Starting /dee2/code/volunteer_pipeline.sh SRR12919391 current disk space = 3050570797056 free memory = 1415132736 SRR12919391 SRAfilesize f51982d61e806c33165acedc86a292a3 SRR12919391.sra SRR12919391.sra file validated SRR12919391 is paired end SRR12919391 is conventional basespace SRR12919391 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919391_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5845 37.0 37.0 37.0 37.0 37.0 2 36.4385 37.0 37.0 37.0 37.0 37.0 3 36.632 37.0 37.0 37.0 37.0 37.0 4 36.639 37.0 37.0 37.0 37.0 37.0 5 36.627 37.0 37.0 37.0 37.0 37.0 6 36.7 37.0 37.0 37.0 37.0 37.0 7 36.603 37.0 37.0 37.0 37.0 37.0 8 36.67 37.0 37.0 37.0 37.0 37.0 9 36.715 37.0 37.0 37.0 37.0 37.0 10-14 36.6387 37.0 37.0 37.0 37.0 37.0 15-19 36.612 37.0 37.0 37.0 37.0 37.0 20-24 36.6078 37.0 37.0 37.0 37.0 37.0 25-29 36.6066 37.0 37.0 37.0 37.0 37.0 30-34 36.591699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.5677 37.0 37.0 37.0 37.0 37.0 40-44 36.5348 37.0 37.0 37.0 37.0 37.0 45-49 36.5243 37.0 37.0 37.0 37.0 37.0 50-54 36.5108 37.0 37.0 37.0 37.0 37.0 55-59 36.4765 37.0 37.0 37.0 37.0 37.0 60-64 36.4567 37.0 37.0 37.0 37.0 37.0 65-69 36.4454 37.0 37.0 37.0 37.0 37.0 70-74 36.4048 37.0 37.0 37.0 37.0 37.0 75-79 36.372 37.0 37.0 37.0 37.0 37.0 80-84 36.3811 37.0 37.0 37.0 37.0 37.0 85-89 36.3163 37.0 37.0 37.0 37.0 37.0 90-94 36.3091 37.0 37.0 37.0 37.0 37.0 95-99 36.25019999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2628 37.0 37.0 37.0 37.0 37.0 105-109 36.19689999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1961 37.0 37.0 37.0 37.0 37.0 115-119 36.1869 37.0 37.0 37.0 37.0 37.0 120-124 36.1226 37.0 37.0 37.0 37.0 37.0 125-129 36.0031 37.0 37.0 37.0 37.0 37.0 130-134 36.063599999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.938100000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.876 37.0 37.0 37.0 37.0 37.0 145-149 35.8277 37.0 37.0 37.0 37.0 37.0 150-151 35.657 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 4.0 25 0.0 26 4.0 27 6.0 28 8.0 29 15.0 30 10.0 31 36.0 32 36.0 33 64.0 34 106.0 35 265.0 36 3011.0 37 430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.949999999999996 12.7 8.1 44.25 2 19.7592778335005 13.615847542627884 37.487462387161486 29.13741223671013 3 16.825000000000003 17.05 26.875 39.25 4 20.1 24.85 24.775 30.275000000000002 5 22.975 30.85 24.474999999999998 21.7 6 20.175 35.099999999999994 24.05 20.674999999999997 7 15.675 26.875 41.25 16.2 8 17.775 26.950000000000003 31.55 23.724999999999998 9 16.85 24.25 35.4 23.5 10-14 19.470000000000002 30.680000000000003 27.24 22.61 15-19 19.7 28.365000000000002 27.944999999999997 23.990000000000002 20-24 19.18 28.945 28.01 23.865 25-29 19.78 28.425 27.825 23.97 30-34 19.400000000000002 28.48 27.91 24.21 35-39 19.84 28.825 27.825 23.51 40-44 19.755 28.7 28.03 23.515 45-49 20.525 28.854999999999997 27.18 23.44 50-54 19.73 28.395 27.79 24.085 55-59 20.465 27.694999999999997 28.27 23.57 60-64 20.14 28.59 26.82 24.45 65-69 19.98 27.42 27.694999999999997 24.905 70-74 20.48 28.52 28.04 22.96 75-79 20.305 28.405 27.715 23.575 80-84 20.380000000000003 28.060000000000002 28.38 23.18 85-89 20.275000000000002 28.4 27.61 23.715 90-94 20.31 28.044999999999998 27.55 24.095 