Starting /dee2/code/volunteer_pipeline.sh SRR12919395 current disk space = 3050485215232 free memory = 1412733904 SRR12919395 SRAfilesize a94372441a1ab3269fe1cd48f888b8d9 SRR12919395.sra SRR12919395.sra file validated SRR12919395 is paired end SRR12919395 is conventional basespace SRR12919395 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919395_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5945 37.0 37.0 37.0 37.0 37.0 2 36.33625 37.0 37.0 37.0 37.0 37.0 3 36.5945 37.0 37.0 37.0 37.0 37.0 4 36.652 37.0 37.0 37.0 37.0 37.0 5 36.7 37.0 37.0 37.0 37.0 37.0 6 36.674 37.0 37.0 37.0 37.0 37.0 7 36.584 37.0 37.0 37.0 37.0 37.0 8 36.6235 37.0 37.0 37.0 37.0 37.0 9 36.6495 37.0 37.0 37.0 37.0 37.0 10-14 36.692499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.651500000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.6125 37.0 37.0 37.0 37.0 37.0 25-29 36.5915 37.0 37.0 37.0 37.0 37.0 30-34 36.569500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.543800000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.5261 37.0 37.0 37.0 37.0 37.0 45-49 36.4801 37.0 37.0 37.0 37.0 37.0 50-54 36.4776 37.0 37.0 37.0 37.0 37.0 55-59 36.4673 37.0 37.0 37.0 37.0 37.0 60-64 36.393100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.37949999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.37859999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3147 37.0 37.0 37.0 37.0 37.0 80-84 36.3101 37.0 37.0 37.0 37.0 37.0 85-89 36.2053 37.0 37.0 37.0 37.0 37.0 90-94 36.2038 37.0 37.0 37.0 37.0 37.0 95-99 36.2136 37.0 37.0 37.0 37.0 37.0 100-104 36.13420000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.0867 37.0 37.0 37.0 37.0 37.0 110-114 36.117000000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.022 37.0 37.0 37.0 37.0 37.0 120-124 36.0249 37.0 37.0 37.0 37.0 37.0 125-129 35.948499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9212 37.0 37.0 37.0 37.0 37.0 135-139 35.8414 37.0 37.0 37.0 37.0 37.0 140-144 35.791 37.0 37.0 37.0 37.0 37.0 145-149 35.7621 37.0 37.0 37.0 37.0 37.0 150-151 35.6355 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 0.0 24 1.0 25 1.0 26 4.0 27 8.0 28 16.0 29 13.0 30 20.0 31 27.0 32 54.0 33 58.0 34 125.0 35 335.0 36 2942.0 37 394.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.025 13.075000000000001 5.425 41.475 2 18.34378920953576 13.42534504391468 37.31493099121707 30.915934755332497 3 17.599999999999998 16.525000000000002 29.45 36.425000000000004 4 21.275 24.8 24.7 29.225 5 22.675 29.549999999999997 25.25 22.525000000000002 6 20.875 35.175 24.275 19.675 7 15.125 26.275 40.8 17.8 8 17.599999999999998 27.375 31.275 23.75 9 16.225 25.275 35.325 23.175 10-14 19.365 30.669999999999998 27.195000000000004 22.770000000000003 15-19 20.185 28.09 28.355000000000004 23.369999999999997 20-24 19.525000000000002 28.62 27.875 23.98 25-29 19.64 28.895 27.26 24.205 30-34 19.405 29.095 27.689999999999998 23.810000000000002 35-39 20.21 28.82 27.439999999999998 23.53 40-44 19.785 28.555000000000003 28.095 23.565 45-49 20.055 28.42 27.925 23.599999999999998 50-54 20.244999999999997 27.884999999999998 28.389999999999997 23.48 55-59 20.175 28.68 28.015 23.13 60-64 19.759999999999998 28.58 27.839999999999996 23.82 65-69 20.09 28.050000000000004 28.18 23.68 70-74 20.18 28.525 27.315 23.98 75-79 19.615 28.544999999999998 27.785 24.055 