Starting /dee2/code/volunteer_pipeline.sh SRR12919394 current disk space = 3050518073344 free memory = 1579315408 SRR12919394 SRAfilesize 1fc60e46cc5436d9c21ea2ca6a0eade6 SRR12919394.sra SRR12919394.sra file validated SRR12919394 is paired end SRR12919394 is conventional basespace SRR12919394 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919394_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.534 37.0 37.0 37.0 37.0 37.0 2 36.32975 37.0 37.0 37.0 37.0 37.0 3 36.5545 37.0 37.0 37.0 37.0 37.0 4 36.64 37.0 37.0 37.0 37.0 37.0 5 36.666 37.0 37.0 37.0 37.0 37.0 6 36.6855 37.0 37.0 37.0 37.0 37.0 7 36.627 37.0 37.0 37.0 37.0 37.0 8 36.6545 37.0 37.0 37.0 37.0 37.0 9 36.624 37.0 37.0 37.0 37.0 37.0 10-14 36.661300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.643100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.6068 37.0 37.0 37.0 37.0 37.0 25-29 36.556799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5041 37.0 37.0 37.0 37.0 37.0 35-39 36.508399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4979 37.0 37.0 37.0 37.0 37.0 45-49 36.4776 37.0 37.0 37.0 37.0 37.0 50-54 36.4949 37.0 37.0 37.0 37.0 37.0 55-59 36.4778 37.0 37.0 37.0 37.0 37.0 60-64 36.4254 37.0 37.0 37.0 37.0 37.0 65-69 36.4261 37.0 37.0 37.0 37.0 37.0 70-74 36.357299999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.2653 37.0 37.0 37.0 37.0 37.0 80-84 36.3137 37.0 37.0 37.0 37.0 37.0 85-89 36.3328 37.0 37.0 37.0 37.0 37.0 90-94 36.244 37.0 37.0 37.0 37.0 37.0 95-99 36.2616 37.0 37.0 37.0 37.0 37.0 100-104 36.2469 37.0 37.0 37.0 37.0 37.0 105-109 36.1627 37.0 37.0 37.0 37.0 37.0 110-114 36.0376 37.0 37.0 37.0 37.0 37.0 115-119 36.166700000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.0668 37.0 37.0 37.0 37.0 37.0 125-129 36.01540000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.9673 37.0 37.0 37.0 37.0 37.0 135-139 35.8158 37.0 37.0 37.0 37.0 37.0 140-144 35.7265 37.0 37.0 37.0 37.0 37.0 145-149 35.75429999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.591750000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 2.0 22 0.0 23 1.0 24 2.0 25 1.0 26 2.0 27 6.0 28 6.0 29 13.0 30 18.0 31 31.0 32 37.0 33 76.0 34 132.0 35 335.0 36 2945.0 37 392.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.550000000000004 13.350000000000001 6.6000000000000005 41.5 2 17.8939432018095 14.199547625031414 38.65292787132446 29.25358130183463 3 16.125 18.725 29.275000000000002 35.875 4 19.900000000000002 25.45 25.374999999999996 29.275000000000002 5 22.650000000000002 33.175 23.875 20.3 6 20.375 34.35 24.625 20.65 7 14.075 27.224999999999998 40.75 17.95 8 16.625 26.325 31.424999999999997 25.624999999999996 9 16.925 23.549999999999997 34.975 24.55 10-14 19.325 29.509999999999998 27.529999999999998 23.635 15-19 19.595000000000002 28.18 28.04 24.185000000000002 20-24 19.45 28.815 28.360000000000003 23.375 25-29 19.72 29.509999999999998 27.169999999999998 23.599999999999998 30-34 19.41 29.060000000000002 27.965 23.565 35-39 19.759999999999998 28.804999999999996 27.32 24.115000000000002 40-44 20.43 28.22 27.575 23.775 45-49 20.044999999999998 27.88 28.175 23.9 50-54 20.119999999999997 28.29 27.565 24.025 55-59 19.950000000000003 29.104999999999997 27.515 23.43 60-64 20.01 28.310000000000002 27.87 23.810000000000002 65-69 20.03 29.054999999999996 27.084999999999997 23.830000000000002 70-74 20.415 28.849999999999998 27.27 23.465 75-79 20.175 28.785 26.974999999999998 24.065 80-84 20.47 28.265 27.505000000000003 23.76 85-89 20.525 28.725 26.765 23.985 90-94 20.26 29.165000000000003 26.555 24.02 95-99 20.555 27.99 27.91 23.544999999999998 100-104 20.575 28.175 27.115000000000002 24.135 105-109 20.275000000000002 28.410000000000004 27.555000000000003 23.76 110-114 20.36 27.855 27.839999999999996 23.945 115-119 20.59 28.13 27.060000000000002 24.22 120-124 20.815 28.01 27.305 23.87 125-129 20.45 27.97 27.32 24.26 130-134 21.029999999999998 28.01 27.12 23.84 135-139 20.72 28.249999999999996 26.715 24.315 140-144 20.794999999999998 27.534999999999997 27.57 24.099999999999998 145-149 21.035 27.944999999999997 27.195000000000004 23.825 150-151 21.825 27.5625 26.650000000000002 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 1.5 25 3.5 26 3.5 27 4.5 28 9.5 29 15.5 30 21.5 31 24.0 32 30.5 33 45.0 34 60.5 35 70.5 36 83.0 37 111.5 38 146.0 39 178.5 40 193.0 41 218.5 42 250.5 43 263.0 44 268.0 45 268.0 46 259.5 47 230.0 48 214.5 49 192.5 50 157.0 51 133.0 52 115.5 53 95.5 54 65.0 55 55.0 56 51.5 57 36.0 58 26.5 59 22.5 60 17.5 61 12.0 62 12.5 63 8.5 64 4.5 65 6.0 66 4.5 67 3.