Starting /dee2/code/volunteer_pipeline.sh SRR12919398 current disk space = 3050492956672 free memory = 1575575360 SRR12919398 SRAfilesize 317643ed8f4b02e4fdaf34538c850f23 SRR12919398.sra SRR12919398.sra file validated SRR12919398 is paired end SRR12919398 is conventional basespace SRR12919398 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919398_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.605 37.0 37.0 37.0 37.0 37.0 2 36.159 37.0 37.0 37.0 37.0 37.0 3 36.583 37.0 37.0 37.0 37.0 37.0 4 36.6425 37.0 37.0 37.0 37.0 37.0 5 36.6045 37.0 37.0 37.0 37.0 37.0 6 36.651 37.0 37.0 37.0 37.0 37.0 7 36.5525 37.0 37.0 37.0 37.0 37.0 8 36.5775 37.0 37.0 37.0 37.0 37.0 9 36.655 37.0 37.0 37.0 37.0 37.0 10-14 36.626 37.0 37.0 37.0 37.0 37.0 15-19 36.5952 37.0 37.0 37.0 37.0 37.0 20-24 36.613 37.0 37.0 37.0 37.0 37.0 25-29 36.538799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4961 37.0 37.0 37.0 37.0 37.0 35-39 36.4861 37.0 37.0 37.0 37.0 37.0 40-44 36.5029 37.0 37.0 37.0 37.0 37.0 45-49 36.4622 37.0 37.0 37.0 37.0 37.0 50-54 36.415 37.0 37.0 37.0 37.0 37.0 55-59 36.430699999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.388600000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3429 37.0 37.0 37.0 37.0 37.0 70-74 36.365700000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2861 37.0 37.0 37.0 37.0 37.0 80-84 36.3216 37.0 37.0 37.0 37.0 37.0 85-89 36.2524 37.0 37.0 37.0 37.0 37.0 90-94 36.1888 37.0 37.0 37.0 37.0 37.0 95-99 36.2043 37.0 37.0 37.0 37.0 37.0 100-104 36.1745 37.0 37.0 37.0 37.0 37.0 105-109 36.1292 37.0 37.0 37.0 37.0 37.0 110-114 36.1099 37.0 37.0 37.0 37.0 37.0 115-119 36.0553 37.0 37.0 37.0 37.0 37.0 120-124 36.011399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.9585 37.0 37.0 37.0 37.0 37.0 130-134 35.939 37.0 37.0 37.0 37.0 37.0 135-139 35.7665 37.0 37.0 37.0 37.0 37.0 140-144 35.6857 37.0 37.0 37.0 37.0 37.0 145-149 35.6459 37.0 37.0 37.0 37.0 37.0 150-151 35.37575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 0.0 25 2.0 26 6.0 27 9.0 28 8.0 29 19.0 30 28.0 31 32.0 32 39.0 33 67.0 34 133.0 35 341.0 36 2950.0 37 365.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.55 12.6 5.525 44.324999999999996 2 18.08779011099899 14.00100908173562 37.10898082744703 30.802219979818364 3 16.825000000000003 15.725 28.375 39.074999999999996 4 20.599999999999998 23.849999999999998 25.5 30.049999999999997 5 23.175 30.95 24.2 21.675 6 20.7 32.625 24.55 22.125 7 13.725000000000001 28.025 40.45 17.8 8 17.5 25.874999999999996 31.95 24.675 9 16.275000000000002 23.674999999999997 35.4 24.65 10-14 19.12 30.235 27.96 22.685 15-19 19.335 28.060000000000002 28.205000000000002 24.4 20-24 19.335 28.405 28.144999999999996 24.115000000000002 25-29 19.48 28.585 27.725 24.21 30-34 19.34 28.299999999999997 28.73 23.630000000000003 35-39 19.415 28.28 28.134999999999998 24.169999999999998 40-44 19.85 28.585 27.584999999999997 23.98 45-49 20.495 28.194999999999997 27.62 23.69 50-54 19.775000000000002 28.549999999999997 28.139999999999997 23.535 55-59 20.19 28.265 28.07 23.474999999999998 60-64 19.42 28.575 28.055000000000003 23.95 65-69 19.725 28.005000000000003 28.465 23.805 70-74 19.400000000000002 28.825 27.605 24.169999999999998 75-79 19.744999999999997 28.17 28.08 24.005000000000003 80-84 19.88 