Starting /dee2/code/volunteer_pipeline.sh SRR12919393 current disk space = 3050552606720 free memory = 1468320592 SRR12919393 SRAfilesize ff06c6b4000c1b2ea6e71fb749d893e7 SRR12919393.sra SRR12919393.sra file validated SRR12919393 is paired end SRR12919393 is conventional basespace SRR12919393 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919393_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5135 37.0 37.0 37.0 37.0 37.0 2 36.357 37.0 37.0 37.0 37.0 37.0 3 36.5535 37.0 37.0 37.0 37.0 37.0 4 36.5845 37.0 37.0 37.0 37.0 37.0 5 36.672 37.0 37.0 37.0 37.0 37.0 6 36.635 37.0 37.0 37.0 37.0 37.0 7 36.639 37.0 37.0 37.0 37.0 37.0 8 36.637 37.0 37.0 37.0 37.0 37.0 9 36.6175 37.0 37.0 37.0 37.0 37.0 10-14 36.6645 37.0 37.0 37.0 37.0 37.0 15-19 36.6437 37.0 37.0 37.0 37.0 37.0 20-24 36.6322 37.0 37.0 37.0 37.0 37.0 25-29 36.5579 37.0 37.0 37.0 37.0 37.0 30-34 36.517700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.558 37.0 37.0 37.0 37.0 37.0 40-44 36.5528 37.0 37.0 37.0 37.0 37.0 45-49 36.52929999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.47279999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.4723 37.0 37.0 37.0 37.0 37.0 60-64 36.44799999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.4194 37.0 37.0 37.0 37.0 37.0 70-74 36.42549999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3618 37.0 37.0 37.0 37.0 37.0 80-84 36.3822 37.0 37.0 37.0 37.0 37.0 85-89 36.32899999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2211 37.0 37.0 37.0 37.0 37.0 95-99 36.2476 37.0 37.0 37.0 37.0 37.0 100-104 36.238 37.0 37.0 37.0 37.0 37.0 105-109 36.171200000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.1096 37.0 37.0 37.0 37.0 37.0 115-119 36.1601 37.0 37.0 37.0 37.0 37.0 120-124 36.153200000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.0202 37.0 37.0 37.0 37.0 37.0 130-134 36.0247 37.0 37.0 37.0 37.0 37.0 135-139 35.947 37.0 37.0 37.0 37.0 37.0 140-144 35.8494 37.0 37.0 37.0 37.0 37.0 145-149 35.7573 37.0 37.0 37.0 37.0 37.0 150-151 35.60925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 1.0 26 0.0 27 2.0 28 10.0 29 9.0 30 25.0 31 28.0 32 46.0 33 60.0 34 119.0 35 335.0 36 2960.0 37 401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.6 13.625000000000002 5.825 35.949999999999996 2 19.954819277108435 13.152610441767068 35.54216867469879 31.350401606425706 3 17.424999999999997 16.875 28.175 37.525 4 22.2 25.924999999999997 23.474999999999998 28.4 5 20.9 32.5 25.374999999999996 21.224999999999998 6 21.175 33.75 23.25 21.825 7 15.45 26.625 40.150000000000006 17.775 8 17.075000000000003 25.874999999999996 32.775 24.275 9 17.0 23.400000000000002 35.05 24.55 10-14 19.405 29.14 28.16 23.294999999999998 15-19 19.53 28.000000000000004 28.134999999999998 24.335 20-24 19.545 27.88 28.605000000000004 23.97 25-29 19.985 29.049999999999997 27.66 23.305 30-34 19.495 28.46 28.125 23.919999999999998 35-39 20.05 28.910000000000004 27.415 23.625 40-44 19.885 28.825 27.644999999999996 23.645 45-49 20.035 28.655 27.544999999999998 23.765 50-54 20.14 28.065 27.800000000000004 23.995 55-59 20.055 27.529999999999998 28.435 23.98 60-64 20.595 28.555000000000003 27.474999999999998 23.375 65-69 19.625 28.74 27.485 24.15 70-74 20.044999999999998 28.52 27.634999999999998 23.799999999999997 75-79 20.625 27.865000000000002 27.435 24.075 