95-99 20.169999999999998 28.615000000000002 27.605 23.61 100-104 20.62 28.299999999999997 27.55 23.53 105-109 20.3 28.744999999999997 27.215 23.74 110-114 20.29 28.63 27.375 23.705000000000002 115-119 20.165 28.02 27.925 23.89 120-124 20.28 28.18 27.36 24.18 125-129 20.535 29.104999999999997 26.784999999999997 23.575 130-134 20.71 27.73 27.765 23.794999999999998 135-139 20.599999999999998 28.325 27.325 23.75 140-144 20.465 28.15 27.47 23.915 145-149 20.745 27.99 26.889999999999997 24.375 150-151 20.200000000000003 27.5625 27.462500000000002 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 2.0 26 4.5 27 7.5 28 8.0 29 9.5 30 17.5 31 24.0 32 27.0 33 41.0 34 55.0 35 68.5 36 90.5 37 102.5 38 121.5 39 164.5 40 191.5 41 217.0 42 241.5 43 255.0 44 271.5 45 282.5 46 282.0 47 270.0 48 263.0 49 213.5 50 170.0 51 150.0 52 106.5 53 75.5 54 64.0 55 50.5 56 34.0 57 25.0 58 19.5 59 18.0 60 14.0 61 12.5 62 9.0 63 4.0 64 5.0 65 3.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.95 #Duplication Level Percentage of deduplicated Percentage of total 1 91.4238592633315 83.15 2 7.531610775151182 13.700000000000001 3 0.8246289169873556 2.25 4 0.19241341396371633 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027487630566245192 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAGTGTCCCGCTATGGAACCTTCTGCCCGCAATGTCAACAGAAGAGT 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 4.074999999999999 0.0 0.0 0.0 0.0 126-127 4.550000000000001 0.0 0.0 0.0 0.0 128-129 5.0 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 6.05 0.0 0.0 0.0 0.0 134-135 6.5875 0.0 0.0 0.0 0.0 136-137 7.1 0.0 0.0 0.0 0.0 138-139 7.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919391 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919391_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.463 37.0 37.0 37.0 37.0 37.0 2 36.273 37.0 37.0 37.0 37.0 37.0 3 36.283 37.0 37.0 37.0 37.0 37.0 4 36.3525 37.0 37.0 37.0 37.0 37.0 5 36.4385 37.0 37.0 37.0 37.0 37.0 6 36.266 37.0 37.0 37.0 37.0 37.0 7 36.262 37.0 37.0 37.0 37.0 37.0 8 36.3675 37.0 37.0 37.0 37.0 37.0 9 36.4525 37.0 37.0 37.0 37.0 37.0 10-14 36.3971 37.0 37.0 37.0 37.0 37.0 15-19 36.3719 37.0 37.0 37.0 37.0 37.0 20-24 36.3977 37.0 37.0 37.0 37.0 37.0 25-29 36.3304 37.0 37.0 37.0 37.0 37.0 30-34 36.3057 37.0 37.0 37.0 37.0 37.0 35-39 36.273199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.2412 37.0 37.0 37.0 37.0 37.0 45-49 36.1967 37.0 37.0 37.0 37.0 37.0 50-54 36.171800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.206100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.1492 37.0 37.0 37.0 37.0 37.0 65-69 36.2195 37.0 37.0 37.0 37.0 37.0 70-74 36.143100000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.0713 37.0 37.0 37.0 37.0 37.0 80-84 36.0955 37.0 37.0 37.0 37.0 37.0 85-89 36.0219 37.0 37.0 37.0 37.0 37.0 90-94 36.0267 37.0 37.0 37.0 37.0 37.0 95-99 36.0157 37.0 37.0 37.0 37.0 37.0 100-104 35.96339999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.9065 37.0 37.0 37.0 37.0 37.0 110-114 35.8934 37.0 37.0 37.0 37.0 37.0 115-119 35.8765 37.0 37.0 37.0 37.0 37.0 120-124 35.785700000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.7518 37.0 37.0 37.0 37.0 37.0 130-134 35.7234 37.0 37.0 37.0 37.0 37.0 135-139 35.561099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.5031 37.0 37.0 37.0 37.0 37.0 145-149 35.40239999999999 37.0 37.0 37.0 34.6 37.0 150-151 35.204 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 0.0 17 2.0 18 1.0 19 1.0 20 0.0 21 2.0 22 2.0 23 8.0 24 4.0 25 5.0 26 6.0 27 7.0 28 3.0 29 15.0 30 24.0 31 32.0 32 47.0 33 93.0 34 168.0 35 522.0 36 2801.0 37 253.