28.33 28.249999999999996 23.54 85-89 19.759999999999998 28.53 27.445000000000004 24.265 90-94 20.244999999999997 28.389999999999997 27.325 24.04 95-99 20.145 28.665000000000003 27.965 23.225 100-104 20.48 28.794999999999998 27.200000000000003 23.525 105-109 20.549999999999997 28.439999999999998 27.279999999999998 23.73 110-114 20.025000000000002 29.060000000000002 26.91 24.005000000000003 115-119 20.94 28.62 27.075 23.365 120-124 21.15 28.794999999999998 26.325 23.73 125-129 19.825 28.225 27.900000000000002 24.05 130-134 20.405 29.025000000000002 27.115000000000002 23.455000000000002 135-139 20.669999999999998 28.165000000000003 27.41 23.755000000000003 140-144 20.555 28.15 27.435 23.86 145-149 20.925 28.349999999999998 27.175 23.549999999999997 150-151 20.974999999999998 28.262500000000003 27.224999999999998 23.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 1.5 23 4.5 24 4.5 25 4.0 26 6.0 27 9.0 28 11.5 29 12.0 30 19.0 31 28.0 32 30.5 33 31.0 34 47.5 35 74.5 36 89.5 37 108.0 38 130.0 39 173.0 40 209.5 41 230.5 42 236.0 43 240.5 44 268.0 45 272.5 46 253.0 47 250.0 48 243.5 49 201.0 50 172.0 51 155.5 52 117.0 53 88.0 54 70.5 55 54.0 56 44.0 57 30.0 58 20.0 59 14.5 60 11.5 61 8.5 62 6.0 63 3.5 64 2.5 65 3.0 66 3.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8999999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.30554031815689 83.22500000000001 2 7.761930883159628 14.149999999999999 3 0.8502468458584751 2.325 4 0.08228195282501372 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.2874999999999996 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 2.975 0.0125 0.0 0.0 0.0 120-121 3.3375 0.025 0.0 0.0 0.0 122-123 3.6875 0.025 0.0 0.0 0.0 124-125 4.0 0.025 0.0 0.0 0.0 126-127 4.375 0.025 0.0 0.0 0.0 128-129 4.762499999999999 0.025 0.0 0.0 0.0 130-131 5.0 0.025 0.0 0.0 0.0 132-133 5.4375 0.025 0.0 0.0 0.0 134-135 5.949999999999999 0.025 0.0 0.0 0.0 136-137 6.4875 0.025 0.0 0.0 0.0 138-139 6.9125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGAT 10 0.006830828 145.0 1 CCAGATC 25 8.7132835E-4 87.0 2 >>END_MODULE SRR12919398 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919398_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0985 37.0 37.0 37.0 37.0 37.0 2 35.9615 37.0 37.0 37.0 37.0 37.0 3 36.158 37.0 37.0 37.0 37.0 37.0 4 36.048 37.0 37.0 37.0 37.0 37.0 5 36.0985 37.0 37.0 37.0 37.0 37.0 6 36.2 37.0 37.0 37.0 37.0 37.0 7 36.113 37.0 37.0 37.0 37.0 37.0 8 36.2 37.0 37.0 37.0 37.0 37.0 9 36.2705 37.0 37.0 37.0 37.0 37.0 10-14 36.2034 37.0 37.0 37.0 37.0 37.0 15-19 36.209500000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.1713 37.0 37.0 37.0 37.0 37.0 25-29 36.1317 37.0 37.0 37.0 37.0 37.0 30-34 36.061400000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.0843 37.0 37.0 37.0 37.0 37.0 40-44 35.9952 37.0 37.0 37.0 37.0 37.0 45-49 36.0239 37.0 37.0 37.0 37.0 37.0 50-54 35.9676 37.0 37.0 37.0 37.0 37.0 55-59 35.972899999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.8872 37.0 37.0 37.0 37.0 37.0 65-69 35.9143 37.0 37.0 37.0 37.0 37.0 70-74 35.8976 37.0 37.0 37.0 37.0 37.0 75-79 35.84310000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.8355 37.0 37.0 37.0 37.0 37.0 85-89 35.8476 37.0 37.0 37.0 37.0 37.0 90-94 