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.24588364434688 83.125 2 7.793633369923161 14.2 3 0.9055982436882546 2.475 4 0.054884742041712405 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.8125 0.0 0.0 0.0 0.0 124-125 4.262499999999999 0.0 0.0 0.0 0.0 126-127 4.55 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 5.925 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 7.1625 0.0 0.0 0.0 0.0 138-139 7.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTTA 10 0.006830828 145.0 5 >>END_MODULE SRR12919394 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919394_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4155 37.0 37.0 37.0 37.0 37.0 2 36.156 37.0 37.0 37.0 37.0 37.0 3 36.356 37.0 37.0 37.0 37.0 37.0 4 36.2225 37.0 37.0 37.0 37.0 37.0 5 36.283 37.0 37.0 37.0 37.0 37.0 6 36.299 37.0 37.0 37.0 37.0 37.0 7 36.2725 37.0 37.0 37.0 37.0 37.0 8 36.437 37.0 37.0 37.0 37.0 37.0 9 36.5215 37.0 37.0 37.0 37.0 37.0 10-14 36.3717 37.0 37.0 37.0 37.0 37.0 15-19 36.3702 37.0 37.0 37.0 37.0 37.0 20-24 36.32770000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2904 37.0 37.0 37.0 37.0 37.0 30-34 36.2536 37.0 37.0 37.0 37.0 37.0 35-39 36.2875 37.0 37.0 37.0 37.0 37.0 40-44 36.2471 37.0 37.0 37.0 37.0 37.0 45-49 36.2394 37.0 37.0 37.0 37.0 37.0 50-54 36.2013 37.0 37.0 37.0 37.0 37.0 55-59 36.154900000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.1108 37.0 37.0 37.0 37.0 37.0 65-69 36.1107 37.0 37.0 37.0 37.0 37.0 70-74 36.0295 37.0 37.0 37.0 37.0 37.0 75-79 36.055299999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0249 37.0 37.0 37.0 37.0 37.0 85-89 35.984899999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.9252 37.0 37.0 37.0 37.0 37.0 95-99 35.955600000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8007 37.0 37.0 37.0 37.0 37.0 105-109 35.8628 37.0 37.0 37.0 37.0 37.0 110-114 35.825599999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.7308 37.0 37.0 37.0 37.0 37.0 120-124 35.7353 37.0 37.0 37.0 37.0 37.0 125-129 35.6979 37.0 37.0 37.0 37.0 37.0 130-134 35.5666 37.0 37.0 37.0 37.0 37.0 135-139 35.3689 37.0 37.0 37.0 37.0 37.0 140-144 35.3245 37.0 37.0 37.0 34.6 37.0 145-149 35.1397 37.0 37.0 37.0 27.4 37.0 150-151 35.02925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 6.0 22 5.0 23 4.0 24 5.0 25 5.0 26 8.0 27 9.0 28 13.0 29 14.0 30 25.0 31 45.0 32 66.0 33 97.0 34 191.0 35 517.0 36 2642.0 37 344.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.4 24.525 9.35 26.724999999999998 2 26.700000000000003 27.425 29.525000000000002 16.35 3 20.25 29.125 31.1 19.525000000000002 4 22.925 35.325 24.3 17.45 5 23.799999999999997 36.0 21.8 18.4 6 21.125 39.300000000000004 22.2 17.375 7 20.075000000000003 23.05 37.35 19.525000000000002 8 20.625 25.05 29.299999999999997 25.025 9 21.65 25.2 29.825000000000003 23.325000000000003 10-14 23.505000000000003 28.605000000000004 26.565 21.325 15-19 22.99 27.825 27.839999999999996 21.345 20-24 23.405 29.29 26.545 20.76 25-29 22.735 28.249999999999996 28.470000000000002 20.544999999999998 30-34 23.015 27.6 28.17 21.215 35-39 23.294999999999998 27.76 27.62 21.325 40-44 22.84 28.13 27.92 21.11 45-49 23.225 27.224999999999998 28.655 20.895 50-54 23.44 28.255000000000003 27.384999999999998 20.919999999999998 55-59 23.175 28.499999999999996 27.96 20.365 60-64 23.215 27.644999999999996 28.110000000000003 21.029999999999998 65-69 23.669999999999998 