Starting /dee2/code/volunteer_pipeline.sh SRR12919392 current disk space = 3050458415104 free memory = 1576827040 SRR12919392 SRAfilesize 2a40eed45c5ed80d91b4ec04cd6cbb2b SRR12919392.sra SRR12919392.sra file validated SRR12919392 is paired end SRR12919392 is conventional basespace SRR12919392 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919392_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5505 37.0 37.0 37.0 37.0 37.0 2 36.1655 37.0 37.0 37.0 37.0 37.0 3 36.513 37.0 37.0 37.0 37.0 37.0 4 36.611 37.0 37.0 37.0 37.0 37.0 5 36.655 37.0 37.0 37.0 37.0 37.0 6 36.6695 37.0 37.0 37.0 37.0 37.0 7 36.59 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.6205 37.0 37.0 37.0 37.0 37.0 10-14 36.650999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.629 37.0 37.0 37.0 37.0 37.0 20-24 36.6212 37.0 37.0 37.0 37.0 37.0 25-29 36.5564 37.0 37.0 37.0 37.0 37.0 30-34 36.532 37.0 37.0 37.0 37.0 37.0 35-39 36.472699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.5311 37.0 37.0 37.0 37.0 37.0 45-49 36.478 37.0 37.0 37.0 37.0 37.0 50-54 36.4894 37.0 37.0 37.0 37.0 37.0 55-59 36.417199999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.4042 37.0 37.0 37.0 37.0 37.0 65-69 36.4116 37.0 37.0 37.0 37.0 37.0 70-74 36.3494 37.0 37.0 37.0 37.0 37.0 75-79 36.342600000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3326 37.0 37.0 37.0 37.0 37.0 85-89 36.25600000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.243900000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.211499999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1799 37.0 37.0 37.0 37.0 37.0 105-109 36.1424 37.0 37.0 37.0 37.0 37.0 110-114 36.087199999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.120599999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.045500000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.996300000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.899499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.869600000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7654 37.0 37.0 37.0 37.0 37.0 145-149 35.727500000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.617 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 1.0 25 3.0 26 4.0 27 8.0 28 5.0 29 12.0 30 13.0 31 37.0 32 33.0 33 89.0 34 121.0 35 323.0 36 2970.0 37 378.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.8 15.375 5.2749999999999995 36.55 2 18.463476070528966 13.904282115869018 39.67254408060453 27.95969773299748 3 16.05 19.25 31.0 33.7 4 21.2 25.724999999999998 25.575 27.500000000000004 5 22.125 32.175 24.425 21.275 6 20.150000000000002 35.325 23.799999999999997 20.724999999999998 7 14.274999999999999 26.900000000000002 41.5 17.325 8 17.275 25.424999999999997 31.874999999999996 25.424999999999997 9 16.525000000000002 24.65 35.575 23.25 10-14 20.125 29.17 26.99 23.715 15-19 19.72 28.265 27.905 24.11 20-24 20.25 28.455000000000002 27.725 23.57 25-29 19.915 28.744999999999997 27.925 23.415 30-34 19.7 28.225 28.34 23.735 35-39 19.765 28.305000000000003 27.744999999999997 24.185000000000002 40-44 20.26 28.82 27.694999999999997 23.225 45-49 19.845 28.605000000000004 27.845 23.705000000000002 50-54 20.565 28.134999999999998 28.065 23.235 55-59 20.415 27.950000000000003 27.615000000000002 24.02 60-64 20.055 28.21 27.965 23.77 65-69 20.23 28.465 27.3 24.005000000000003 70-74 20.16 28.865000000000002 27.18 23.794999999999998 75-79 20.13 28.12 28.09 23.66 80-84 20.44 