35.759299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.728899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.768899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.694900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6035 37.0 37.0 37.0 37.0 37.0 115-119 35.6754 37.0 37.0 37.0 37.0 37.0 120-124 35.5666 37.0 37.0 37.0 37.0 37.0 125-129 35.5077 37.0 37.0 37.0 37.0 37.0 130-134 35.3668 37.0 37.0 37.0 37.0 37.0 135-139 35.3164 37.0 37.0 37.0 37.0 37.0 140-144 35.3016 37.0 37.0 37.0 32.2 37.0 145-149 35.10979999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.9675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 1.0 16 2.0 17 2.0 18 3.0 19 2.0 20 4.0 21 4.0 22 7.0 23 4.0 24 8.0 25 6.0 26 7.0 27 11.0 28 13.0 29 24.0 30 29.0 31 42.0 32 67.0 33 105.0 34 217.0 35 588.0 36 2628.0 37 220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.475 25.0 9.675 26.85 2 26.375 27.275 31.275 15.075 3 19.175 28.325 33.800000000000004 18.7 4 21.65 34.525 25.45 18.375 5 25.074999999999996 35.525 22.025 17.375 6 20.95 38.875 22.775000000000002 17.4 7 19.900000000000002 23.200000000000003 37.875 19.025 8 20.325 26.75 28.1 24.825 9 21.6 23.325000000000003 31.0 24.075 10-14 22.575 30.130000000000003 26.229999999999997 21.065 15-19 23.880000000000003 28.405 27.76 19.955000000000002 20-24 21.84 29.035 28.02 21.105 25-29 23.45 28.470000000000002 27.845 20.235 30-34 23.05 27.91 27.775 21.265 35-39 23.01 28.29 27.860000000000003 20.84 40-44 22.715 28.525 27.63 21.13 45-49 22.634999999999998 28.249999999999996 28.13 20.985 50-54 22.49 29.220000000000002 27.35 20.94 55-59 23.335 28.18 27.860000000000003 20.625 60-64 23.035 28.825 27.694999999999997 20.445 65-69 23.385 28.38 28.084999999999997 20.150000000000002 70-74 23.724999999999998 28.335 27.72 20.22 75-79 23.44 28.050000000000004 27.889999999999997 20.62 80-84 23.580000000000002 28.08 27.415 20.925 85-89 23.45 27.935 27.425 21.19 90-94 23.36 28.1 27.875 20.665 95-99 23.925 28.205000000000002 27.224999999999998 20.645 100-104 24.265 28.15 27.200000000000003 20.385 105-109 24.02 28.645 27.375 19.96 110-114 23.69 28.82 27.389999999999997 20.1 115-119 24.39 28.48 27.339999999999996 19.79 120-124 24.36 29.160000000000004 26.76 19.72 125-129 24.55 28.439999999999998 27.0 20.01 130-134 25.335 28.044999999999998 26.924999999999997 19.695 135-139 24.785 28.549999999999997 27.365000000000002 19.3 140-144 25.624999999999996 28.505000000000003 26.14 19.73 145-149 25.515 28.17 26.855 19.46 150-151 26.487500000000004 27.2625 27.625 18.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.5 13 1.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.0 22 0.0 23 1.5 24 4.0 25 5.0 26 6.5 27 9.5 28 10.5 29 12.0 30 15.5 31 18.5 32 26.5 33 39.5 34 45.5 35 58.0 36 90.0 37 118.5 38 149.5 39 178.0 40 190.0 41 219.0 42 254.5 43 280.5 44 292.5 45 282.0 46 257.0 47 256.5 48 238.5 49 184.5 50 162.0 51 141.0 52 111.5 53 81.0 54 60.0 55 43.5 56 28.0 57 25.5 58 20.5 59 16.5 60 14.0 61 10.5 62 6.5 63 6.0 64 5.0 65 1.