28.194999999999997 27.805000000000003 20.330000000000002 70-74 23.835 27.785 27.425 20.955 75-79 23.400000000000002 28.115000000000002 27.42 21.065 80-84 22.939999999999998 27.965 27.384999999999998 21.709999999999997 85-89 24.33 27.860000000000003 27.375 20.435 90-94 23.674999999999997 27.79 27.435 21.099999999999998 95-99 23.474999999999998 27.96 27.74 20.825 100-104 24.18 28.444999999999997 27.26 20.115 105-109 24.279999999999998 27.16 27.32 21.240000000000002 110-114 24.265 27.865000000000002 27.255000000000003 20.615 115-119 24.755 28.084999999999997 27.375 19.785 120-124 24.27 28.144999999999996 27.105 20.48 125-129 24.75 28.63 27.169999999999998 19.45 130-134 25.095 27.189999999999998 27.529999999999998 20.185 135-139 26.0 27.785 26.515 19.7 140-144 25.924999999999997 27.61 26.8 19.665 145-149 26.179999999999996 27.155 27.155 19.509999999999998 150-151 26.6125 27.0125 27.175 19.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 1.0 11 1.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 0.5 23 2.0 24 4.0 25 2.0 26 0.5 27 4.5 28 8.5 29 9.5 30 9.5 31 15.5 32 28.0 33 35.0 34 43.0 35 66.0 36 89.0 37 114.0 38 137.5 39 172.0 40 203.0 41 216.0 42 255.5 43 268.0 44 261.0 45 286.0 46 273.0 47 246.5 48 221.5 49 190.5 50 164.0 51 127.0 52 102.0 53 85.0 54 74.0 55 63.5 56 49.0 57 42.0 58 35.5 59 21.0 60 10.5 61 10.5 62 14.0 63 10.0 64 6.0 65 3.5 66 2.5 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.65526675786595 83.75 2 7.305061559507524 13.350000000000001 3 0.9849521203830369 2.7 4 0.05471956224350205 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 3.0374999999999996 0.0 0.0 0.0 0.0 120-121 3.4625 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.6625 0.0 0.0 0.0 0.0 132-133 5.987500000000001 0.0 0.0 0.0 0.0 134-135 6.487500000000001 0.0 0.0 0.0 0.0 136-137 7.2375 0.0 0.0 0.0 0.0 138-139 7.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGGAGA 10 0.006830828 145.0 145 >>END_MODULE Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821559 spots for SRR12919394.sra Written 821559 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra Read 821555 spots for SRR12919394.sra Written 821555 spots for SRR12919394.sra SRR ids: ['SRR12919394.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f4myxl9w SRR12919394.sra spots: 16431104 blocks: [[1, 821555], [821556, 1643110], [1643111, 2464665], [2464666, 3286220], [3286221, 4107775], [4107776, 4929330], [4929331, 5750885], [5750886, 6572440], [6572441, 7393995], [7393996, 8215550], [8215551, 9037105], [9037106, 9858660], [9858661, 10680215], [10680216, 11501770], [11501771, 12323325], [12323326, 13144880], [13144881, 13966435], [13966436, 14787990], [14787991, 15609545], [15609546, 16431104]] SRR12919394 file size 5562307 SRR12919394 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919394 SRR12919394_1.fastq SRR12919394_2.fastq Input file: SRR12919394_1.fastq Paired file: SRR12919394_2.fastq trimmed: SRR12919394-trimmed-pair1.fastq, SRR12919394-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:10:51 2025 >> started Thu Feb 13 00:17:12 2025 >> done (380.601s) 16431104 read pairs processed; of these: 34 ( 0.00%) short read pairs filtered out after trimming by size control 491 ( 0.00%) empty read pairs filtered out after trimming by size control 16430579 (100.00%) read pairs available; of these: 1809781 (11.01%) trimmed read pairs available after processing 14620798 (88.