80-84 20.025000000000002 28.925 28.065 22.985 85-89 19.830000000000002 28.615000000000002 27.605 23.95 90-94 19.775000000000002 28.57 27.505000000000003 24.15 95-99 20.355 28.54 27.625 23.48 100-104 20.035 28.225 28.325 23.415 105-109 20.560000000000002 28.79 27.525 23.125 110-114 20.330000000000002 28.310000000000002 27.779999999999998 23.580000000000002 115-119 20.145 27.800000000000004 28.310000000000002 23.745 120-124 20.025000000000002 28.410000000000004 27.389999999999997 24.175 125-129 19.965 29.244999999999997 26.755000000000003 24.035 130-134 20.885 27.965 27.389999999999997 23.76 135-139 21.560000000000002 27.805000000000003 27.07 23.565 140-144 20.59 27.975 27.555000000000003 23.880000000000003 145-149 20.44 28.67 27.275 23.615 150-151 22.162499999999998 27.8125 26.200000000000003 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 2.5 24 2.0 25 3.5 26 3.0 27 5.0 28 8.5 29 13.0 30 17.5 31 24.0 32 30.0 33 34.0 34 50.5 35 80.5 36 94.0 37 101.5 38 128.5 39 154.5 40 191.5 41 219.0 42 236.5 43 258.5 44 277.5 45 283.5 46 270.5 47 248.5 48 237.0 49 222.0 50 171.5 51 134.0 52 110.5 53 83.0 54 70.0 55 65.0 56 50.5 57 36.5 58 29.0 59 18.0 60 9.5 61 5.5 62 4.5 63 3.0 64 3.0 65 3.0 66 1.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.66438168357554 83.575 2 7.293666026871401 13.3 3 0.8774335069920483 2.4 4 0.08225939128050452 0.3 5 0.054839594187003016 0.25 6 0.0 0.0 7 0.027419797093501508 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACAGCAACGGTCTGGCGCATGTCCCTCACAGCAAATCGACCAAGTGG 7 0.17500000000000002 No Hit CCTGCTTCAACTTTTGCAGTGTTCCAAACTGCTCCAAGACCAGTAGGAAC 5 0.125 No Hit GCTCTGTATATGTCGAAACTTCACCAAAATTCAGCGCAAGGCGATCAGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4500000000000002 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.8625 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.6500000000000004 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACGA 10 0.006830828 145.0 1 ATTAGCC 10 0.006830828 145.0 6 GCACGAA 10 0.006830828 145.0 2 AGCCCTC 10 0.006830828 145.0 9 >>END_MODULE SRR12919393 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919393_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.236 37.0 37.0 37.0 37.0 37.0 2 36.1745 37.0 37.0 37.0 37.0 37.0 3 36.247 37.0 37.0 37.0 37.0 37.0 4 36.2925 37.0 37.0 37.0 37.0 37.0 5 36.309 37.0 37.0 37.0 37.0 37.0 6 36.3635 37.0 37.0 37.0 37.0 37.0 7 36.302 37.0 37.0 37.0 37.0 37.0 8 36.4225 37.0 37.0 37.0 37.0 37.0 9 36.283 37.0 37.0 37.0 37.0 37.0 10-14 36.3076 37.0 37.0 37.0 37.0 37.0 15-19 36.267 37.0 37.0 37.0 37.0 37.0 20-24 36.2144 37.0 37.0 37.0 37.0 37.0 25-29 36.1987 37.0 37.0 37.0 37.0 37.0 30-34 36.1286 37.0 37.0 37.0 37.0 37.0 35-39 36.1674 37.0 37.0 37.0 37.0 37.0 40-44 36.108799999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.139 37.0 37.0 37.0 37.0 37.0 50-54 36.0607 37.0 37.0 37.0 37.0 37.0 55-59 36.030300000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9999 37.0 37.0 37.0 37.0 37.0 65-69 35.9627 37.0 37.0 37.0 37.0 37.0 70-74 35.9892 37.0 37.0 37.0 37.0 37.0 75-79 35.9515 37.0 37.0 37.0 37.0 37.0 80-84 35.8689 37.0 37.0 37.0 37.0 37.0 85-89 35.8669 37.0 37.0 37.0 37.0 37.0 90-94 35.754900000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.753499999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.7279 37.0 37.0 37.0 37.0 