Starting /dee2/code/volunteer_pipeline.sh SRR12919390 current disk space = 3050479034368 free memory = 1579339416 SRR12919390 SRAfilesize 19427b8ebd13098deee3db1768c8e387 SRR12919390.sra SRR12919390.sra file validated SRR12919390 is paired end SRR12919390 is conventional basespace SRR12919390 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919390_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.599 37.0 37.0 37.0 37.0 37.0 2 36.27825 37.0 37.0 37.0 37.0 37.0 3 36.585 37.0 37.0 37.0 37.0 37.0 4 36.6705 37.0 37.0 37.0 37.0 37.0 5 36.6615 37.0 37.0 37.0 37.0 37.0 6 36.6975 37.0 37.0 37.0 37.0 37.0 7 36.6125 37.0 37.0 37.0 37.0 37.0 8 36.6855 37.0 37.0 37.0 37.0 37.0 9 36.72 37.0 37.0 37.0 37.0 37.0 10-14 36.6834 37.0 37.0 37.0 37.0 37.0 15-19 36.673 37.0 37.0 37.0 37.0 37.0 20-24 36.6577 37.0 37.0 37.0 37.0 37.0 25-29 36.5701 37.0 37.0 37.0 37.0 37.0 30-34 36.5762 37.0 37.0 37.0 37.0 37.0 35-39 36.549899999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.5207 37.0 37.0 37.0 37.0 37.0 45-49 36.4989 37.0 37.0 37.0 37.0 37.0 50-54 36.4997 37.0 37.0 37.0 37.0 37.0 55-59 36.463 37.0 37.0 37.0 37.0 37.0 60-64 36.4477 37.0 37.0 37.0 37.0 37.0 65-69 36.3781 37.0 37.0 37.0 37.0 37.0 70-74 36.3969 37.0 37.0 37.0 37.0 37.0 75-79 36.329499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.366600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.285399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.267399999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.2264 37.0 37.0 37.0 37.0 37.0 100-104 36.2716 37.0 37.0 37.0 37.0 37.0 105-109 36.198100000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1283 37.0 37.0 37.0 37.0 37.0 115-119 36.0952 37.0 37.0 37.0 37.0 37.0 120-124 36.0843 37.0 37.0 37.0 37.0 37.0 125-129 36.001 37.0 37.0 37.0 37.0 37.0 130-134 35.9676 37.0 37.0 37.0 37.0 37.0 135-139 35.9233 37.0 37.0 37.0 37.0 37.0 140-144 35.8482 37.0 37.0 37.0 37.0 37.0 145-149 35.8682 37.0 37.0 37.0 37.0 37.0 150-151 35.69475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 3.0 26 5.0 27 6.0 28 10.0 29 14.0 30 17.0 31 17.0 32 46.0 33 71.0 34 111.0 35 319.0 36 2948.0 37 430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.475 11.1 6.875000000000001 44.55 2 19.63791802866482 11.918531556449585 36.43449836560222 32.00905204928338 3 16.8 16.05 27.55 39.6 4 21.05 22.95 24.7 31.3 5 21.85 30.0 24.375 23.775 6 20.0 34.300000000000004 26.075 19.625 7 16.175 25.95 40.275 17.599999999999998 8 17.375 26.224999999999998 30.325000000000003 26.075 9 16.275000000000002 24.525 36.125 23.075000000000003 10-14 19.62 29.92 27.155 23.305 15-19 19.6 27.900000000000002 28.12 24.38 20-24 19.35 28.535 27.634999999999998 24.48 25-29 19.105 28.67 28.13 24.095 30-34 19.095000000000002 28.89 27.939999999999998 24.075 35-39 19.945 28.405 27.51 24.14 40-44 19.919999999999998 28.815 27.544999999999998 23.72 45-49 19.814999999999998 27.815 27.955000000000002 24.415 50-54 19.475 28.185 28.42 23.919999999999998 55-59 20.225 28.26 27.200000000000003 24.315 60-64 20.11 28.235 27.445000000000004 24.21 65-69 20.195 28.08 27.584999999999997 24.14 70-74 20.125 28.689999999999998 27.810000000000002 23.375 75-79 20.005 28.665000000000003 27.589999999999996 23.74 80-84 20.150000000000002 28.16 27.63 24.060000000000002 85-89 19.84 28.634999999999998 27.605 23.919999999999998 90-94 20.96 27.625 27.750000000000004 23.665 95-99 20.424999999999997 28.15 27.939999999999998 23.485 100-104 19.825 27.584999999999997 28.349999999999998 24.240000000000002 105-109 20.655 27.825 27.665 23.855 110-114 19.655 27.944999999999997 28.444999999999997 23.955000000000002 115-119 20.31 28.615000000000002 27.224999999999998 23.849999999999998 120-124 20.41 28.549999999999997 26.790000000000003 24.25 125-129 20.544999999999998 28.754999999999995 27.025 23.674999999999997 130-134 20.84 28.225 27.175 23.76 135-139 20.474999999999998 27.91 27.485 24.13 140-144 20.145 28.599999999999998 27.295 23.96 145-149 20.77 28.544999999999998 26.650000000000002 24.035 150-151 19.375 28.237499999999997 27.125 25.