Starting /dee2/code/volunteer_pipeline.sh SRR12919396 current disk space = 3050479034368 free memory = 1471220496 SRR12919396 SRAfilesize 64acdc30fbce745a17b69eb96012f2de SRR12919396.sra SRR12919396.sra file validated SRR12919396 is paired end SRR12919396 is conventional basespace SRR12919396 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919396_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5655 37.0 37.0 37.0 37.0 37.0 2 36.369 37.0 37.0 37.0 37.0 37.0 3 36.6325 37.0 37.0 37.0 37.0 37.0 4 36.607 37.0 37.0 37.0 37.0 37.0 5 36.681 37.0 37.0 37.0 37.0 37.0 6 36.707 37.0 37.0 37.0 37.0 37.0 7 36.6055 37.0 37.0 37.0 37.0 37.0 8 36.718 37.0 37.0 37.0 37.0 37.0 9 36.662 37.0 37.0 37.0 37.0 37.0 10-14 36.7081 37.0 37.0 37.0 37.0 37.0 15-19 36.658100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.6355 37.0 37.0 37.0 37.0 37.0 25-29 36.57899999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.5438 37.0 37.0 37.0 37.0 37.0 35-39 36.56949999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.5193 37.0 37.0 37.0 37.0 37.0 45-49 36.5305 37.0 37.0 37.0 37.0 37.0 50-54 36.4885 37.0 37.0 37.0 37.0 37.0 55-59 36.434099999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.3993 37.0 37.0 37.0 37.0 37.0 65-69 36.4165 37.0 37.0 37.0 37.0 37.0 70-74 36.3322 37.0 37.0 37.0 37.0 37.0 75-79 36.318799999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3403 37.0 37.0 37.0 37.0 37.0 85-89 36.2649 37.0 37.0 37.0 37.0 37.0 90-94 36.2114 37.0 37.0 37.0 37.0 37.0 95-99 36.2349 37.0 37.0 37.0 37.0 37.0 100-104 36.2467 37.0 37.0 37.0 37.0 37.0 105-109 36.171 37.0 37.0 37.0 37.0 37.0 110-114 36.0553 37.0 37.0 37.0 37.0 37.0 115-119 36.0214 37.0 37.0 37.0 37.0 37.0 120-124 36.10379999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.9654 37.0 37.0 37.0 37.0 37.0 130-134 35.9354 37.0 37.0 37.0 37.0 37.0 135-139 35.7764 37.0 37.0 37.0 37.0 37.0 140-144 35.692899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.6083 37.0 37.0 37.0 37.0 37.0 150-151 35.38125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 3.0 26 2.0 27 5.0 28 7.0 29 15.0 30 27.0 31 32.0 32 44.0 33 59.0 34 120.0 35 320.0 36 2971.0 37 389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.1 12.35 5.8999999999999995 38.65 2 20.9442491210447 13.41034655951783 34.78151682571572 30.863887493721748 3 17.0 16.875 29.225 36.9 4 21.075 25.124999999999996 24.775 29.025000000000002 5 23.599999999999998 31.2 22.825 22.375 6 20.9 35.625 23.5 19.975 7 14.924999999999999 27.6 41.15 16.325 8 17.424999999999997 27.474999999999998 30.95 24.15 9 17.025000000000002 24.375 34.849999999999994 23.75 10-14 19.220000000000002 29.62 27.85 23.31 15-19 19.81 28.15 27.875 24.165 20-24 19.905 28.825 27.915 23.355 25-29 20.035 29.07 27.145000000000003 23.75 30-34 19.835 29.13 27.150000000000002 23.885 35-39 19.975 28.535 27.500000000000004 23.990000000000002 40-44 19.805 28.939999999999998 27.584999999999997 23.669999999999998 45-49 20.155 28.810000000000002 27.395000000000003 23.64 50-54 19.38 28.660000000000004 27.735 24.224999999999998 55-59 18.975 28.9 27.735 24.39 60-64 20.419999999999998 28.494999999999997 27.384999999999998 23.7 65-69 20.06 28.73 27.41 23.799999999999997 70-74 20.0 28.04 27.894999999999996 24.065 75-79 20.07 28.075 27.700000000000003 24.154999999999998 80-84 20.43 28.535 27.474999999999998 23.56 85-89 20.9 27.93 