Starting /dee2/code/volunteer_pipeline.sh SRR12919397 current disk space = 3050476953600 free memory = 1414588392 SRR12919397 SRAfilesize bbb2c66c016e8375cacf87c2df9a9705 SRR12919397.sra SRR12919397.sra file validated SRR12919397 is paired end SRR12919397 is conventional basespace SRR12919397 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919397_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4845 37.0 37.0 37.0 37.0 37.0 2 36.25025 37.0 37.0 37.0 37.0 37.0 3 36.535 37.0 37.0 37.0 37.0 37.0 4 36.5825 37.0 37.0 37.0 37.0 37.0 5 36.673 37.0 37.0 37.0 37.0 37.0 6 36.6585 37.0 37.0 37.0 37.0 37.0 7 36.543 37.0 37.0 37.0 37.0 37.0 8 36.638 37.0 37.0 37.0 37.0 37.0 9 36.617 37.0 37.0 37.0 37.0 37.0 10-14 36.6614 37.0 37.0 37.0 37.0 37.0 15-19 36.626799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.601800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5308 37.0 37.0 37.0 37.0 37.0 30-34 36.5312 37.0 37.0 37.0 37.0 37.0 35-39 36.4995 37.0 37.0 37.0 37.0 37.0 40-44 36.482099999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.479400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.477 37.0 37.0 37.0 37.0 37.0 55-59 36.4396 37.0 37.0 37.0 37.0 37.0 60-64 36.4322 37.0 37.0 37.0 37.0 37.0 65-69 36.372400000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.3568 37.0 37.0 37.0 37.0 37.0 75-79 36.341499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2747 37.0 37.0 37.0 37.0 37.0 85-89 36.202 37.0 37.0 37.0 37.0 37.0 90-94 36.1886 37.0 37.0 37.0 37.0 37.0 95-99 36.2335 37.0 37.0 37.0 37.0 37.0 100-104 36.159 37.0 37.0 37.0 37.0 37.0 105-109 36.1168 37.0 37.0 37.0 37.0 37.0 110-114 36.057300000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.0348 37.0 37.0 37.0 37.0 37.0 120-124 36.0766 37.0 37.0 37.0 37.0 37.0 125-129 35.911100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.8812 37.0 37.0 37.0 37.0 37.0 135-139 35.8393 37.0 37.0 37.0 37.0 37.0 140-144 35.6604 37.0 37.0 37.0 37.0 37.0 145-149 35.66330000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.531 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 2.0 23 2.0 24 0.0 25 3.0 26 2.0 27 5.0 28 14.0 29 12.0 30 23.0 31 30.0 32 44.0 33 74.0 34 121.0 35 309.0 36 2991.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.525 12.275 5.625 39.574999999999996 2 18.9937106918239 13.0062893081761 35.9496855345912 32.0503144654088 3 16.275000000000002 17.575 29.349999999999998 36.8 4 21.15 24.45 24.95 29.45 5 21.325 30.45 25.275 22.95 6 20.1 33.6 24.775 21.525 7 15.475 27.175 38.6 18.75 8 17.375 25.525 32.275 24.825 9 16.325 24.925 32.975 25.775 10-14 18.59 30.23 27.92 23.26 15-19 19.695 27.49 28.525 24.29 20-24 19.08 28.7 27.48 24.740000000000002 25-29 19.384999999999998 28.355000000000004 27.334999999999997 24.925 30-34 19.84 28.799999999999997 27.36 24.0 35-39 19.475 28.335 27.884999999999998 24.305 40-44 19.72 28.310000000000002 27.250000000000004 24.72 45-49 19.919999999999998 28.98 27.189999999999998 23.91 50-54 20.165 27.639999999999997 27.96 24.235 55-59 19.994999999999997 27.985 27.950000000000003 24.07 60-64 20.14 28.42 27.779999999999998 23.66 65-69 20.0 28.955 27.13 23.915 70-74 20.185 28.28 27.245 24.29 75-79 20.48 28.59 27.485 23.445 80-84 20.31 27.76 27.955000000000002 23.974999999999998 85-89 20.25 28.09 27.575 24.085 90-94 20.24 28.67 27.150000000000002 23.94 95-99 20.794999999999998 28.505000000000003 27.16 23.54 100-104 20.235 28.705000000000002 27.250000000000004 23.810000000000002 105-109 20.785 28.53 26.924999999999997 23.76 110-114 20.369999999999997 28.52 27.425 23.685000000000002 115-119 20.635 28.59 27.650000000000002 23.125 120-124 20.64 27.685 27.76 23.915 125-129 20.990000000000002 28.29 27.05 23.669999999999998 130-134 20.830000000000002 27.500000000000004 27.375 24.295 135-139 21.205 28.27 27.034999999999997 23.49 140-144 21.01 28.134999999999998 27.02 23.835 145-149 20.810000000000002 28.205000000000002 27.36 23.625 150-151 21.5 27.950000000000003 25.9875 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 0.5 25 2.0 26 5.0 27 7.0 28 9.5 29 13.0 30 20.0 31 26.0 32 31.5 33 43.0 34 58.5 35 69.0 36 79.5 37 110.0 38 131.0 39 137.0 40 164.0 41 193.0 42 224.0 43 257.0 44 273.0 45 269.5 46 260.0 47 260.5 48 240.5 49 223.5 50 176.5 51 136.5 52 127.0 53 94.5 54 81.0 55 73.0 56 56.0 57 39.0 58 28.0 59 18.5 60 13.0 61 12.0 62 9.5 63 6.0 64 3.5 65 3.5 66 2.5 67 1.