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.5 21 1.5 22 0.0 23 0.0 24 1.0 25 2.0 26 5.5 27 9.5 28 10.5 29 10.0 30 13.5 31 21.0 32 31.0 33 45.5 34 54.5 35 58.0 36 82.5 37 106.0 38 118.5 39 140.0 40 186.5 41 221.5 42 236.5 43 264.0 44 272.5 45 276.5 46 277.0 47 271.0 48 251.5 49 203.5 50 163.0 51 137.5 52 113.5 53 93.5 54 69.5 55 58.0 56 51.5 57 31.5 58 16.0 59 14.0 60 14.0 61 9.5 62 8.0 63 9.0 64 10.5 65 7.5 66 3.0 67 3.5 68 4.0 69 2.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.98157822381083 82.72500000000001 2 8.083585372559803 14.7 3 0.9073412152873247 2.475 4 0.027495188342040146 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.0 0.0 120-121 1.9749999999999999 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.8125 0.0 0.0 0.0 0.0 132-133 4.3 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 5.0 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATATC 10 0.006830828 145.0 4 >>END_MODULE SRR12919390 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919390_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.24 37.0 37.0 37.0 37.0 37.0 2 36.204 37.0 37.0 37.0 37.0 37.0 3 36.247 37.0 37.0 37.0 37.0 37.0 4 36.221 37.0 37.0 37.0 37.0 37.0 5 36.3315 37.0 37.0 37.0 37.0 37.0 6 36.2395 37.0 37.0 37.0 37.0 37.0 7 36.301 37.0 37.0 37.0 37.0 37.0 8 36.304 37.0 37.0 37.0 37.0 37.0 9 36.4155 37.0 37.0 37.0 37.0 37.0 10-14 36.349799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.3495 37.0 37.0 37.0 37.0 37.0 20-24 36.325199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.2808 37.0 37.0 37.0 37.0 37.0 30-34 36.2332 37.0 37.0 37.0 37.0 37.0 35-39 36.2073 37.0 37.0 37.0 37.0 37.0 40-44 36.1832 37.0 37.0 37.0 37.0 37.0 45-49 36.1546 37.0 37.0 37.0 37.0 37.0 50-54 36.1023 37.0 37.0 37.0 37.0 37.0 55-59 36.04 37.0 37.0 37.0 37.0 37.0 60-64 36.0746 37.0 37.0 37.0 37.0 37.0 65-69 36.02759999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.9818 37.0 37.0 37.0 37.0 37.0 75-79 35.99829999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.0 37.0 37.0 37.0 37.0 37.0 85-89 35.914699999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8438 37.0 37.0 37.0 37.0 37.0 95-99 35.8318 37.0 37.0 37.0 37.0 37.0 100-104 35.803399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8304 37.0 37.0 37.0 37.0 37.0 110-114 35.783 37.0 37.0 37.0 37.0 37.0 115-119 35.78 37.0 37.0 37.0 37.0 37.0 120-124 35.681099999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.6622 37.0 37.0 37.0 37.0 37.0 130-134 35.564499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4805 37.0 37.0 37.0 37.0 37.0 140-144 35.4663 37.0 37.0 37.0 37.0 37.0 145-149 35.364599999999996 37.0 37.0 37.0 32.2 37.0 150-151 35.24675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 3.0 16 0.0 17 1.0 18 1.0 19 0.0 20 2.0 21 1.0 22 3.0 23 5.0 24 3.0 25 4.0 26 7.0 27 10.0 28 12.0 29 18.0 30 31.0 31 33.0 32 59.0 33 109.0 34 214.0 35 551.0 36 2654.0 37 277.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.85 24.3 10.375 29.475 2 27.325 27.625 29.7 15.35 3 19.650000000000002 28.425 32.425 19.5 4 22.6 34.725 23.425 19.25 5 24.75 36.475 21.9 16.875 6 20.724999999999998 39.574999999999996 22.725 16.975 7 20.674999999999997 22.975 37.275000000000006 19.075 8 21.0 25.7 29.325000000000003 23.974999999999998 9 21.275 25.45 30.85 22.425 10-14 23.73 29.744999999999997 25.955000000000002 20.57 15-19 23.885 27.650000000000002 28.08 20.385 20-24 23.189999999999998 28.345 27.060000000000002 21.404999999999998 25-29 22.900000000000002 28.67 27.575 20.855 30-34 23.185 28.575 27.500000000000004 20.74 35-39 23.080000000000002 27.815 28.09 21.015 40-44 23.465 27.99 28.005000000000003 20.54 45-49 22.88 28.415000000000003 27.66 21.044999999999998 50-54 23.32 27.67 28.194999999999997 20.815 55-59 23.73 28.244999999999997 27.71 20.315 60-64 24.075 27.445000000000004 