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 1.5 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.41760350973402 83.35000000000001 2 7.62270359199342 13.900000000000002 3 0.8500137098985467 2.325 4 0.08225939128050452 0.3 5 0.027419797093501508 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAGTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6625 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.7125000000000004 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.425000000000001 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.075 0.0 0.0 0.0 0.0 132-133 5.5 0.0 0.0 0.0 0.0 134-135 6.0 0.0 0.0 0.0 0.0 136-137 6.5375 0.0 0.0 0.0 0.0 138-139 7.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211490 spots for SRR12919398.sra Written 1211490 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra Read 1211475 spots for SRR12919398.sra Written 1211475 spots for SRR12919398.sra SRR ids: ['SRR12919398.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dph87nax SRR12919398.sra spots: 24229515 blocks: [[1, 1211475], [1211476, 2422950], [2422951, 3634425], [3634426, 4845900], [4845901, 6057375], [6057376, 7268850], [7268851, 8480325], [8480326, 9691800], [9691801, 10903275], [10903276, 12114750], [12114751, 13326225], [13326226, 14537700], [14537701, 15749175], [15749176, 16960650], [16960651, 18172125], [18172126, 19383600], [19383601, 20595075], [20595076, 21806550], [21806551, 23018025], [23018026, 24229515]] SRR12919398 file size 8212548 SRR12919398 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919398 SRR12919398_1.fastq SRR12919398_2.fastq Input file: SRR12919398_1.fastq Paired file: SRR12919398_2.fastq trimmed: SRR12919398-trimmed-pair1.fastq, SRR12919398-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:46:28 2025 >> started Thu Feb 13 00:57:47 2025 >> done (679.031s) 24229515 read pairs processed; of these: 39 ( 0.00%) short read pairs filtered out after trimming by size control 453 ( 0.00%) empty read pairs filtered out after trimming by size control 24229023 (100.00%) read pairs available; of these: 2837738 (11.71%) trimmed read pairs available after processing 21391285 (88.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 9 0.00% 23 6 0.00% 24 8 0.00% 25 14 0.00% 26 9 0.00% 27 10 0.00% 28 11 0.00% 29 11 0.00% 30 13 0.00% 31 14 0.00% 32 22 0.00% 33 10 0.00% 34 14 0.00% 35 18 0.00% 36 17 0.00% 37 22 0.00% 38 31 0.00% 39 28 0.00% 40 26 0.00% 41 42 0.00% 42 36 0.00% 43 29 0.00% 44 34 0.00% 45 41 0.00% 46 40 0.00% 47 40 0.00% 48 45 0.00% 49 55 0.00% 50 69 0.00% 51 85 0.00% 52 112 0.00% 53 109 0.00% 54 88 0.00% 55 136 0.00% 56 135 0.00% 57 163 0.00% 58 163 0.00% 59 227 0.00% 60 225 0.00% 61 350 0.00% 62 336 0.00% 63 395 0.00% 64 414 0.00% 65 443 0.00% 66 537 0.00% 67 667 0.00% 68 667 0.00% 69 807 0.00% 70 958 0.00% 71 1125 0.00% 72 1298 0.01% 73 1490 0.01% 74 1689 0.01% 75 1926 0.01% 76 2084 0.01% 77 2357 0.01% 78 2596 0.01% 79 3049 0.01% 80 3300 0.01% 81 3894 0.02% 82 4502 0.02% 83 5087 0.02% 84 5839 0.02% 85 6361 0.03% 86 6919 0.03% 87 7272 0.03% 88 8042 0.03% 89 8402 0.03% 90 9482 0.04% 91 10782 0.04% 92 11616 0.05% 93 12868 0.05% 94 14205 0.06% 95 15199 0.06% 96 16234 0.07% 97 17353 0.07% 98 17924 0.07% 99 19157 0.08% 100 20469 0.08% 101 21558 0.09% 102 23198 0.10% 103 25054 0.10% 104 26384 0.11% 105 27745 0.11% 106 28984 0.12% 107 30106 0.12% 108 30963 0.13% 109 32348 0.13% 110 32507 0.13% 111 34083 0.14% 112 35990 0.15% 113 37128 0.15% 114 38547 0.16% 115 40484 0.17% 116 41291 0.17% 117 42950 0.18% 118 43531 0.18% 119 44479 0.18% 120 45384 0.19% 121 46907 0.19% 122 47285 0.20% 123 49046 0.20% 124 