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.06652126499455 84.425 2 6.870229007633588 12.6 3 1.0087241003271539 2.775 4 0.05452562704471102 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.025 0.0 0.0 0.0 0.0 126-127 4.5 0.0 0.0 0.0 0.0 128-129 4.925 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.362500000000001 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.1 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12919397 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919397_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0195 37.0 37.0 37.0 37.0 37.0 2 36.164 37.0 37.0 37.0 37.0 37.0 3 36.26 37.0 37.0 37.0 37.0 37.0 4 36.291 37.0 37.0 37.0 37.0 37.0 5 36.3115 37.0 37.0 37.0 37.0 37.0 6 36.334 37.0 37.0 37.0 37.0 37.0 7 36.3055 37.0 37.0 37.0 37.0 37.0 8 36.277 37.0 37.0 37.0 37.0 37.0 9 36.378 37.0 37.0 37.0 37.0 37.0 10-14 36.3118 37.0 37.0 37.0 37.0 37.0 15-19 36.303 37.0 37.0 37.0 37.0 37.0 20-24 36.244400000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.1666 37.0 37.0 37.0 37.0 37.0 30-34 36.14 37.0 37.0 37.0 37.0 37.0 35-39 36.122400000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.08239999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.0341 37.0 37.0 37.0 37.0 37.0 50-54 36.0033 37.0 37.0 37.0 37.0 37.0 55-59 35.9817 37.0 37.0 37.0 37.0 37.0 60-64 35.9508 37.0 37.0 37.0 37.0 37.0 65-69 35.9092 37.0 37.0 37.0 37.0 37.0 70-74 35.8609 37.0 37.0 37.0 37.0 37.0 75-79 35.806 37.0 37.0 37.0 37.0 37.0 80-84 35.8144 37.0 37.0 37.0 37.0 37.0 85-89 35.791700000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.664 37.0 37.0 37.0 37.0 37.0 95-99 35.7675 37.0 37.0 37.0 37.0 37.0 100-104 35.7221 37.0 37.0 37.0 37.0 37.0 105-109 35.6508 37.0 37.0 37.0 37.0 37.0 110-114 35.66009999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6765 37.0 37.0 37.0 37.0 37.0 120-124 35.5664 37.0 37.0 37.0 37.0 37.0 125-129 35.489 37.0 37.0 37.0 37.0 37.0 130-134 35.4248 37.0 37.0 37.0 37.0 37.0 135-139 35.2769 37.0 37.0 37.0 32.2 37.0 140-144 35.1931 37.0 37.0 37.0 27.4 37.0 145-149 35.1123 37.0 37.0 37.0 27.4 37.0 150-151 35.006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 0.0 15 3.0 16 1.0 17 1.0 18 2.0 19 5.0 20 5.0 21 4.0 22 2.0 23 6.0 24 8.0 25 7.0 26 11.0 27 9.0 28 11.0 29 20.0 30 32.0 31 38.0 32 53.0 33 115.0 34 210.0 35 563.0 36 2626.0 37 261.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.45 24.474999999999998 9.1 25.974999999999998 2 25.324999999999996 25.95 31.55 17.175 3 19.950000000000003 28.050000000000004 33.074999999999996 18.925 4 23.625 33.175 22.775000000000002 20.424999999999997 5 24.525 37.15 21.825 16.5 6 20.925 38.2 21.8 19.075 7 21.224999999999998 22.2 36.95 19.625 8 21.525 25.575 28.375 24.525 9 21.15 25.5 30.25 23.1 10-14 23.65 28.854999999999997 26.32 21.175 15-19 22.32 28.465 27.939999999999998 21.275 20-24 23.175 28.439999999999998 27.334999999999997 21.05 25-29 23.48 27.744999999999997 27.894999999999996 20.880000000000003 30-34 22.770000000000003 27.639999999999997 28.444999999999997 21.145 35-39 22.61 28.299999999999997 28.01 21.08 40-44 23.635 27.765 27.544999999999998 21.055 45-49 23.54 27.6 28.410000000000004 20.45 50-54 22.63 28.205000000000002 28.46 20.705000000000002 55-59 23.445 27.6 27.775 21.18 60-64 23.135 28.595 27.38 20.89 65-69 23.235 28.185 27.839999999999996 20.74 70-74 23.724999999999998 27.355 27.944999999999997 20.974999999999998 75-79 23.72 27.99 28.035 20.255000000000003 80-84 23.61 27.665 27.6 21.125 85-89 24.325 27.735 27.485 20.455000000000002 