80-84 20.424999999999997 27.915 27.884999999999998 23.775 85-89 19.78 28.439999999999998 28.17 23.61 90-94 20.605 27.955000000000002 27.91 23.53 95-99 19.84 28.84 27.150000000000002 24.169999999999998 100-104 20.595 28.38 27.93 23.095 105-109 20.925 28.315 27.025 23.735 110-114 20.405 28.549999999999997 27.339999999999996 23.705000000000002 115-119 20.119999999999997 28.615000000000002 27.62 23.645 120-124 20.865000000000002 28.549999999999997 26.900000000000002 23.685000000000002 125-129 20.69 28.384999999999998 27.505000000000003 23.419999999999998 130-134 20.724999999999998 28.03 27.500000000000004 23.745 135-139 20.794999999999998 28.665000000000003 26.27 24.27 140-144 20.21 29.23 27.029999999999998 23.53 145-149 20.71 28.38 26.445 24.465 150-151 19.8375 27.9125 27.175 25.074999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 4.0 24 5.5 25 4.5 26 5.5 27 5.0 28 5.0 29 9.5 30 12.5 31 19.0 32 31.5 33 43.0 34 50.0 35 61.5 36 85.5 37 109.5 38 133.0 39 170.5 40 206.0 41 224.5 42 244.5 43 283.0 44 283.0 45 257.5 46 267.0 47 250.0 48 210.5 49 194.0 50 177.5 51 152.5 52 123.5 53 92.5 54 65.5 55 59.0 56 52.0 57 28.0 58 17.0 59 15.5 60 9.0 61 3.0 62 3.0 63 3.0 64 2.5 65 2.0 66 1.5 67 1.5 68 3.5 69 3.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.92800654485956 84.275 2 7.253886010362693 13.3 3 0.6817562039814562 1.875 4 0.08181074447777476 0.3 5 0.0545404963185165 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGGCGAAAATTGCAGATATGAGTTCTGATAAGACAGCAAGAACGTTGG 5 0.125 No Hit CCATATAGAGAGCTGCGTTCTGAGGATGAAGGCCATCCATCACCATGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.9124999999999996 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.1375 0.0 0.0 0.0 0.0 120-121 4.550000000000001 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.85 0.0 0.0 0.0 0.0 128-129 6.2875 0.0 0.0 0.0 0.0 130-131 6.9125 0.0 0.0 0.0 0.0 132-133 7.725 0.0 0.0 0.0 0.0 134-135 8.175 0.0 0.0 0.0 0.0 136-137 8.85 0.0 0.0 0.0 0.0 138-139 9.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCTCT 10 0.006830828 145.0 1 TTTATTC 10 0.006830828 145.0 7 >>END_MODULE SRR12919395 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919395_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.371 37.0 37.0 37.0 37.0 37.0 2 36.382 37.0 37.0 37.0 37.0 37.0 3 36.3475 37.0 37.0 37.0 37.0 37.0 4 36.4135 37.0 37.0 37.0 37.0 37.0 5 36.43 37.0 37.0 37.0 37.0 37.0 6 36.522 37.0 37.0 37.0 37.0 37.0 7 36.369 37.0 37.0 37.0 37.0 37.0 8 36.497 37.0 37.0 37.0 37.0 37.0 9 36.4365 37.0 37.0 37.0 37.0 37.0 10-14 36.467200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.43900000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.3998 37.0 37.0 37.0 37.0 37.0 25-29 36.3344 37.0 37.0 37.0 37.0 37.0 30-34 36.363800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.327299999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.2924 37.0 37.0 37.0 37.0 37.0 45-49 36.2745 37.0 37.0 37.0 37.0 37.0 50-54 36.2221 37.0 37.0 37.0 37.0 37.0 55-59 36.194900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1828 37.0 37.0 37.0 37.0 37.0 65-69 36.1896 37.0 37.0 37.0 37.0 37.0 70-74 36.107299999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.087300000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.0848 37.0 37.0 37.0 37.0 37.0 85-89 36.0596 37.0 37.0 37.0 37.0 37.0 90-94 36.0377 37.0 37.0 37.0 37.0 