27.775 23.395 90-94 21.165 27.889999999999997 27.575 23.369999999999997 95-99 20.32 28.46 27.845 23.375 100-104 20.195 28.82 27.07 23.915 105-109 20.755000000000003 28.005000000000003 27.21 24.03 110-114 20.169999999999998 28.03 27.500000000000004 24.3 115-119 20.4 28.335 27.355 23.91 120-124 20.415 28.57 27.16 23.855 125-129 20.76 28.33 26.39 24.52 130-134 21.055 27.955000000000002 26.66 24.33 135-139 20.76 28.305000000000003 26.584999999999997 24.349999999999998 140-144 21.115000000000002 27.29 27.029999999999998 24.565 145-149 20.96 27.029999999999998 27.965 24.044999999999998 150-151 20.9 27.150000000000002 26.987499999999997 24.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.0 24 1.0 25 4.5 26 7.0 27 8.5 28 10.0 29 9.5 30 13.5 31 19.0 32 26.0 33 36.0 34 49.5 35 61.0 36 87.5 37 116.5 38 129.5 39 155.0 40 187.0 41 211.5 42 246.5 43 268.5 44 279.0 45 282.0 46 268.0 47 264.0 48 250.5 49 214.0 50 171.5 51 136.0 52 111.5 53 93.0 54 76.0 55 53.5 56 31.0 57 24.5 58 19.0 59 18.5 60 18.5 61 9.0 62 7.0 63 9.0 64 5.5 65 1.5 66 1.0 67 1.0 68 0.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.64162797049985 83.875 2 7.566238732586725 13.850000000000001 3 0.6828735318219066 1.875 4 0.10925976509150505 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.2875 0.0 0.0 0.0 0.0 106-107 2.625 0.0 0.0 0.0 0.0 108-109 3.1375 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 4.15 0.0 0.0 0.0 0.0 114-115 4.775 0.0 0.0 0.0 0.0 116-117 5.2375 0.0 0.0 0.0 0.0 118-119 5.6875 0.0 0.0 0.0 0.0 120-121 6.1625 0.0 0.0 0.0 0.0 122-123 6.6875 0.0 0.0 0.0 0.0 124-125 7.3125 0.0 0.0 0.0 0.0 126-127 7.9375 0.0 0.0 0.0 0.0 128-129 8.6375 0.0 0.0 0.0 0.0 130-131 9.399999999999999 0.0 0.0 0.0 0.0 132-133 10.025 0.0 0.0 0.0 0.0 134-135 10.6375 0.0 0.0 0.0 0.0 136-137 11.149999999999999 0.0 0.0 0.0 0.0 138-139 11.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTAGC 10 0.006830828 145.0 5 TGAACTC 20 3.5877043E-4 108.75 145 >>END_MODULE SRR12919396 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919396_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2495 37.0 37.0 37.0 37.0 37.0 2 36.207 37.0 37.0 37.0 37.0 37.0 3 36.2065 37.0 37.0 37.0 37.0 37.0 4 36.294 37.0 37.0 37.0 37.0 37.0 5 36.395 37.0 37.0 37.0 37.0 37.0 6 36.2725 37.0 37.0 37.0 37.0 37.0 7 36.3515 37.0 37.0 37.0 37.0 37.0 8 36.3775 37.0 37.0 37.0 37.0 37.0 9 36.4155 37.0 37.0 37.0 37.0 37.0 10-14 36.365500000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.316199999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.324299999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.2419 37.0 37.0 37.0 37.0 37.0 30-34 36.2007 37.0 37.0 37.0 37.0 37.0 35-39 36.2162 37.0 37.0 37.0 37.0 37.0 40-44 36.1571 37.0 37.0 37.0 37.0 37.0 45-49 36.1357 37.0 37.0 37.0 37.0 37.0 50-54 36.0963 37.0 37.0 37.0 37.0 37.0 55-59 36.049699999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.033699999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.0148 37.0 37.0 37.0 37.0 37.0 70-74 35.96939999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.925200000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.935700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.8495 37.0 37.0 37.0 37.0 37.0 90-94 35.808800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.84910000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.811899999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.7351 