90-94 24.195 27.810000000000002 27.589999999999996 20.405 95-99 23.669999999999998 28.105000000000004 27.584999999999997 20.64 100-104 23.53 27.715 27.810000000000002 20.945 105-109 24.01 27.91 27.685 20.395 110-114 23.919999999999998 27.889999999999997 27.58 20.61 115-119 24.195 28.060000000000002 26.745 21.0 120-124 24.355 28.235 27.325 20.085 125-129 24.265 28.549999999999997 26.740000000000002 20.445 130-134 24.745 28.68 26.38 20.195 135-139 25.06 28.22 27.08 19.64 140-144 25.174999999999997 28.355000000000004 27.495000000000005 18.975 145-149 25.240000000000002 28.15 26.995 19.615 150-151 27.212500000000002 27.750000000000004 26.2125 18.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 1.5 23 3.5 24 3.5 25 3.5 26 4.5 27 8.0 28 9.5 29 11.5 30 15.0 31 19.5 32 31.5 33 40.0 34 52.5 35 73.5 36 88.0 37 107.0 38 129.5 39 161.0 40 200.5 41 223.0 42 220.5 43 242.0 44 274.5 45 267.0 46 253.5 47 249.0 48 235.5 49 214.0 50 177.5 51 138.5 52 112.5 53 93.0 54 77.0 55 58.5 56 43.0 57 33.5 58 27.0 59 17.5 60 12.0 61 10.5 62 9.0 63 7.0 64 3.0 65 1.5 66 3.0 67 2.5 68 1.5 69 1.0 70 2.5 71 2.0 72 0.0 73 0.5 74 0.5 75 0.5 76 1.0 77 1.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.24067519738634 84.7 2 6.670296760141574 12.25 3 1.0345766403484888 2.85 4 0.054451402123604685 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 2.0250000000000004 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.6625 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.6500000000000004 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.1375 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 5.6625 0.0 0.0 0.0 0.0 136-137 6.05 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0035366106 20.714287 95-99 >>END_MODULE Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090763 spots for SRR12919397.sra Written 1090763 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra Read 1090761 spots for SRR12919397.sra Written 1090761 spots for SRR12919397.sra SRR ids: ['SRR12919397.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nqy83nj4 SRR12919397.sra spots: 21815222 blocks: [[1, 1090761], [1090762, 2181522], [2181523, 3272283], [3272284, 4363044], [4363045, 5453805], [5453806, 6544566], [6544567, 7635327], [7635328, 8726088], [8726089, 9816849], [9816850, 10907610], [10907611, 11998371], [11998372, 13089132], [13089133, 14179893], [14179894, 15270654], [15270655, 16361415], [16361416, 17452176], [17452177, 18542937], [18542938, 19633698], [19633699, 20724459], [20724460, 21815222]] SRR12919397 file size 7392066 SRR12919397 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919397 SRR12919397_1.fastq SRR12919397_2.fastq Input file: SRR12919397_1.fastq Paired file: SRR12919397_2.fastq trimmed: SRR12919397-trimmed-pair1.fastq, SRR12919397-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:41:19 2025 >> started Wed Feb 12 22:41:56 2025 >> done (36.896s) 21815222 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 2339 ( 0.01%) empty read pairs filtered out after trimming by size control 21812846 (99.99%) read pairs available; of these: 2224986 (10.20%) trimmed read pairs available after processing 19587860 (89.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 11 0.00% 22 4 0.00% 23 7 0.00% 24 11 0.00% 25 15 0.00% 26 5 0.00% 27 9 0.00% 28 9 0.00% 29 8 0.00% 30 10 0.00% 31 12 0.00% 32 18 0.00% 33 19 0.00% 34 13 0.00% 35 18 0.00% 36 22 0.00% 37 27 0.00% 38 21 0.00% 39 35 0.00% 40 31 0.00% 41 29 0.00% 42 25 0.00% 43 45 0.00% 44 35 0.00% 45 41 0.00% 46 50 0.00% 47 50 0.00% 48 52 0.00% 49 72 0.00% 50 73 0.00% 51 111 0.00% 52 109 0.00% 53 85 0.00% 54 113 0.00% 55 121 0.00% 56 135 0.00% 57 173 0.00% 58 163 0.00% 59 189 0.00% 60 250 0.00% 61 347 0.00% 62 363 0.00% 63 376 0.00% 64 423 0.00% 65 470 0.00% 66 522 0.00% 67 546 0.00% 68 630 0.00% 69 769 0.00% 70 881 0.00% 71 1034 0.00% 72 1120 0.01% 73 1336 0.01% 74 1477 0.01% 75 1651 0.01% 76 1863 0.01% 77 1853 0.01% 78 