50862 0.21% 125 53318 0.22% 126 54171 0.22% 127 55233 0.23% 128 55477 0.23% 129 56282 0.23% 130 57912 0.24% 131 58123 0.24% 132 59383 0.25% 133 61323 0.25% 134 61909 0.26% 135 63680 0.26% 136 64828 0.27% 137 66495 0.27% 138 66567 0.27% 139 67743 0.28% 140 67930 0.28% 141 69150 0.29% 142 70304 0.29% 143 71225 0.29% 144 74070 0.31% 145 74727 0.31% 146 75431 0.31% 147 75765 0.31% 148 76243 0.31% 149 75764 0.31% 150 77591 0.32% 151 21391285 88.29% 24229023 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.61 prefix-fanout=2.0 sequence=TACAGTCCCCAACAAGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTTTCTCCGATCCGAATTTCTTCCAGTTCCAAACTCCTGTGAAGGCAACAGCCTGCGGCACAGAAACATCACCTGGAACCATTGTTTTCTTATCCAAGCTTCCAGCATTCCCAAAATAGATGACTCCGTGAATGCTGAATCTA criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=28.87 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=7.7 sequence=TCTTCTCATCACTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=40 prefix-density=0.57 prefix-fanout=2.0 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTCTGATGAATGCCTGCCCGGAAAACCCAAAGTTGTCTTTGGATCGAAGAGTTCTACTTCTGATTTTTACGTTCGAAATAAAGCATACGGAGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=390.67 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=10.6 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12919398 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:21:19 Started mapping on | Feb 13 01:21:19 Finished on | Feb 13 01:24:14 Mapping speed, Million of reads per hour | 498.43 Number of input reads | 24229023 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 22563890 Uniquely mapped reads % | 93.13% Average mapped length | 294.96 Number of splices: Total | 21309795 Number of splices: Annotated (sjdb) | 20802632 Number of splices: GT/AG | 20923237 Number of splices: GC/AG | 297712 Number of splices: AT/AC | 27872 Number of splices: Non-canonical | 60974 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 649454 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 100132 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1015679 1015679 1015679 N_multimapping 649454 649454 649454 N_noFeature 822728 22299794 961654 N_ambiguous 264768 1242 138939 UnstrandedReadsAssigned:21476394 PositiveStrandReadsAssigned:262854 NegativeStrandReadsAssigned:21463297 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919398 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919398-trimmed-pair1.fastq SRR12919398-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,229,023 reads, 21,567,462 reads pseudoaligned [quant] estimated average fragment length: 256.516 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR12919398.ke.tsv 34699 SRR12919398.se.tsv 87100 total ==> SRR12919398.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.48 1192 32.4255 Potri.005G024800.1.v4.1 1035 779.484 305 18.7598 Potri.004G059700.1.v4.1 961 705.72 19 1.29079 Potri.007G009000.2.v4.1 1416 1160.48 0 0 Potri.003G141000.2.v4.1 2943 2687.48 697 12.4343 Potri.016G087400.1.v4.1 270 87.0646 1391 765.986 Potri.015G069301.1.v4.1 564 324.426 0 0 Potri.010G195200.1.v4.1 1773 1517.48 236 7.45629 Potri.012G127500.1.v4.1 977 721.607 10720 712.245 ==> SRR12919398.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 53 SRR12919398 completed mapping pipeline successfully