37.0 95-99 36.0048 37.0 37.0 37.0 37.0 37.0 100-104 36.0195 37.0 37.0 37.0 37.0 37.0 105-109 35.9769 37.0 37.0 37.0 37.0 37.0 110-114 35.9386 37.0 37.0 37.0 37.0 37.0 115-119 35.8899 37.0 37.0 37.0 37.0 37.0 120-124 35.8529 37.0 37.0 37.0 37.0 37.0 125-129 35.8581 37.0 37.0 37.0 37.0 37.0 130-134 35.7034 37.0 37.0 37.0 37.0 37.0 135-139 35.5245 37.0 37.0 37.0 37.0 37.0 140-144 35.5714 37.0 37.0 37.0 37.0 37.0 145-149 35.4089 37.0 37.0 37.0 37.0 37.0 150-151 35.22725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 1.0 16 1.0 17 0.0 18 2.0 19 2.0 20 1.0 21 3.0 22 5.0 23 1.0 24 5.0 25 1.0 26 9.0 27 11.0 28 6.0 29 14.0 30 27.0 31 21.0 32 32.0 33 86.0 34 180.0 35 480.0 36 2758.0 37 348.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1 25.4 8.075000000000001 26.424999999999997 2 25.025 27.975 32.275 14.725 3 19.25 28.175 33.225 19.35 4 24.2 33.2 24.325 18.275 5 23.125 39.025 21.2 16.650000000000002 6 21.925 38.025 22.925 17.125 7 21.25 21.725 37.824999999999996 19.2 8 20.75 24.725 29.325000000000003 25.2 9 21.3 23.5 32.725 22.475 10-14 23.585 29.104999999999997 26.21 21.099999999999998 15-19 23.119999999999997 28.110000000000003 28.115000000000002 20.655 20-24 22.650000000000002 28.675 27.76 20.915 25-29 23.025000000000002 28.395 27.58 21.0 30-34 22.715 28.405 28.435 20.445 35-39 22.97 28.63 27.79 20.61 40-44 23.200000000000003 28.32 28.54 19.939999999999998 45-49 23.674999999999997 28.655 27.589999999999996 20.080000000000002 50-54 23.59 28.455000000000002 27.38 20.575 55-59 23.595 27.884999999999998 28.74 19.78 60-64 23.275000000000002 28.144999999999996 28.32 20.26 65-69 23.674999999999997 27.67 28.000000000000004 20.655 70-74 23.849999999999998 28.215 27.775 20.16 75-79 24.595 27.965 27.445000000000004 19.994999999999997 80-84 23.919999999999998 28.12 27.685 20.275000000000002 85-89 23.13 28.194999999999997 27.6 21.075 90-94 23.46 27.865000000000002 28.01 20.665 95-99 23.155 28.585 27.575 20.685000000000002 100-104 23.94 28.62 27.615000000000002 19.825 105-109 23.895 28.249999999999996 27.065 20.79 110-114 24.154999999999998 28.444999999999997 27.474999999999998 19.925 115-119 24.745 28.515 27.200000000000003 19.54 120-124 24.845 28.235 26.66 20.26 125-129 24.73 28.015 26.995 20.26 130-134 24.72 28.65 27.02 19.61 135-139 24.785 28.54 27.32 19.355 140-144 25.419999999999998 28.685 26.009999999999998 19.885 145-149 26.11 27.705000000000002 26.674999999999997 19.509999999999998 150-151 25.7375 28.012500000000003 27.0625 19.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 2.0 23 2.0 24 2.5 25 4.5 26 6.0 27 8.5 28 9.5 29 9.5 30 17.5 31 24.0 32 31.5 33 45.0 34 46.5 35 54.5 36 83.5 37 110.5 38 142.0 39 175.0 40 221.0 41 246.0 42 251.5 43 291.0 44 286.5 45 252.0 46 257.5 47 252.0 48 227.0 49 199.0 50 168.5 51 140.0 52 102.0 53 78.0 54 66.5 55 45.0 56 30.0 57 23.5 58 16.5 59 14.5 60 13.0 61 9.5 62 6.5 63 5.5 64 4.0 65 1.5 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.7054475773337 83.75 2 7.391185327128387 13.5 3 0.7391185327128388 2.025 4 0.08212428141253764 0.3 5 0.054749520941691755 0.25 6 0.0 0.0 7 0.027374760470845878 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GTCCCTTGAGAATCTTCAATTCTGATGACAAGTCTGAGGGTGTCGGCTCA 5 0.125 No Hit CCTACATTGCTGGATTACTGACTGGAAGGCCTAATTCCAAGGCCACTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.3250000000000002 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.9875 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.8625000000000003 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.65 0.0 0.0 0.0 0.0 122-123 5.012499999999999 0.0 0.0 0.0 0.0 124-125 5.4625 0.0 0.0 0.0 0.0 126-127 5.975 0.0 0.0 0.0 0.0 128-129 6.4125 0.0 0.0 0.0 0.0 130-131 7.0625 0.0 0.0 0.0 0.0 132-133 7.875 0.0 0.0 0.0 0.0 134-135 8.325 0.0 0.0 0.0 0.0 136-137 9.037500000000001 0.0 0.0 0.0 0.0 138-139 9.