27.615000000000002 28.03 23.915 85-89 20.474999999999998 27.944999999999997 28.105000000000004 23.474999999999998 90-94 20.115 28.904999999999998 27.775 23.205000000000002 95-99 20.54 27.939999999999998 27.58 23.94 100-104 19.99 28.62 27.185 24.205 105-109 20.455000000000002 28.694999999999997 27.205000000000002 23.645 110-114 20.75 27.575 27.93 23.745 115-119 20.775 28.59 27.12 23.515 120-124 20.685000000000002 28.075 27.07 24.169999999999998 125-129 21.02 27.57 27.13 24.279999999999998 130-134 20.69 27.779999999999998 27.224999999999998 24.305 135-139 21.154999999999998 27.615000000000002 27.29 23.94 140-144 21.115000000000002 27.189999999999998 27.555000000000003 24.14 145-149 20.745 27.884999999999998 27.584999999999997 23.785 150-151 20.724999999999998 27.3875 26.775 25.112499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 3.0 26 6.5 27 6.5 28 9.0 29 16.0 30 19.0 31 22.5 32 29.5 33 39.0 34 50.0 35 75.5 36 99.0 37 106.0 38 132.0 39 163.5 40 182.5 41 220.5 42 241.0 43 267.0 44 281.0 45 259.0 46 265.0 47 266.0 48 228.5 49 184.5 50 157.5 51 138.0 52 123.5 53 96.0 54 73.0 55 57.5 56 42.5 57 37.0 58 28.5 59 18.5 60 12.5 61 11.5 62 9.0 63 5.0 64 3.5 65 3.5 66 2.0 67 1.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.69407894736842 83.625 2 7.319078947368421 13.350000000000001 3 0.7675438596491228 2.1 4 0.1644736842105263 0.6 5 0.0 0.0 6 0.027412280701754384 0.15 7 0.027412280701754384 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATTGTTGAGTGGTGGTTTCGGTTATCTTGTGAGGTGGGTTTTGGGTTT 7 0.17500000000000002 No Hit GTTAACCTTGTCAGGGCATTGCTGGCAATAGCCAATCTTGTACTGCGGAG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.3375000000000004 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.4 0.0 0.0 0.0 0.0 120-121 3.8375000000000004 0.0 0.0 0.0 0.0 122-123 4.0875 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.824999999999999 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.824999999999999 0.0 0.0 0.0 0.0 132-133 6.1375 0.0 0.0 0.0 0.0 134-135 6.612500000000001 0.0 0.0 0.0 0.0 136-137 7.0625 0.0 0.0 0.0 0.0 138-139 7.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATCAC 10 0.006830828 145.0 5 >>END_MODULE SRR12919392 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919392_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.081 37.0 37.0 37.0 37.0 37.0 2 36.2065 37.0 37.0 37.0 37.0 37.0 3 36.2155 37.0 37.0 37.0 37.0 37.0 4 36.3015 37.0 37.0 37.0 37.0 37.0 5 36.302 37.0 37.0 37.0 37.0 37.0 6 36.261 37.0 37.0 37.0 37.0 37.0 7 36.2795 37.0 37.0 37.0 37.0 37.0 8 36.354 37.0 37.0 37.0 37.0 37.0 9 36.359 37.0 37.0 37.0 37.0 37.0 10-14 36.3155 37.0 37.0 37.0 37.0 37.0 15-19 36.2903 37.0 37.0 37.0 37.0 37.0 20-24 36.2608 37.0 37.0 37.0 37.0 37.0 25-29 36.205799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.16330000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.2154 37.0 37.0 37.0 37.0 37.0 40-44 36.1581 37.0 37.0 37.0 37.0 37.0 45-49 36.1374 37.0 37.0 37.0 37.0 37.0 50-54 36.113299999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.066500000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9911 37.0 37.0 37.0 37.0 37.0 65-69 36.04209999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.9863 37.0 37.0 37.0 37.0 37.0 75-79 35.909499999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.92280000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.89880000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8404 