37.0 37.0 37.0 37.0 37.0 110-114 35.7793 37.0 37.0 37.0 37.0 37.0 115-119 35.672799999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.641200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.601099999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.487300000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.2997 37.0 37.0 37.0 34.6 37.0 140-144 35.3246 37.0 37.0 37.0 34.6 37.0 145-149 35.1971 37.0 37.0 37.0 27.4 37.0 150-151 34.968500000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 1.0 15 3.0 16 0.0 17 3.0 18 2.0 19 1.0 20 2.0 21 3.0 22 5.0 23 4.0 24 5.0 25 6.0 26 15.0 27 16.0 28 12.0 29 17.0 30 19.0 31 33.0 32 55.0 33 97.0 34 194.0 35 529.0 36 2678.0 37 295.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.099999999999994 24.45 9.925 24.525 2 28.025 27.175 30.0 14.799999999999999 3 21.25 27.500000000000004 32.225 19.025 4 23.3 33.875 24.224999999999998 18.6 5 24.349999999999998 38.05 20.225 17.375 6 21.45 38.25 23.25 17.05 7 21.575 23.125 36.4 18.9 8 21.375 26.775 27.6 24.25 9 22.2 24.55 30.575000000000003 22.675 10-14 24.044999999999998 29.34 26.355 20.26 15-19 23.605 28.335 27.405 20.655 20-24 23.56 28.325 27.060000000000002 21.055 25-29 23.43 27.994999999999997 27.485 21.09 30-34 23.5 27.650000000000002 28.115000000000002 20.735 35-39 22.96 28.015 27.77 21.255 40-44 23.445 28.43 27.565 20.560000000000002 45-49 23.28 28.134999999999998 27.935 20.65 50-54 23.44 28.16 27.905 20.495 55-59 23.43 29.020000000000003 27.365000000000002 20.185 60-64 23.119999999999997 28.13 27.595 21.154999999999998 65-69 23.68 28.549999999999997 27.665 20.105 70-74 23.630000000000003 28.065 27.755000000000003 20.549999999999997 75-79 22.939999999999998 28.485 27.705000000000002 20.87 80-84 23.51 28.060000000000002 27.71 20.72 85-89 24.0 28.07 27.725 20.205000000000002 90-94 23.915 28.32 27.634999999999998 20.13 95-99 23.57 27.87 27.775 20.785 100-104 24.445 27.794999999999998 27.49 20.27 105-109 23.875 28.26 27.089999999999996 20.775 110-114 24.62 27.58 27.66 20.14 115-119 24.685000000000002 27.860000000000003 27.35 20.105 120-124 24.015 28.199999999999996 27.425 20.36 125-129 24.834999999999997 28.42 26.97 19.775000000000002 130-134 25.900000000000002 27.85 26.939999999999998 19.31 135-139 25.535000000000004 27.57 27.565 19.33 140-144 25.81 27.215 27.185 19.79 145-149 26.540000000000003 27.405 27.01 19.045 150-151 26.525 27.325 26.924999999999997 19.225 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.5 6 2.0 7 1.0 8 1.5 9 1.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.5 20 1.5 21 0.5 22 0.5 23 1.0 24 0.5 25 1.0 26 3.0 27 5.0 28 7.0 29 12.0 30 13.0 31 15.5 32 22.0 33 31.5 34 44.5 35 57.5 36 84.0 37 109.0 38 137.5 39 179.5 40 201.0 41 219.0 42 259.0 43 278.5 44 279.5 45 273.0 46 293.5 47 278.5 48 216.0 49 192.0 50 162.0 51 132.5 52 108.5 53 91.0 54 75.5 55 48.5 56 30.0 57 21.5 58 22.0 59 19.5 60 11.0 61 6.0 62 4.0 63 4.5 64 6.0 65 5.5 66 3.