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.325 24.4 11.675 28.599999999999998 2 26.474999999999998 26.55 31.5 15.475 3 19.825 29.025000000000002 31.874999999999996 19.275000000000002 4 21.7 34.475 23.775 20.05 5 24.175 36.199999999999996 22.35 17.275 6 21.55 37.15 24.05 17.25 7 20.575 21.475 38.15 19.8 8 21.15 25.8 29.599999999999998 23.45 9 21.325 25.55 30.9 22.225 10-14 23.145 29.160000000000004 26.974999999999998 20.72 15-19 23.46 27.845 27.73 20.965 20-24 23.369999999999997 28.925 27.375 20.330000000000002 25-29 23.315 27.950000000000003 27.77 20.965 30-34 23.26 28.255000000000003 27.61 20.875 35-39 22.875 29.24 27.46 20.424999999999997 40-44 22.994999999999997 28.34 27.85 20.815 45-49 23.549999999999997 28.51 27.68 20.26 50-54 23.47 28.810000000000002 27.339999999999996 20.380000000000003 55-59 23.330000000000002 28.4 27.675 20.595 60-64 23.555 27.425 28.38 20.64 65-69 24.38 28.01 27.725 19.885 70-74 23.23 28.93 27.794999999999998 20.044999999999998 75-79 23.380000000000003 28.005000000000003 27.639999999999997 20.974999999999998 80-84 23.03 28.205000000000002 27.76 21.005 85-89 23.565 27.61 28.565 20.26 90-94 24.2 27.834999999999997 27.389999999999997 20.575 95-99 23.945 27.810000000000002 27.74 20.505000000000003 100-104 24.38 27.375 27.625 20.62 105-109 24.265 27.72 27.92 20.095 110-114 24.015 27.685 27.92 20.380000000000003 115-119 24.245 28.244999999999997 27.38 20.13 120-124 24.33 28.675 26.705000000000002 20.29 125-129 24.395 28.439999999999998 27.279999999999998 19.885 130-134 24.93 28.43 26.72 19.919999999999998 135-139 25.3 27.889999999999997 27.105 19.705000000000002 140-144 25.275 28.4 26.845000000000002 19.48 145-149 26.235000000000003 27.750000000000004 26.895000000000003 19.12 150-151 25.887500000000003 27.875 26.974999999999998 19.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 4.0 26 5.5 27 9.0 28 9.0 29 5.0 30 9.0 31 20.5 32 29.5 33 30.0 34 40.5 35 59.5 36 81.0 37 110.5 38 146.0 39 191.0 40 212.5 41 223.0 42 270.5 43 277.0 44 286.5 45 302.0 46 268.5 47 246.0 48 218.0 49 184.5 50 158.0 51 135.0 52 108.0 53 81.5 54 62.5 55 47.5 56 37.5 57 28.5 58 18.5 59 16.0 60 14.5 61 10.0 62 7.0 63 5.5 64 5.0 65 2.5 66 1.5 67 3.0 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.66209544706527 83.55 2 7.3230938014262215 13.350000000000001 3 0.8228195282501372 2.25 4 0.16456390565002743 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027427317608337907 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAGTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTA 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.7625000000000002 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.6625 0.0 0.0 0.0 0.0 124-125 4.074999999999999 0.0 0.0 0.0 0.0 126-127 4.550000000000001 0.0 0.0 0.0 0.0 128-129 5.0 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 6.05 0.0 0.0 0.0 0.0 134-135 6.6 0.0 0.0 0.0 0.0 136-137 7.15 0.0 0.0 0.0 0.0 138-139 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838791 spots for SRR12919391.sra Written 838791 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra Read 838783 spots for SRR12919391.sra Written 838783 spots for SRR12919391.sra SRR ids: ['SRR12919391.