37.0 37.0 37.0 37.0 37.0 95-99 35.9132 37.0 37.0 37.0 37.0 37.0 100-104 35.7958 37.0 37.0 37.0 37.0 37.0 105-109 35.761900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.697900000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6764 37.0 37.0 37.0 37.0 37.0 120-124 35.640600000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.5926 37.0 37.0 37.0 37.0 37.0 130-134 35.488 37.0 37.0 37.0 37.0 37.0 135-139 35.367999999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3283 37.0 37.0 37.0 32.2 37.0 145-149 35.177600000000005 37.0 37.0 37.0 32.2 37.0 150-151 35.05275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 3.0 15 1.0 16 4.0 17 0.0 18 2.0 19 0.0 20 1.0 21 3.0 22 4.0 23 6.0 24 6.0 25 5.0 26 3.0 27 7.0 28 15.0 29 20.0 30 27.0 31 38.0 32 57.0 33 114.0 34 188.0 35 547.0 36 2657.0 37 286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.675000000000004 26.474999999999998 7.249999999999999 24.6 2 26.6 25.174999999999997 32.300000000000004 15.925 3 19.175 27.55 34.35 18.925 4 23.150000000000002 34.599999999999994 23.599999999999998 18.65 5 23.525 37.574999999999996 21.3 17.599999999999998 6 22.35 37.125 22.1 18.425 7 21.275 22.325 37.1 19.3 8 22.325 26.075 27.325 24.275 9 21.325 25.2 30.075000000000003 23.400000000000002 10-14 23.39 29.220000000000002 26.025 21.365000000000002 15-19 22.73 28.275 27.165 21.83 20-24 23.18 28.455000000000002 27.250000000000004 21.115000000000002 25-29 23.225 27.785 27.48 21.51 30-34 22.52 28.544999999999998 27.810000000000002 21.125 35-39 23.61 27.975 27.389999999999997 21.025 40-44 23.044999999999998 28.194999999999997 27.455000000000002 21.305 45-49 23.015 27.345000000000002 28.1 21.54 50-54 22.64 28.57 28.185 20.605 55-59 23.905 27.384999999999998 27.82 20.89 60-64 23.09 28.92 27.589999999999996 20.4 65-69 23.61 28.26 27.905 20.225 70-74 23.9 28.38 26.645000000000003 21.075 75-79 24.255 27.97 27.060000000000002 20.715 80-84 23.695 28.095 27.62 20.59 85-89 23.645 28.389999999999997 27.395000000000003 20.57 90-94 23.865 27.93 27.845 20.36 95-99 23.26 27.665 28.59 20.485 100-104 23.810000000000002 27.839999999999996 27.334999999999997 21.015 105-109 24.27 28.485 26.88 20.365 110-114 23.630000000000003 28.62 27.279999999999998 20.47 115-119 24.88 27.779999999999998 26.91 20.43 120-124 24.555 27.515 27.58 20.349999999999998 125-129 24.285 28.189999999999998 26.900000000000002 20.625 130-134 25.374999999999996 27.245 27.01 20.369999999999997 135-139 25.28 27.74 27.295 19.685 140-144 25.945 27.24 26.995 19.82 145-149 25.845000000000002 27.855 26.22 20.080000000000002 150-151 26.325 27.675 26.55 19.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 1.0 24 0.5 25 3.0 26 4.5 27 6.0 28 9.0 29 9.0 30 12.5 31 22.5 32 25.0 33 30.0 34 44.5 35 60.5 36 73.0 37 95.5 38 131.5 39 179.5 40 202.5 41 214.5 42 262.5 43 271.0 44 272.0 45 289.5 46 268.0 47 249.0 48 223.0 49 200.5 50 193.0 51 147.0 52 113.5 53 97.5 54 61.5 55 39.5 56 33.5 57 31.0 58 25.0 59 16.5 60 16.0 61 12.5 62 7.5 63 8.5 64 7.0 65 4.5 66 3.0 67 1.0 68 0.5 69 0.5 70 1.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.25 #Duplication Level Percentage of deduplicated Percentage of total 1 91.69863013698631 83.675 2 7.3424657534246585 13.4 3 0.7671232876712328 2.1 4 0.136986301369863 0.5 5 0.0 0.0 6 0.0273972602739726 0.15 7 0.0273972602739726 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATCAAAGTATCTTTCTATCAAAACCCTAAAAACAATCCCTGTCACTCTC 7 0.17500000000000002 No Hit CTTCTCTCAAGTTCTCTTTTAAAGCCTCCTCTCTCACTCTCTTTCATCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.0 124-125 4.5 0.0 0.0 0.0 0.0 126-127 4.9375 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.949999999999999 0.0 0.0 0.0 0.0 132-133 6.3 0.0 0.0 0.0 0.0 134-135 6.7875 0.0 0.0 0.0 0.0 136-137 7.225 0.0 0.0 0.0 0.0 138-139 7.