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTACC 10 0.006830828 145.0 6 TCAGTTG 10 0.006830828 145.0 8 CTCACCT 10 0.006830828 145.0 8 >>END_MODULE Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802745 spots for SRR12919395.sra Written 802745 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra Read 802740 spots for SRR12919395.sra Written 802740 spots for SRR12919395.sra SRR ids: ['SRR12919395.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2qca8jcd SRR12919395.sra spots: 16054805 blocks: [[1, 802740], [802741, 1605480], [1605481, 2408220], [2408221, 3210960], [3210961, 4013700], [4013701, 4816440], [4816441, 5619180], [5619181, 6421920], [6421921, 7224660], [7224661, 8027400], [8027401, 8830140], [8830141, 9632880], [9632881, 10435620], [10435621, 11238360], [11238361, 12041100], [12041101, 12843840], [12843841, 13646580], [13646581, 14449320], [14449321, 15252060], [15252061, 16054805]] SRR12919395 file size 5434424 SRR12919395 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919395 SRR12919395_1.fastq SRR12919395_2.fastq Input file: SRR12919395_1.fastq Paired file: SRR12919395_2.fastq trimmed: SRR12919395-trimmed-pair1.fastq, SRR12919395-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:26:51 2025 >> started Wed Feb 12 22:27:18 2025 >> done (27.324s) 16054805 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 8366 ( 0.05%) empty read pairs filtered out after trimming by size control 16046412 (99.95%) read pairs available; of these: 2131115 (13.28%) trimmed read pairs available after processing 13915297 (86.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 1 0.00% 22 4 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 5 0.00% 27 4 0.00% 28 6 0.00% 29 11 0.00% 30 5 0.00% 31 9 0.00% 32 9 0.00% 33 14 0.00% 34 15 0.00% 35 10 0.00% 36 10 0.00% 37 19 0.00% 38 13 0.00% 39 17 0.00% 40 15 0.00% 41 27 0.00% 42 28 0.00% 43 33 0.00% 44 38 0.00% 45 27 0.00% 46 32 0.00% 47 52 0.00% 48 52 0.00% 49 42 0.00% 50 75 0.00% 51 59 0.00% 52 82 0.00% 53 80 0.00% 54 102 0.00% 55 108 0.00% 56 116 0.00% 57 143 0.00% 58 192 0.00% 59 214 0.00% 60 231 0.00% 61 290 0.00% 62 339 0.00% 63 392 0.00% 64 397 0.00% 65 506 0.00% 66 497 0.00% 67 568 0.00% 68 638 0.00% 69 795 0.00% 70 994 0.01% 71 1168 0.01% 72 1314 0.01% 73 1495 0.01% 74 1737 0.01% 75 1947 0.01% 76 2094 0.01% 77 2281 0.01% 78 2470 0.02% 79 2853 0.02% 80 3164 0.02% 81 3758 0.02% 82 4352 0.03% 83 4855 0.03% 84 5418 0.03% 85 5901 0.04% 86 6248 0.04% 87 6816 0.04% 88 7346 0.05% 89 7918 0.05% 90 8544 0.05% 91 9337 0.06% 92 10177 0.06% 93 11571 0.07% 94 12258 0.08% 95 12915 0.08% 96 13769 0.09% 97 14163 0.09% 98 14879 0.09% 99 15673 0.10% 100 16311 0.10% 101 17308 0.11% 102 18608 0.12% 103 19953 0.12% 104 21054 0.13% 105 22201 0.14% 106 23021 0.14% 107 23214 0.14% 108 23826 0.15% 109 24537 0.15% 110 24816 0.15% 111 26076 0.16% 112 27052 