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x81rpws_ SRR12919391.sra spots: 16775668 blocks: [[1, 838783], [838784, 1677566], [1677567, 2516349], [2516350, 3355132], [3355133, 4193915], [4193916, 5032698], [5032699, 5871481], [5871482, 6710264], [6710265, 7549047], [7549048, 8387830], [8387831, 9226613], [9226614, 10065396], [10065397, 10904179], [10904180, 11742962], [11742963, 12581745], [12581746, 13420528], [13420529, 14259311], [14259312, 15098094], [15098095, 15936877], [15936878, 16775668]] SRR12919391 file size 5679405 SRR12919391 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919391 SRR12919391_1.fastq SRR12919391_2.fastq Input file: SRR12919391_1.fastq Paired file: SRR12919391_2.fastq trimmed: SRR12919391-trimmed-pair1.fastq, SRR12919391-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:12:55 2025 >> started Wed Feb 12 22:13:23 2025 >> done (28.042s) 16775668 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 129 ( 0.00%) empty read pairs filtered out after trimming by size control 16775523 (100.00%) read pairs available; of these: 2177934 (12.98%) trimmed read pairs available after processing 14597589 (87.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 11 0.00% 25 7 0.00% 26 7 0.00% 27 4 0.00% 28 5 0.00% 29 10 0.00% 30 11 0.00% 31 12 0.00% 32 11 0.00% 33 12 0.00% 34 12 0.00% 35 15 0.00% 36 13 0.00% 37 5 0.00% 38 14 0.00% 39 10 0.00% 40 19 0.00% 41 32 0.00% 42 28 0.00% 43 28 0.00% 44 28 0.00% 45 25 0.00% 46 34 0.00% 47 40 0.00% 48 61 0.00% 49 65 0.00% 50 66 0.00% 51 90 0.00% 52 100 0.00% 53 107 0.00% 54 110 0.00% 55 121 0.00% 56 145 0.00% 57 167 0.00% 58 152 0.00% 59 201 0.00% 60 270 0.00% 61 332 0.00% 62 369 0.00% 63 416 0.00% 64 441 0.00% 65 444 0.00% 66 539 0.00% 67 673 0.00% 68 673 0.00% 69 780 0.00% 70 940 0.01% 71 1100 0.01% 72 1294 0.01% 73 1576 0.01% 74 1722 0.01% 75 1955 0.01% 76 2089 0.01% 77 2187 0.01% 78 2521 0.02% 79 2897 0.02% 80 3246 0.02% 81 3727 0.02% 82 4383 0.03% 83 4681 0.03% 84 5542 0.03% 85 5781 0.03% 86 6360 0.04% 87 6815 0.04% 88 7178 0.04% 89 7455 0.04% 90 8376 0.05% 91 9442 0.06% 92 10317 0.06% 93 11046 0.07% 94 12592 0.08% 95 13607 0.08% 96 13900 0.08% 97 14511 0.09% 98 15163 0.09% 99 16230 0.10% 100 17003 0.10% 101 17617 0.11% 102 19059 0.11% 103 20479 0.12% 104 21810 0.13% 105 22809 0.14% 106 23892 0.14% 107 24334 0.15% 108 25324 0.15% 109 25627 0.15% 110 25745 0.15% 111 26499 0.16% 112 28558 0.17% 113 28903 0.17% 114 31135 0.19% 115 32324 0.19% 116 32755 0.20% 117 33502 0.20% 118 34602 0.21% 119 34256 0.20% 120 34887 0.21% 121 35736 0.21% 122 36004 0.21% 123 37451 0.22% 124 38937 0.23% 125 40249 0.24% 126 41440 0.25% 127 41959 0.25% 128 42245 0.25% 129 42746 0.25% 130 43351 0.26% 131 43791 0.26% 132 44835 0.27% 133 45556 0.27% 134 45371 0.27% 135 47562 0.28% 136 48547 0.29% 137 48986 0.29% 138 49879 0.30% 139 50159 0.30% 140 50357 0.30% 141 50496 0.30% 142 51530 0.31% 143 51322 0.31% 