27.905 20.575 65-69 23.195 28.48 27.529999999999998 20.794999999999998 70-74 23.915 27.655 27.815 20.615 75-79 23.54 27.994999999999997 27.74 20.724999999999998 80-84 23.655 27.935 28.27 20.14 85-89 23.69 28.255000000000003 27.755000000000003 20.3 90-94 24.41 27.87 27.215 20.505000000000003 95-99 23.845 28.58 27.495000000000005 20.080000000000002 100-104 23.78 27.775 27.894999999999996 20.549999999999997 105-109 24.215 27.800000000000004 27.389999999999997 20.595 110-114 24.32 27.55 27.73 20.4 115-119 23.875 27.685 27.375 21.065 120-124 24.245 28.105000000000004 27.52 20.13 125-129 24.615000000000002 28.444999999999997 27.43 19.509999999999998 130-134 24.805 27.865000000000002 26.77 20.560000000000002 135-139 25.069999999999997 27.975 26.845000000000002 20.11 140-144 25.22 27.48 26.884999999999998 20.415 145-149 25.635 27.529999999999998 26.565 20.27 150-151 25.412499999999998 28.15 27.3125 19.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 1.0 26 2.5 27 4.0 28 6.5 29 8.0 30 13.0 31 19.5 32 30.5 33 41.5 34 47.0 35 67.0 36 81.5 37 105.0 38 138.0 39 171.5 40 213.0 41 244.5 42 251.5 43 257.0 44 269.0 45 283.5 46 291.0 47 257.5 48 219.5 49 211.5 50 178.5 51 125.0 52 94.5 53 75.0 54 66.5 55 59.0 56 42.5 57 31.0 58 22.0 59 13.0 60 10.5 61 8.0 62 7.0 63 5.0 64 3.0 65 3.0 66 2.0 67 0.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.0 98 0.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.825 #Duplication Level Percentage of deduplicated Percentage of total 1 91.13680154142581 82.775 2 7.789705477566749 14.149999999999999 3 0.990916597853014 2.7 4 0.055050922102945224 0.2 5 0.0 0.0 6 0.0 0.0 7 0.027525461051472612 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.6125 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.4124999999999996 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.325 0.0 0.0 0.0 0.0 134-135 4.575 0.0 0.0 0.0 0.0 136-137 5.025 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930440 spots for SRR12919390.sra Written 930440 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra Read 930422 spots for SRR12919390.sra Written 930422 spots for SRR12919390.sra SRR ids: ['SRR12919390.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f4kr_2oi SRR12919390.sra spots: 18608458 blocks: [[1, 930422], [930423, 1860844], [1860845, 2791266], [2791267, 3721688], [3721689, 4652110], [4652111, 5582532], [5582533, 6512954], [6512955, 7443376], [7443377, 8373798], [8373799, 9304220], [9304221, 10234642], [10234643, 11165064], [11165065, 12095486], [12095487, 13025908], [13025909, 13956330], [13956331, 14886752], [14886753, 15817174], [15817175, 16747596], [16747597, 17678018], [17678019, 18608458]] SRR12919390 file size 6302267 SRR12919390 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919390 SRR12919390_1.fastq SRR12919390_2.fastq Input file: SRR12919390_1.fastq Paired file: SRR12919390_2.fastq trimmed: SRR12919390-trimmed-pair1.fastq, SRR12919390-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:47:19 2025 >> started Wed Feb 12 22:47:40 2025 >> done (20.848s) 18608458 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 2957 ( 0.02%) empty read pairs filtered out after trimming by size control 18605475 (99.98%) read pairs available; of these: 1729922 ( 9.30%) trimmed read pairs available after processing 16875553 (90.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 6 0.00% 21 5 0.00% 22 3 0.00% 23 2 0.00% 24 10 0.00% 25 5 0.00% 26 14 0.00% 27 10 0.00% 28 10 0.00% 29 12 0.00% 30 10 0.00% 31 13 0.00% 32 17 0.00% 33 25 0.00% 34 18 0.00% 35 14 0.00% 36 19 0.00% 37 11 0.00% 38 19 0.00% 39 17 0.00% 40 24 0.00% 41 25 0.00% 42 23 0.00% 43 21 0.00% 44 24 0.00% 45 28 0.00% 46 26 0.00% 47 29 0.00% 48 31 0.00% 49 44 0.00% 50 39 0.00% 51 41 0.00% 52 49 0.00% 53 52 0.00% 54 39 0.00% 55 55 0.00% 56 65 0.00% 57 65 0.00% 58 94 0.00% 59 93 0.00% 60 129 0.00% 61 129 0.00% 62 166 0.00% 63 171 0.00% 64 196 