCTTTAAAAATTCCAAGCACCAAAAGCATGTCACTCGCCTCTCATCTCT 6 0.15 No Hit CTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCA 5 0.125 No Hit CATGGATGGTTTCTACATTGCTCCTGCTTTCATGGACAAGCTTGTTGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.05 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.1624999999999996 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 4.05 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 4.737500000000001 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.5875 0.0 0.0 0.0 0.0 126-127 6.074999999999999 0.0 0.0 0.0 0.0 128-129 6.625 0.0 0.0 0.0 0.0 130-131 7.275 0.0 0.0 0.0 0.0 132-133 7.862500000000001 0.0 0.0 0.0 0.0 134-135 8.462499999999999 0.0 0.0 0.0 0.0 136-137 8.95 0.0 0.0 0.0 0.0 138-139 9.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATGCT 10 0.006830828 145.0 9 >>END_MODULE Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134639 spots for SRR12919389.sra Written 1134639 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra Read 1134633 spots for SRR12919389.sra Written 1134633 spots for SRR12919389.sra SRR ids: ['SRR12919389.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7wze_3pw SRR12919389.sra spots: 22692666 blocks: [[1, 1134633], [1134634, 2269266], [2269267, 3403899], [3403900, 4538532], [4538533, 5673165], [5673166, 6807798], [6807799, 7942431], [7942432, 9077064], [9077065, 10211697], [10211698, 11346330], [11346331, 12480963], [12480964, 13615596], [13615597, 14750229], [14750230, 15884862], [15884863, 17019495], [17019496, 18154128], [18154129, 19288761], [19288762, 20423394], [20423395, 21558027], [21558028, 22692666]] SRR12919389 file size 7690260 SRR12919389 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919389 SRR12919389_1.fastq SRR12919389_2.fastq Input file: SRR12919389_1.fastq Paired file: SRR12919389_2.fastq trimmed: SRR12919389-trimmed-pair1.fastq, SRR12919389-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:50:39 2025 >> started Wed Feb 12 22:51:02 2025 >> done (23.680s) 22692666 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 1986 ( 0.01%) empty read pairs filtered out after trimming by size control 22690648 (99.99%) read pairs available; of these: 3216984 (14.18%) trimmed read pairs available after processing 19473664 (85.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 8 0.00% 25 4 0.00% 26 6 0.00% 27 4 0.00% 28 9 0.00% 29 7 0.00% 30 7 0.00% 31 10 0.00% 32 7 0.00% 33 12 0.00% 34 17 0.00% 35 12 0.00% 36 20 0.00% 37 14 0.00% 38 29 0.00% 39 18 0.00% 40 28 0.00% 41 38 0.00% 42 39 0.00% 43 37 0.00% 44 17 0.00% 45 36 0.00% 46 55 0.00% 47 62 0.00% 48 84 0.00% 49 72 0.00% 50 97 0.00% 51 112 0.00% 52 116 0.00% 53 137 0.00% 54 147 0.00% 55 135 0.00% 56 163 0.00% 57 236 0.00% 58 253 0.00% 59 328 0.00% 60 368 0.00% 61 400 0.00% 62 455 0.00% 63 627 0.00% 64 574 0.00% 65 685 0.00% 66 698 0.00% 67 826 0.00% 68 995 0.00% 69 1102 0.00% 70 1312 0.01% 71 1620 0.01% 72 1796 0.01% 73 2119 0.01% 74 2393 0.01% 75 2517 0.01% 76 2902 0.01% 77 3097 0.01% 78 3525 0.02% 79 3979 0.02% 80 4416 0.02% 81 5358 0.02% 82 6137 0.03% 83 7085 0.03% 84 7695 0.03% 85 8313 0.04% 86 8918 0.04% 87 9689 0.04% 88 10442 0.05% 89 11111 0.05% 90 12678 0.06% 91 13824 0.06% 92 14997 0.07% 93 16392 0.07% 94 18149 0.08% 95 19256 0.08% 96 20271 0.09% 97 21109 0.09% 98 21671 0.10% 99 23010 0.10% 100 24582 0.11% 101 25646 0.11% 102 27801 0.12% 103 29517 0.13% 104 31161 0.14% 105 32661 0.14% 106 34113 0.15% 107 35324 0.16% 108 35884 0.16% 109 37160 0.16% 110 38411 0.17% 111 