144 53057 0.32% 145 54059 0.32% 146 55042 0.33% 147 55042 0.33% 148 55335 0.33% 149 54744 0.33% 150 55656 0.33% 151 14597589 87.02% 16775523 reads passed initial QC criterion=sequence-density sequence-density=1.55 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=29 prefix-density=1.53 prefix-fanout=2.0 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.19 sequence-density-rank=32 fanout-score=14.24 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=4.2 sequence=TCTTCTCATCAAGGCTTCCAGAACTTCCAAAGAAGATGATTCCGGAAGTACGAAATCTAAGCAAGAGAATTTGCACAGCTGTAGCCACATTTACTGAGTGACTCCCGGTCTTAACATATATAATAAGGCTATTGTTAAGTGTTCCAATATGGAACCTT criterion=sequence-density sequence-density=1.29 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=32 prefix-density=1.28 prefix-fanout=2.0 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTCAGATAAATGCCTGCCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=64.85 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=1.3 sequence=GTTGCATTTCTAAAGTACTATCCGTCTGCTCAATCCACTTCACACAATGTCGAGTATCAATTTGGCA SRR12919391 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:14:17 Started mapping on | Feb 12 22:14:18 Finished on | Feb 12 22:17:18 Mapping speed, Million of reads per hour | 335.51 Number of input reads | 16775523 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15258967 Uniquely mapped reads % | 90.96% Average mapped length | 294.09 Number of splices: Total | 15006449 Number of splices: Annotated (sjdb) | 14646527 Number of splices: GT/AG | 14756811 Number of splices: GC/AG | 194553 Number of splices: AT/AC | 14650 Number of splices: Non-canonical | 40435 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505291 % of reads mapped to multiple loci | 3.01% Number of reads mapped to too many loci | 65342 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.50% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1011265 1011265 1011265 N_multimapping 505291 505291 505291 N_noFeature 477192 15102762 546497 N_ambiguous 220853 1065 133221 UnstrandedReadsAssigned:14560922 PositiveStrandReadsAssigned:155140 NegativeStrandReadsAssigned:14579249 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919391 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919391-trimmed-pair1.fastq SRR12919391-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,775,523 reads, 14,601,676 reads pseudoaligned [quant] estimated average fragment length: 249.944 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52401 SRR12919391.ke.tsv 34699 SRR12919391.se.tsv 87100 total ==> SRR12919391.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.06 781 30.3176 Potri.005G024800.1.v4.1 1035 786.056 286 24.9861 Potri.004G059700.1.v4.1 961 712.098 6 0.578626 Potri.007G009000.2.v4.1 1416 1167.06 0 0 Potri.003G141000.2.v4.1 2943 2694.06 449 11.4453 Potri.016G087400.1.v4.1 270 89.9599 1032 787.801 Potri.015G069301.1.v4.1 564 325.553 0 0 Potri.010G195200.1.v4.1 1773 1524.06 138 6.21819 Potri.012G127500.1.v4.1 977 728.08 1651 155.723 ==> SRR12919391.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 243 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 159 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 195 SRR12919391 completed mapping pipeline successfully