0.17% 113 28451 0.18% 114 29666 0.18% 115 30997 0.19% 116 31910 0.20% 117 32387 0.20% 118 32804 0.20% 119 33149 0.21% 120 33672 0.21% 121 34486 0.21% 122 35673 0.22% 123 36693 0.23% 124 37932 0.24% 125 38910 0.24% 126 40218 0.25% 127 41103 0.26% 128 40898 0.25% 129 41369 0.26% 130 41922 0.26% 131 42583 0.27% 132 43665 0.27% 133 44387 0.28% 134 45425 0.28% 135 46569 0.29% 136 48047 0.30% 137 48340 0.30% 138 49043 0.31% 139 49187 0.31% 140 49011 0.31% 141 49602 0.31% 142 50455 0.31% 143 50907 0.32% 144 52767 0.33% 145 53185 0.33% 146 54275 0.34% 147 54538 0.34% 148 55046 0.34% 149 54824 0.34% 150 55284 0.34% 151 13915297 86.72% 16046412 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=8.16 fanout-score-rank=25 prefix-density=0.34 prefix-fanout=4.3 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=418.38 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=34.8 sequence=TTCTTCTTCGGTACCCTGTCGAATTAAGAGGTTGCACAAACACT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=14.57 fanout-score-rank=17 prefix-density=0.32 prefix-fanout=7.2 sequence=TTTGACAAGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=474.94 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=9.6 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12919395 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:28:13 Started mapping on | Feb 12 22:28:13 Finished on | Feb 12 22:30:47 Mapping speed, Million of reads per hour | 375.11 Number of input reads | 16046412 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14979498 Uniquely mapped reads % | 93.35% Average mapped length | 293.96 Number of splices: Total | 13869080 Number of splices: Annotated (sjdb) | 13546014 Number of splices: GT/AG | 13611936 Number of splices: GC/AG | 198585 Number of splices: AT/AC | 15312 Number of splices: Non-canonical | 43247 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398271 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 44034 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.77% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 668643 668643 668643 N_multimapping 398271 398271 398271 N_noFeature 597763 14795266 693116 N_ambiguous 175371 1294 85629 UnstrandedReadsAssigned:14206364 PositiveStrandReadsAssigned:182938 NegativeStrandReadsAssigned:14200753 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919395 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919395-trimmed-pair1.fastq SRR12919395-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,046,412 reads, 14,267,387 reads pseudoaligned [quant] estimated average fragment length: 248.859 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR12919395.ke.tsv 34699 SRR12919395.se.tsv 87100 total ==> SRR12919395.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.14 593 24.9023 Potri.005G024800.1.v4.1 1035 787.141 134 12.6545 Potri.004G059700.1.v4.1 961 713.263 70 7.29526 Potri.007G009000.2.v4.1 1416 1168.14 8 0.509082 Potri.003G141000.2.v4.1 2943 2695.14 462.304 12.7508 Potri.016G087400.1.v4.1 270 89.6521 1283.17 1063.94 Potri.015G069301.1.v4.1 564 328.886 0 0 Potri.010G195200.1.v4.1 1773 1525.14 51 2.48572 Potri.012G127500.1.v4.1 977 729.211 8702 887.072 ==> SRR12919395.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 193 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR12919395 completed mapping pipeline successfully