39289 0.17% 112 40958 0.18% 113 42699 0.19% 114 44937 0.20% 115 47078 0.21% 116 47672 0.21% 117 49263 0.22% 118 49690 0.22% 119 50114 0.22% 120 51662 0.23% 121 52903 0.23% 122 53841 0.24% 123 55735 0.25% 124 58537 0.26% 125 59443 0.26% 126 61187 0.27% 127 62441 0.28% 128 62853 0.28% 129 62956 0.28% 130 64201 0.28% 131 64853 0.29% 132 66002 0.29% 133 67805 0.30% 134 69529 0.31% 135 71174 0.31% 136 73085 0.32% 137 72937 0.32% 138 74359 0.33% 139 75140 0.33% 140 75173 0.33% 141 75700 0.33% 142 76672 0.34% 143 77746 0.34% 144 80100 0.35% 145 80342 0.35% 146 81402 0.36% 147 82158 0.36% 148 83146 0.37% 149 81782 0.36% 150 83252 0.37% 151 19473664 85.82% 22690648 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.41 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=44.34 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=17 prefix-density=0.63 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=22.15 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.3 sequence=GCCAAAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAAATTCAGCTTTCTTTGGCAACAGCTTGAAGAAAGTGAGCTCATCAAGGTTCACAAACTCCAAAATTTCACCAGGGAGCTTCAAGGTTGTTGCAGAGTACGATGAGAAGAAGCAGACCGACAAGGACAGATGGGGAGGCCTTGTTACAGACATGTCTGATGACCAACAAGATATCAGCAGAGGAAAGGGTATGGTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGTTTTGAATTCTTATGAGTATCTCAGTCAAGGTCTTCGTACGTACAACTTGGACAACAACATGGATGGTTTCTACATTGCTCCTGCTTTCATGGACAAGCTTGTTGTTC SRR12919389 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:51:43 Started mapping on | Feb 12 22:51:44 Finished on | Feb 12 22:53:55 Mapping speed, Million of reads per hour | 623.56 Number of input reads | 22690648 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21355246 Uniquely mapped reads % | 94.11% Average mapped length | 293.41 Number of splices: Total | 21315949 Number of splices: Annotated (sjdb) | 20812765 Number of splices: GT/AG | 20877348 Number of splices: GC/AG | 354680 Number of splices: AT/AC | 16889 Number of splices: Non-canonical | 67032 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 504102 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 44922 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 831300 831300 831300 N_multimapping 504102 504102 504102 N_noFeature 846220 21099491 962261 N_ambiguous 273347 1270 132849 UnstrandedReadsAssigned:20235679 PositiveStrandReadsAssigned:254485 NegativeStrandReadsAssigned:20260136 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919389 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919389-trimmed-pair1.fastq SRR12919389-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,690,648 reads, 20,308,889 reads pseudoaligned [quant] estimated average fragment length: 245.171 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR12919389.ke.tsv 34699 SRR12919389.se.tsv 87100 total ==> SRR12919389.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.83 930 27.5435 Potri.005G024800.1.v4.1 1035 790.829 712 47.2983 Potri.004G059700.1.v4.1 961 717.051 100 7.32653 Potri.007G009000.2.v4.1 1416 1171.83 0 0 Potri.003G141000.2.v4.1 2943 2698.83 1183 23.0281 Potri.016G087400.1.v4.1 270 90.3228 1209 703.198 Potri.015G069301.1.v4.1 564 332.752 0 0 Potri.010G195200.1.v4.1 1773 1528.83 133 4.57026 Potri.012G127500.1.v4.1 977 732.944 714 51.1771 ==> SRR12919389.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 51 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 402 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 39 SRR12919389 completed mapping pipeline successfully