2178 0.01% 79 2462 0.01% 80 2855 0.01% 81 3217 0.01% 82 3747 0.02% 83 4296 0.02% 84 4793 0.02% 85 5142 0.02% 86 5631 0.03% 87 6007 0.03% 88 6516 0.03% 89 6828 0.03% 90 7598 0.03% 91 8312 0.04% 92 9282 0.04% 93 10394 0.05% 94 11429 0.05% 95 12260 0.06% 96 12718 0.06% 97 13430 0.06% 98 13884 0.06% 99 14807 0.07% 100 15800 0.07% 101 16700 0.08% 102 17975 0.08% 103 19387 0.09% 104 20427 0.09% 105 21904 0.10% 106 22447 0.10% 107 23205 0.11% 108 23910 0.11% 109 24739 0.11% 110 25253 0.12% 111 26076 0.12% 112 27366 0.13% 113 28873 0.13% 114 30490 0.14% 115 31449 0.14% 116 32375 0.15% 117 33676 0.15% 118 34066 0.16% 119 34348 0.16% 120 35003 0.16% 121 35824 0.16% 122 36776 0.17% 123 38289 0.18% 124 40249 0.18% 125 41002 0.19% 126 42794 0.20% 127 43601 0.20% 128 43444 0.20% 129 44037 0.20% 130 44725 0.21% 131 44813 0.21% 132 46093 0.21% 133 47481 0.22% 134 47900 0.22% 135 50306 0.23% 136 51414 0.24% 137 52096 0.24% 138 52496 0.24% 139 53205 0.24% 140 53115 0.24% 141 54312 0.25% 142 54803 0.25% 143 55176 0.25% 144 57750 0.26% 145 58430 0.27% 146 59535 0.27% 147 60521 0.28% 148 60719 0.28% 149 60605 0.28% 150 62324 0.29% 151 19587860 89.80% 21812846 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=7.24 fanout-score-rank=30 prefix-density=0.40 prefix-fanout=4.1 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=427.04 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=34.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=13.05 fanout-score-rank=16 prefix-density=0.37 prefix-fanout=6.7 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=459.14 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=10.2 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGAT SRR12919397 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:42:55 Started mapping on | Feb 12 22:42:56 Finished on | Feb 12 22:46:42 Mapping speed, Million of reads per hour | 347.46 Number of input reads | 21812846 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20113645 Uniquely mapped reads % | 92.21% Average mapped length | 295.65 Number of splices: Total | 19200465 Number of splices: Annotated (sjdb) | 18744292 Number of splices: GT/AG | 18839709 Number of splices: GC/AG | 282095 Number of splices: AT/AC | 22207 Number of splices: Non-canonical | 56454 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.13 Insertion rate per base | 0.03% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 534587 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 54232 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.96% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1164614 1164614 1164614 N_multimapping 534587 534587 534587 N_noFeature 756335 19854494 887838 N_ambiguous 241099 1348 112710 UnstrandedReadsAssigned:19116211 PositiveStrandReadsAssigned:257803 NegativeStrandReadsAssigned:19113097 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919397 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919397-trimmed-pair1.fastq SRR12919397-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,812,846 reads, 19,239,698 reads pseudoaligned [quant] estimated average fragment length: 268.055 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR12919397.ke.tsv 34699 SRR12919397.se.tsv 87100 total ==> SRR12919397.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.94 1093 32.5189 Potri.005G024800.1.v4.1 1035 767.945 247 16.7554 Potri.004G059700.1.v4.1 961 694.149 23 1.72609 Potri.007G009000.2.v4.1 1416 1148.94 0 0 Potri.003G141000.2.v4.1 2943 2675.94 646.166 12.5793 Potri.016G087400.1.v4.1 270 85.1906 1842.58 1126.74 Potri.015G069301.1.v4.1 564 314.566 0 0 Potri.010G195200.1.v4.1 1773 1505.94 40 1.38369 Potri.012G127500.1.v4.1 977 710.068 17251 1265.62 ==> SRR12919397.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 73 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 391 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 239 SRR12919397 completed mapping pipeline successfully