37.0 105-109 35.7414 37.0 37.0 37.0 37.0 37.0 110-114 35.672799999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.660900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.6236 37.0 37.0 37.0 37.0 37.0 125-129 35.563300000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.5313 37.0 37.0 37.0 37.0 37.0 135-139 35.3435 37.0 37.0 37.0 34.6 37.0 140-144 35.302099999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.2035 37.0 37.0 37.0 29.8 37.0 150-151 35.142250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 4.0 15 4.0 16 1.0 17 3.0 18 2.0 19 5.0 20 0.0 21 4.0 22 6.0 23 3.0 24 9.0 25 7.0 26 8.0 27 14.0 28 13.0 29 23.0 30 26.0 31 32.0 32 46.0 33 103.0 34 204.0 35 487.0 36 2692.0 37 301.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.5 25.374999999999996 8.774999999999999 24.349999999999998 2 26.924999999999997 26.900000000000002 29.95 16.225 3 20.875 26.724999999999998 33.275 19.125 4 22.825 34.175 25.05 17.95 5 24.6 34.75 23.724999999999998 16.925 6 21.85 38.525 21.425 18.2 7 22.175 22.575 36.925000000000004 18.325 8 22.55 25.8 27.175 24.474999999999998 9 22.175 23.849999999999998 31.324999999999996 22.650000000000002 10-14 23.724999999999998 29.23 26.14 20.905 15-19 23.400000000000002 28.075 27.74 20.785 20-24 22.814999999999998 28.65 27.02 21.515 25-29 22.939999999999998 28.4 27.615000000000002 21.044999999999998 30-34 22.38 28.215 28.015 21.39 35-39 23.035 28.549999999999997 27.694999999999997 20.72 40-44 23.235 27.955000000000002 27.425 21.385 45-49 22.855 28.54 27.650000000000002 20.955 50-54 23.275000000000002 27.905 27.975 20.845 55-59 23.24 28.17 27.615000000000002 20.974999999999998 60-64 23.544999999999998 28.084999999999997 27.810000000000002 20.560000000000002 65-69 23.01 29.195 27.08 20.715 70-74 22.985 28.53 27.74 20.745 75-79 23.255 28.615000000000002 27.505000000000003 20.625 80-84 23.064999999999998 28.155 27.785 20.995 85-89 23.78 28.405 27.51 20.305 90-94 23.395 28.110000000000003 28.044999999999998 20.45 95-99 23.41 28.65 27.46 20.48 100-104 23.794999999999998 28.299999999999997 27.565 20.34 105-109 23.505000000000003 28.46 27.450000000000003 20.585 110-114 23.395 28.01 28.12 20.474999999999998 115-119 24.42 27.639999999999997 28.255000000000003 19.685 120-124 24.07 28.055000000000003 27.57 20.305 125-129 24.395 28.485 26.855 20.265 130-134 24.575 28.265 27.435 19.725 135-139 24.685000000000002 28.435 27.265 19.615 140-144 25.145 28.194999999999997 27.115000000000002 19.545 145-149 25.095 28.044999999999998 27.334999999999997 19.525000000000002 150-151 24.525 28.4 27.8125 19.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 2.0 17 3.0 18 1.5 19 0.5 20 2.0 21 3.5 22 2.0 23 0.5 24 2.5 25 3.5 26 6.0 27 9.5 28 6.5 29 6.5 30 14.0 31 21.0 32 28.5 33 33.5 34 38.0 35 59.5 36 82.0 37 102.0 38 141.0 39 178.5 40 199.5 41 216.0 42 251.5 43 286.5 44 295.0 45 292.5 46 275.5 47 256.0 48 215.0 49 182.5 50 168.5 51 128.0 52 105.5 53 86.0 54 62.0 55 54.0 56 40.5 57 29.5 58 21.5 59 17.5 60 17.0 61 8.5 62 7.5 63 7.5 64 3.5 65 2.5 66 1.5 67 2.5 68 3.0 69 1.5 70 0.0 71 1.5 72 2.