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 1.0 75 1.5 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.74863387978142 83.95 2 7.4590163934426235 13.65 3 0.6830601092896175 1.875 4 0.08196721311475409 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0273224043715847 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.7 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.3125 0.0 0.0 0.0 0.0 106-107 2.65 0.0 0.0 0.0 0.0 108-109 3.1625 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 4.2 0.0 0.0 0.0 0.0 114-115 4.824999999999999 0.0 0.0 0.0 0.0 116-117 5.275 0.0 0.0 0.0 0.0 118-119 5.6875 0.0 0.0 0.0 0.0 120-121 6.1625 0.0 0.0 0.0 0.0 122-123 6.6875 0.0 0.0 0.0 0.0 124-125 7.3375 0.0 0.0 0.0 0.0 126-127 7.9625 0.0 0.0 0.0 0.0 128-129 8.6625 0.0 0.0 0.0 0.0 130-131 9.425 0.0 0.0 0.0 0.0 132-133 10.075 0.0 0.0 0.0 0.0 134-135 10.7125 0.0 0.0 0.0 0.0 136-137 11.225000000000001 0.0 0.0 0.0 0.0 138-139 11.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGAAA 25 8.7132835E-4 87.0 145 >>END_MODULE Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762773 spots for SRR12919396.sra Written 762773 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra Read 762764 spots for SRR12919396.sra Written 762764 spots for SRR12919396.sra SRR ids: ['SRR12919396.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xjk_8crf SRR12919396.sra spots: 15255289 blocks: [[1, 762764], [762765, 1525528], [1525529, 2288292], [2288293, 3051056], [3051057, 3813820], [3813821, 4576584], [4576585, 5339348], [5339349, 6102112], [6102113, 6864876], [6864877, 7627640], [7627641, 8390404], [8390405, 9153168], [9153169, 9915932], [9915933, 10678696], [10678697, 11441460], [11441461, 12204224], [12204225, 12966988], [12966989, 13729752], [13729753, 14492516], [14492517, 15255289]] SRR12919396 file size 5162714 SRR12919396 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919396 SRR12919396_1.fastq SRR12919396_2.fastq Input file: SRR12919396_1.fastq Paired file: SRR12919396_2.fastq trimmed: SRR12919396-trimmed-pair1.fastq, SRR12919396-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:46:43 2025 >> started Wed Feb 12 22:47:00 2025 >> done (17.310s) 15255289 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 9014 ( 0.06%) empty read pairs filtered out after trimming by size control 15246256 (99.94%) read pairs available; of these: 2565181 (16.82%) trimmed read pairs available after processing 12681075 (83.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 5 0.00% 25 6 0.00% 26 1 0.00% 27 6 0.00% 28 7 0.00% 29 5 0.00% 30 7 0.00% 31 10 0.00% 32 8 0.00% 33 18 0.00% 34 9 0.00% 35 15 0.00% 36 16 0.00% 37 20 0.00% 38 17 0.00% 39 25 0.00% 40 23 0.00% 41 26 0.00% 42 27 0.00% 43 35 0.00% 44 33 0.00% 45 32 0.00% 46 43 0.00% 47 44 0.00% 48 40 0.00% 49 69 0.00% 50 67 0.00% 51 65 0.00% 52 106 0.00% 53 95 0.00% 54 113 0.00% 55 159 0.00% 56 126 0.00% 57 178 0.00% 58 234 0.00% 59 270 0.00% 60 333 0.00% 61 375 0.00% 62 427 0.00% 63 468 0.00% 64 520 0.00% 65 544 0.00% 66 629 0.00% 67 725 0.00% 68 888 0.01% 69 1035 0.01% 70 1246 0.01% 71 1415 0.01% 72 1660 0.01% 73 1926 0.01% 74 2114 0.01% 75 2383 0.02% 76 2618 0.02% 77 2964 0.02% 78 3086 0.02% 79 3662 0.02% 80 4205 0.03% 81 4702 0.03% 82 5392 0.04% 83 6211 0.04% 84 6740 0.04% 85 7757 0.05% 86 8135 0.05% 87 8863 0.06% 88 9438 0.06% 89 9800 0.06% 90 10949 0.07% 91 12045 0.08% 92 13256 0.09% 93 14885 0.10% 94 16020 0.11% 95 17179 0.11% 96 17952 0.12% 97 19082 0.13% 98 19419 0.13% 99 20451 0.13% 100 21818 0.14% 101 22689 0.15% 102 24295 0.16% 103 26220 0.17% 104 27768 0.18% 105 28707 0.19% 106 29728 0.19% 107 30348 0.20% 108 31342 0.21% 109 32100 0.21% 110 32590 0.21% 111 33853 0.22% 112 35128 0.23% 113 36483 0.24% 