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 4 0.00% 21 4 0.00% 22 7 0.00% 23 5 0.00% 24 5 0.00% 25 7 0.00% 26 5 0.00% 27 7 0.00% 28 7 0.00% 29 9 0.00% 30 5 0.00% 31 8 0.00% 32 5 0.00% 33 14 0.00% 34 15 0.00% 35 21 0.00% 36 19 0.00% 37 17 0.00% 38 22 0.00% 39 22 0.00% 40 22 0.00% 41 26 0.00% 42 24 0.00% 43 30 0.00% 44 30 0.00% 45 29 0.00% 46 33 0.00% 47 33 0.00% 48 50 0.00% 49 54 0.00% 50 55 0.00% 51 57 0.00% 52 76 0.00% 53 72 0.00% 54 80 0.00% 55 84 0.00% 56 103 0.00% 57 105 0.00% 58 141 0.00% 59 129 0.00% 60 188 0.00% 61 237 0.00% 62 227 0.00% 63 281 0.00% 64 346 0.00% 65 350 0.00% 66 367 0.00% 67 425 0.00% 68 480 0.00% 69 568 0.00% 70 634 0.00% 71 781 0.00% 72 935 0.01% 73 1155 0.01% 74 1267 0.01% 75 1362 0.01% 76 1432 0.01% 77 1625 0.01% 78 1740 0.01% 79 2024 0.01% 80 2304 0.01% 81 2673 0.02% 82 3295 0.02% 83 3603 0.02% 84 3935 0.02% 85 4435 0.03% 86 4678 0.03% 87 4810 0.03% 88 5324 0.03% 89 5752 0.04% 90 6137 0.04% 91 6799 0.04% 92 7812 0.05% 93 8907 0.05% 94 9658 0.06% 95 10340 0.06% 96 10475 0.06% 97 11026 0.07% 98 11600 0.07% 99 11897 0.07% 100 12737 0.08% 101 13874 0.08% 102 14699 0.09% 103 16325 0.10% 104 17550 0.11% 105 18302 0.11% 106 18754 0.11% 107 19201 0.12% 108 19484 0.12% 109 20175 0.12% 110 20625 0.13% 111 21556 0.13% 112 22487 0.14% 113 24080 0.15% 114 25443 0.15% 115 26151 0.16% 116 27096 0.16% 117 27634 0.17% 118 27630 0.17% 119 27904 0.17% 120 27803 0.17% 121 29655 0.18% 122 30298 0.18% 123 31408 0.19% 124 32713 0.20% 125 34369 0.21% 126 35210 0.21% 127 35216 0.21% 128 35390 0.22% 129 35236 0.21% 130 35810 0.22% 131 36237 0.22% 132 37133 0.23% 133 38382 0.23% 134 39579 0.24% 135 40837 0.25% 136 41312 0.25% 137 42034 0.26% 138 42139 0.26% 139 42904 0.26% 140 42794 0.26% 141 43041 0.26% 142 44368 0.27% 143 45015 0.27% 144 47000 0.29% 145 47606 0.29% 146 47974 0.29% 147 48477 0.30% 148 48468 0.29% 149 47944 0.29% 150 48391 0.29% 151 14620798 88.99% 16430579 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=2.4 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=386.40 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=34.3 sequence=CTTCTTCTTGAG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=44 prefix-density=0.15 prefix-fanout=1.9 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=84.61 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.4 sequence=GTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGC SRR12919394 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 00:40:31 Started mapping on | Feb 13 00:40:47 Finished on | Feb 13 01:12:47 Mapping speed, Million of reads per hour | 30.81 Number of input reads | 16430579 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14925643 Uniquely mapped reads % | 90.84% Average mapped length | 295.34 Number of splices: Total | 14453162 Number of splices: Annotated (sjdb) | 14123860 Number of splices: GT/AG | 14183505 Number of splices: GC/AG | 211564 Number of splices: AT/AC | 17796 Number of splices: Non-canonical | 40297 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.11 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395055 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 66376 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.20% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1109881 1109881 1109881 N_multimapping 395055 395055 395055 N_noFeature 498127 14750694 575727 N_ambiguous 183871 824 86080 UnstrandedReadsAssigned:14243645 PositiveStrandReadsAssigned:174125 NegativeStrandReadsAssigned:14263836 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919394 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919394-trimmed-pair1.fastq SRR12919394-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,430,579 reads, 14,328,367 reads pseudoaligned [quant] estimated average fragment length: 264.516 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR12919394.ke.tsv 34699 SRR12919394.se.tsv 87100 total ==> SRR12919394.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.48 670 25.6363 Potri.005G024800.1.v4.1 1035 771.484 98 8.52766 Potri.004G059700.1.v4.1 961 697.697 14 1.34707 Potri.007G009000.2.v4.1 1416 1152.48 0 0 Potri.003G141000.2.v4.1 2943 2679.48 440 11.0238 Potri.016G087400.1.v4.1 270 86.7233 1090 843.764 Potri.015G069301.1.v4.1 564 317.755 0 0 Potri.010G195200.1.v4.1 1773 1509.48 70 3.11315 Potri.012G127500.1.v4.1 977 713.573 12154 1143.43 ==> SRR12919394.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 83 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12919394 completed mapping pipeline successfully