0.00% 65 207 0.00% 66 270 0.00% 67 266 0.00% 68 298 0.00% 69 346 0.00% 70 434 0.00% 71 501 0.00% 72 610 0.00% 73 649 0.00% 74 762 0.00% 75 788 0.00% 76 895 0.00% 77 1062 0.01% 78 1061 0.01% 79 1285 0.01% 80 1498 0.01% 81 1678 0.01% 82 1978 0.01% 83 2221 0.01% 84 2553 0.01% 85 2771 0.01% 86 3200 0.02% 87 3365 0.02% 88 3644 0.02% 89 4087 0.02% 90 4609 0.02% 91 5173 0.03% 92 5717 0.03% 93 6526 0.04% 94 6849 0.04% 95 7676 0.04% 96 8152 0.04% 97 8762 0.05% 98 9288 0.05% 99 9972 0.05% 100 10665 0.06% 101 11148 0.06% 102 12143 0.07% 103 13409 0.07% 104 14010 0.08% 105 15017 0.08% 106 15786 0.08% 107 16344 0.09% 108 17335 0.09% 109 18024 0.10% 110 18252 0.10% 111 19209 0.10% 112 20351 0.11% 113 21263 0.11% 114 22339 0.12% 115 23631 0.13% 116 24382 0.13% 117 25389 0.14% 118 26140 0.14% 119 26171 0.14% 120 27304 0.15% 121 27991 0.15% 122 28934 0.16% 123 30090 0.16% 124 31582 0.17% 125 32235 0.17% 126 33936 0.18% 127 34351 0.18% 128 34607 0.19% 129 35101 0.19% 130 36545 0.20% 131 36587 0.20% 132 37747 0.20% 133 38435 0.21% 134 39835 0.21% 135 40647 0.22% 136 41807 0.22% 137 42251 0.23% 138 43019 0.23% 139 43569 0.23% 140 44216 0.24% 141 44805 0.24% 142 46028 0.25% 143 46218 0.25% 144 47653 0.26% 145 48987 0.26% 146 49327 0.27% 147 50112 0.27% 148 50842 0.27% 149 50898 0.27% 150 52196 0.28% 151 16875553 90.70% 18605475 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=8.14 fanout-score-rank=17 prefix-density=0.36 prefix-fanout=4.1 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=89.11 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=17.6 sequence=CCTTCTTCACAAT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=35 prefix-density=0.23 prefix-fanout=2.3 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=378.10 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=32.7 sequence=AAGAAGAAGAAA SRR12919390 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:48:22 Started mapping on | Feb 12 22:48:23 Finished on | Feb 12 22:50:58 Mapping speed, Million of reads per hour | 432.13 Number of input reads | 18605475 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17191081 Uniquely mapped reads % | 92.40% Average mapped length | 296.50 Number of splices: Total | 16336541 Number of splices: Annotated (sjdb) | 15969242 Number of splices: GT/AG | 16034610 Number of splices: GC/AG | 236336 Number of splices: AT/AC | 18196 Number of splices: Non-canonical | 47399 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 457972 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 56227 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.71% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 956422 956422 956422 N_multimapping 457972 457972 457972 N_noFeature 596930 17001020 683669 N_ambiguous 202776 975 98892 UnstrandedReadsAssigned:16391375 PositiveStrandReadsAssigned:189086 NegativeStrandReadsAssigned:16408520 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919390 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919390-trimmed-pair1.fastq SRR12919390-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,605,475 reads, 16,444,868 reads pseudoaligned [quant] estimated average fragment length: 269.716 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR12919390.ke.tsv 34699 SRR12919390.se.tsv 87100 total ==> SRR12919390.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.28 731 25.7244 Potri.005G024800.1.v4.1 1035 766.284 149 11.9697 Potri.004G059700.1.v4.1 961 692.432 56 4.97849 Potri.007G009000.2.v4.1 1416 1147.28 0 0 Potri.003G141000.2.v4.1 2943 2674.28 619.154 14.2521 Potri.016G087400.1.v4.1 270 82.4588 1391 1038.43 Potri.015G069301.1.v4.1 564 311.584 0 0 Potri.010G195200.1.v4.1 1773 1504.28 104 4.2559 Potri.012G127500.1.v4.1 977 708.364 11588 1007.02 ==> SRR12919390.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 157 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 37 SRR12919390 completed mapping pipeline successfully