114 38026 0.25% 115 39849 0.26% 116 40449 0.27% 117 41440 0.27% 118 41904 0.27% 119 41865 0.27% 120 42599 0.28% 121 43333 0.28% 122 44087 0.29% 123 45405 0.30% 124 47110 0.31% 125 47765 0.31% 126 49212 0.32% 127 49558 0.33% 128 49419 0.32% 129 49978 0.33% 130 50745 0.33% 131 50678 0.33% 132 51493 0.34% 133 52288 0.34% 134 53155 0.35% 135 55061 0.36% 136 55250 0.36% 137 55085 0.36% 138 55866 0.37% 139 56439 0.37% 140 55523 0.36% 141 56118 0.37% 142 56577 0.37% 143 57481 0.38% 144 58446 0.38% 145 58879 0.39% 146 58889 0.39% 147 59696 0.39% 148 59747 0.39% 149 59543 0.39% 150 59676 0.39% 151 12681075 83.18% 15246256 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=9.96 fanout-score-rank=16 prefix-density=0.23 prefix-fanout=4.8 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=183.01 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=24.1 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=12.41 fanout-score-rank=19 prefix-density=0.22 prefix-fanout=7.0 sequence=GAAGGCAATGAGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=36 fanout-score=83.99 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=11.0 sequence=GTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTG SRR12919396 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:47:45 Started mapping on | Feb 12 22:47:46 Finished on | Feb 12 22:49:40 Mapping speed, Million of reads per hour | 481.46 Number of input reads | 15246256 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14128209 Uniquely mapped reads % | 92.67% Average mapped length | 291.75 Number of splices: Total | 13279827 Number of splices: Annotated (sjdb) | 12940187 Number of splices: GT/AG | 13025334 Number of splices: GC/AG | 193291 Number of splices: AT/AC | 16343 Number of splices: Non-canonical | 44859 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414157 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 54954 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.08% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 703890 703890 703890 N_multimapping 414157 414157 414157 N_noFeature 562423 13952475 653106 N_ambiguous 169815 875 84200 UnstrandedReadsAssigned:13395971 PositiveStrandReadsAssigned:174859 NegativeStrandReadsAssigned:13390903 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919396 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919396-trimmed-pair1.fastq SRR12919396-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,246,256 reads, 13,524,134 reads pseudoaligned [quant] estimated average fragment length: 241.604 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR12919396.ke.tsv 34699 SRR12919396.se.tsv 87100 total ==> SRR12919396.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.4 831 35.4036 Potri.005G024800.1.v4.1 1035 794.396 393 37.4616 Potri.004G059700.1.v4.1 961 720.624 16 1.68129 Potri.007G009000.2.v4.1 1416 1175.4 0 0 Potri.003G141000.2.v4.1 2943 2702.4 518.28 14.5227 Potri.016G087400.1.v4.1 270 95.9268 1186 936.214 Potri.015G069301.1.v4.1 564 337.179 0 0 Potri.010G195200.1.v4.1 1773 1532.4 148 7.31343 Potri.012G127500.1.v4.1 977 736.466 2513 258.387 ==> SRR12919396.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 228 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 167 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 19 SRR12919396 completed mapping pipeline successfully