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.07650273224044 84.25 2 6.857923497267759 12.55 3 0.8743169398907104 2.4 4 0.1092896174863388 0.4 5 0.0546448087431694 0.25 6 0.0273224043715847 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACATGATTGAGAGGTCCACCAACCTTGACTGGTACAAGGGCCCAACTCT 6 0.15 No Hit ACTCAGGGACAGGTCATCACTTGCCGAGCTGCGGTTGCTTGGGAGGCGAA 5 0.125 No Hit GATTACCAGTTAGTGGACGTGCCTGATTATCATGGGAGAGGCGAGACTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.7374999999999998 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.55 0.0 0.0 0.0 0.0 126-127 2.7750000000000004 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.7750000000000004 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATGT 10 0.006830828 145.0 1 GCATGTT 10 0.006830828 145.0 2 >>END_MODULE Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054898 spots for SRR12919393.sra Written 1054898 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra Read 1054896 spots for SRR12919393.sra Written 1054896 spots for SRR12919393.sra SRR ids: ['SRR12919393.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8nyv4v3z SRR12919393.sra spots: 21097922 blocks: [[1, 1054896], [1054897, 2109792], [2109793, 3164688], [3164689, 4219584], [4219585, 5274480], [5274481, 6329376], [6329377, 7384272], [7384273, 8439168], [8439169, 9494064], [9494065, 10548960], [10548961, 11603856], [11603857, 12658752], [12658753, 13713648], [13713649, 14768544], [14768545, 15823440], [15823441, 16878336], [16878337, 17933232], [17933233, 18988128], [18988129, 20043024], [20043025, 21097922]] SRR12919393 file size 7148296 SRR12919393 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919393 SRR12919393_1.fastq SRR12919393_2.fastq Input file: SRR12919393_1.fastq Paired file: SRR12919393_2.fastq trimmed: SRR12919393-trimmed-pair1.fastq, SRR12919393-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:22:05 2025 >> started Wed Feb 12 22:22:30 2025 >> done (24.805s) 21097922 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 906 ( 0.00%) empty read pairs filtered out after trimming by size control 21096985 (100.00%) read pairs available; of these: 1721834 ( 8.16%) trimmed read pairs available after processing 19375151 (91.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 3 0.00% 25 8 0.00% 26 8 0.00% 27 7 0.00% 28 13 0.00% 29 7 0.00% 30 13 0.00% 31 14 0.00% 32 17 0.00% 33 12 0.00% 34 9 0.00% 35 11 0.00% 36 14 0.00% 37 27 0.00% 38 19 0.00% 39 19 0.00% 40 16 0.00% 41 26 0.00% 42 20 0.00% 43 27 0.00% 44 33 0.00% 45 38 0.00% 46 13 0.00% 47 28 0.00% 48 28 0.00% 49 36 0.00% 50 35 0.00% 51 63 0.00% 52 56 0.00% 53 43 0.00% 54 44 0.00% 55 60 0.00% 56 62 0.00% 57 91 0.00% 58 97 0.00% 59 100 0.00% 60 120 0.00% 61 166 0.00% 62 148 0.00% 63 187 0.00% 64 201 0.00% 65 208 0.00% 66 248 0.00% 67 266 0.00% 68 293 0.00% 69 364 0.00% 70 449 0.00% 71 494 0.00% 72 635 0.00% 73 727 0.00% 74 817 0.00% 75 920 0.00% 76 923 0.00% 77 1020 0.00% 78 1184 0.01% 79 1367 0.01% 80 1578 0.01% 81 1807 0.01% 82 2022 0.01% 83 2397 0.01% 84 2760 0.01% 85 3020 0.01% 86 3320 0.02% 87 3462 0.02% 88 3709 0.02% 89 4151 0.02% 90 4514 0.02% 91 5213 0.02% 92 5805 0.03% 93 6417 0.03% 94 7285 0.03% 95 7681 0.04% 96 8260 0.04% 97 8805 0.04% 98 8950 0.04% 99 9424 0.04% 100 10212 0.05% 101 10921 0.05% 102 11893 0.06% 103 12683 0.06% 104 14021 0.07% 105 14789 0.07% 106 15554 0.07% 107 16186 0.08% 108 16480 0.08% 109 16961 0.08% 110 17570 0.08% 111 18559 0.09% 112 19691 0.09% 113 20357 0.10% 114 21963 0.10% 115 23150 0.11% 116 23652 0.11% 117 24379 0.12% 118 24883 0.12% 119 25273 0.12% 120 26163 