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTACAA 10 0.006830828 145.0 5 TCCGATT 10 0.006830828 145.0 7 >>END_MODULE Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142701 spots for SRR12919392.sra Written 1142701 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra Read 1142696 spots for SRR12919392.sra Written 1142696 spots for SRR12919392.sra SRR ids: ['SRR12919392.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rn4l5yp6 SRR12919392.sra spots: 22853925 blocks: [[1, 1142696], [1142697, 2285392], [2285393, 3428088], [3428089, 4570784], [4570785, 5713480], [5713481, 6856176], [6856177, 7998872], [7998873, 9141568], [9141569, 10284264], [10284265, 11426960], [11426961, 12569656], [12569657, 13712352], [13712353, 14855048], [14855049, 15997744], [15997745, 17140440], [17140441, 18283136], [18283137, 19425832], [19425833, 20568528], [20568529, 21711224], [21711225, 22853925]] SRR12919392 file size 7745063 SRR12919392 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919392 SRR12919392_1.fastq SRR12919392_2.fastq Input file: SRR12919392_1.fastq Paired file: SRR12919392_2.fastq trimmed: SRR12919392-trimmed-pair1.fastq, SRR12919392-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 23:46:56 2025 >> started Wed Feb 12 23:55:09 2025 >> done (493.372s) 22853925 read pairs processed; of these: 48 ( 0.00%) short read pairs filtered out after trimming by size control 419 ( 0.00%) empty read pairs filtered out after trimming by size control 22853458 (100.00%) read pairs available; of these: 2533798 (11.09%) trimmed read pairs available after processing 20319660 (88.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 10 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 8 0.00% 24 16 0.00% 25 6 0.00% 26 16 0.00% 27 20 0.00% 28 8 0.00% 29 18 0.00% 30 23 0.00% 31 19 0.00% 32 16 0.00% 33 21 0.00% 34 18 0.00% 35 19 0.00% 36 22 0.00% 37 25 0.00% 38 28 0.00% 39 33 0.00% 40 33 0.00% 41 43 0.00% 42 47 0.00% 43 47 0.00% 44 37 0.00% 45 45 0.00% 46 40 0.00% 47 47 0.00% 48 66 0.00% 49 78 0.00% 50 81 0.00% 51 87 0.00% 52 101 0.00% 53 124 0.00% 54 100 0.00% 55 143 0.00% 56 151 0.00% 57 172 0.00% 58 224 0.00% 59 236 0.00% 60 271 0.00% 61 368 0.00% 62 394 0.00% 63 444 0.00% 64 432 0.00% 65 484 0.00% 66 487 0.00% 67 548 0.00% 68 645 0.00% 69 802 0.00% 70 934 0.00% 71 1125 0.00% 72 1371 0.01% 73 1571 0.01% 74 1768 0.01% 75 1965 0.01% 76 2049 0.01% 77 2134 0.01% 78 2293 0.01% 79 2743 0.01% 80 3120 0.01% 81 3861 0.02% 82 4520 0.02% 83 5110 0.02% 84 5620 0.02% 85 6173 0.03% 86 6320 0.03% 87 6628 0.03% 88 7097 0.03% 89 7608 0.03% 90 8375 0.04% 91 9638 0.04% 92 10906 0.05% 93 12282 0.05% 94 13463 0.06% 95 14171 0.06% 96 15037 0.07% 97 15476 0.07% 98 15397 0.07% 99 16363 0.07% 100 17314 0.08% 101 18590 0.08% 102 20265 0.09% 103 22720 0.10% 104 24447 0.11% 105 25565 0.11% 106 26431 0.12% 107 26126 0.11% 108 26818 0.12% 109 26973 0.12% 110 27398 0.12% 111 29074 0.13% 112 31361 0.14% 113 33505 0.15% 114 35385 0.15% 115 37320 0.16% 116 37809 0.17% 117 38030 0.17% 118 38574 0.17% 119 37720 0.17% 120 38177 0.17% 121 39403 0.17% 