0.12% 121 26996 0.13% 122 27651 0.13% 123 29246 0.14% 124 30853 0.15% 125 31861 0.15% 126 33182 0.16% 127 33598 0.16% 128 34184 0.16% 129 34513 0.16% 130 35165 0.17% 131 35799 0.17% 132 37302 0.18% 133 38503 0.18% 134 39055 0.19% 135 41201 0.20% 136 42342 0.20% 137 42575 0.20% 138 43784 0.21% 139 43702 0.21% 140 44249 0.21% 141 45208 0.21% 142 46249 0.22% 143 46816 0.22% 144 48834 0.23% 145 50165 0.24% 146 51107 0.24% 147 51437 0.24% 148 52339 0.25% 149 52652 0.25% 150 53462 0.25% 151 19375151 91.84% 21096985 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=7.68 fanout-score-rank=16 prefix-density=0.38 prefix-fanout=3.9 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=62.44 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.0 sequence=AACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACTTGT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=16.33 fanout-score-rank=12 prefix-density=0.33 prefix-fanout=7.7 sequence=TTTGACAAGAAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=363.47 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=32.6 sequence=AAGAAGAAGAAA SRR12919393 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:23:14 Started mapping on | Feb 12 22:23:14 Finished on | Feb 12 22:26:20 Mapping speed, Million of reads per hour | 408.33 Number of input reads | 21096985 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19541610 Uniquely mapped reads % | 92.63% Average mapped length | 296.85 Number of splices: Total | 18830057 Number of splices: Annotated (sjdb) | 18380693 Number of splices: GT/AG | 18480059 Number of splices: GC/AG | 269395 Number of splices: AT/AC | 19906 Number of splices: Non-canonical | 60697 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 3.11 Insertion rate per base | 0.03% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515432 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 61056 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.48% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1039943 1039943 1039943 N_multimapping 515432 515432 515432 N_noFeature 704721 19320138 811475 N_ambiguous 245752 1460 130085 UnstrandedReadsAssigned:18591137 PositiveStrandReadsAssigned:220012 NegativeStrandReadsAssigned:18600050 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919393 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919393-trimmed-pair1.fastq SRR12919393-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,096,985 reads, 18,581,064 reads pseudoaligned [quant] estimated average fragment length: 273.819 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR12919393.ke.tsv 34699 SRR12919393.se.tsv 87100 total ==> SRR12919393.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.18 979 31.3871 Potri.005G024800.1.v4.1 1035 762.181 301 22.0962 Potri.004G059700.1.v4.1 961 688.489 37 3.00687 Potri.007G009000.2.v4.1 1416 1143.18 0 0 Potri.003G141000.2.v4.1 2943 2670.18 586.774 12.2953 Potri.016G087400.1.v4.1 270 80.5685 1499.1 1041.06 Potri.015G069301.1.v4.1 564 310.613 0 0 Potri.010G195200.1.v4.1 1773 1500.18 127 4.73663 Potri.012G127500.1.v4.1 977 704.345 10703 850.216 ==> SRR12919393.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 494 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 153 Potri.001G452600.v4.1 33 SRR12919393 completed mapping pipeline successfully