122 41249 0.18% 123 43952 0.19% 124 46338 0.20% 125 48015 0.21% 126 49765 0.22% 127 50099 0.22% 128 48958 0.21% 129 49390 0.22% 130 49647 0.22% 131 49757 0.22% 132 51823 0.23% 133 54514 0.24% 134 56169 0.25% 135 58417 0.26% 136 59906 0.26% 137 60535 0.26% 138 59979 0.26% 139 60003 0.26% 140 59145 0.26% 141 59704 0.26% 142 61464 0.27% 143 62985 0.28% 144 66185 0.29% 145 68100 0.30% 146 69384 0.30% 147 69850 0.31% 148 69647 0.30% 149 68849 0.30% 150 68728 0.30% 151 20319660 88.91% 22853458 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=2.4 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=343.98 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=33.8 sequence=CTTCTTCTTGAG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=28 prefix-density=0.28 prefix-fanout=2.5 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=66.00 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.3 sequence=CAAAGCAGTTGCATTTATCTAAAGTATTGTCACTTTACTTAACACTTGAGCTGCATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTACCTCTGATGTCAACGAAAGGGCTCTGCAAGACTCTGGACTCTATAGCCCTGACAGTGAAGACTCTTCTGTTGACATTGCGGGCAGAAGGTTCCATAGCGGGACACTAAACGGTTCTTCTATTGTATATGTCAAGACAGGGAGTCCTTCAGTAAATATGGCAACAACTTTGCAAATCCTTTTAGCTAGATTCAGCATTCACGGAGTCATCTATTTTGGGAATGCTGGAAGCTTGGATAAGAAAACAATGGTTCCAGGTGATGTTTCTGTGCCGCAGGCTGTTGCCTTCACAGGAGTTTGGAA SRR12919392 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 00:07:38 Started mapping on | Feb 13 00:07:54 Finished on | Feb 13 00:44:28 Mapping speed, Million of reads per hour | 37.50 Number of input reads | 22853458 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20754228 Uniquely mapped reads % | 90.81% Average mapped length | 295.39 Number of splices: Total | 19702253 Number of splices: Annotated (sjdb) | 19233571 Number of splices: GT/AG | 19337119 Number of splices: GC/AG | 284225 Number of splices: AT/AC | 22198 Number of splices: Non-canonical | 58711 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 566926 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 96428 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.78% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1532304 1532304 1532304 N_multimapping 566926 566926 566926 N_noFeature 723440 20499541 848549 N_ambiguous 255462 1207 125268 UnstrandedReadsAssigned:19775326 PositiveStrandReadsAssigned:253480 NegativeStrandReadsAssigned:19780411 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919392 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919392-trimmed-pair1.fastq SRR12919392-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,853,458 reads, 19,889,025 reads pseudoaligned [quant] estimated average fragment length: 263.149 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR12919392.ke.tsv 34699 SRR12919392.se.tsv 87100 total ==> SRR12919392.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.85 1090 31.5121 Potri.005G024800.1.v4.1 1035 772.851 310 20.3612 Potri.004G059700.1.v4.1 961 699.048 26 1.88801 Potri.007G009000.2.v4.1 1416 1153.85 0 0 Potri.003G141000.2.v4.1 2943 2680.85 656.664 12.4339 Potri.016G087400.1.v4.1 270 86.1316 1382.94 815.041 Potri.015G069301.1.v4.1 564 320.38 0 0 Potri.010G195200.1.v4.1 1773 1510.85 113 3.7966 Potri.012G127500.1.v4.1 977 714.978 10643 755.631 ==> SRR12919392.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 167 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 53 SRR12919392 completed mapping pipeline successfully