Starting /dee2/code/volunteer_pipeline.sh SRR12919399 current disk space = 3050511290368 free memory = 1580550460 SRR12919399 SRAfilesize ecf11a26398132dfd77da51ec497c54d SRR12919399.sra SRR12919399.sra file validated SRR12919399 is paired end SRR12919399 is conventional basespace SRR12919399 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919399_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5435 37.0 37.0 37.0 37.0 37.0 2 36.3045 37.0 37.0 37.0 37.0 37.0 3 36.587 37.0 37.0 37.0 37.0 37.0 4 36.6395 37.0 37.0 37.0 37.0 37.0 5 36.6405 37.0 37.0 37.0 37.0 37.0 6 36.679 37.0 37.0 37.0 37.0 37.0 7 36.567 37.0 37.0 37.0 37.0 37.0 8 36.588 37.0 37.0 37.0 37.0 37.0 9 36.5955 37.0 37.0 37.0 37.0 37.0 10-14 36.6545 37.0 37.0 37.0 37.0 37.0 15-19 36.613299999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.631099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.537 37.0 37.0 37.0 37.0 37.0 30-34 36.498000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4587 37.0 37.0 37.0 37.0 37.0 40-44 36.497 37.0 37.0 37.0 37.0 37.0 45-49 36.464800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.457100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.4275 37.0 37.0 37.0 37.0 37.0 60-64 36.379000000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3404 37.0 37.0 37.0 37.0 37.0 70-74 36.3211 37.0 37.0 37.0 37.0 37.0 75-79 36.2967 37.0 37.0 37.0 37.0 37.0 80-84 36.339600000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2489 37.0 37.0 37.0 37.0 37.0 90-94 36.2346 37.0 37.0 37.0 37.0 37.0 95-99 36.2388 37.0 37.0 37.0 37.0 37.0 100-104 36.1477 37.0 37.0 37.0 37.0 37.0 105-109 36.1514 37.0 37.0 37.0 37.0 37.0 110-114 36.1465 37.0 37.0 37.0 37.0 37.0 115-119 36.0818 37.0 37.0 37.0 37.0 37.0 120-124 36.093399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.9401 37.0 37.0 37.0 37.0 37.0 130-134 36.0152 37.0 37.0 37.0 37.0 37.0 135-139 35.8786 37.0 37.0 37.0 37.0 37.0 140-144 35.7826 37.0 37.0 37.0 37.0 37.0 145-149 35.7082 37.0 37.0 37.0 37.0 37.0 150-151 35.6695 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 4.0 25 6.0 26 3.0 27 2.0 28 12.0 29 18.0 30 13.0 31 34.0 32 47.0 33 54.0 34 115.0 35 341.0 36 2981.0 37 367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.875 13.05 5.45 43.625 2 19.064386317907445 12.90241448692153 37.90241448692153 30.130784708249497 3 16.775000000000002 15.950000000000001 27.775 39.5 4 19.3 23.75 24.6 32.35 5 22.625 29.2 25.650000000000002 22.525000000000002 6 21.5 33.225 23.275000000000002 22.0 7 14.774999999999999 28.7 39.95 16.575 8 17.549999999999997 25.0 32.925 24.525 9 16.225 23.974999999999998 36.65 23.150000000000002 10-14 18.905 30.049999999999997 27.605 23.44 15-19 19.785 28.360000000000003 27.76 24.095 20-24 19.495 28.83 27.92 23.755000000000003 25-29 19.375 28.725 28.265 23.635 30-34 19.67 28.98 27.615000000000002 23.735 35-39 19.5 28.849999999999998 27.400000000000002 24.25 40-44 19.78 28.675 27.82 23.724999999999998 45-49 19.689999999999998 28.335 28.275 23.7 50-54 20.605 28.244999999999997 27.67 23.48 55-59 19.88 28.65 27.66 23.810000000000002 60-64 19.145 28.515 27.224999999999998 25.115 65-69 19.54 27.97 28.225 24.265 70-74 19.939999999999998 29.185 27.015 23.86 75-79 19.755 28.73 27.900000000000002 23.615 80-84 20.455000000000002 27.694999999999997 27.779999999999998 24.07 85-89 20.32 28.57 27.339999999999996 23.77 90-94 19.875 28.345 27.6 24.18 95-99 19.869999999999997 28.599999999999998 27.834999999999997 23.695 100-104 20.005 28.115000000000002 28.310000000000002 23.57 105-109 20.265 27.93 28.065 23.74 110-114 20.1 28.955 27.57 23.375 115-119 20.21 28.585 27.79 23.415 120-124 20.74 28.405 26.895000000000003 23.96 125-129 20.495 28.625 27.3 23.580000000000002 130-134 20.44 28.965000000000003 27.105 23.49 135-139 20.135 27.985 27.43 24.45 140-144 20.125 27.91 27.685 24.279999999999998 145-149 20.435 28.03 27.005000000000003 24.529999999999998 150-151 20.9875 27.625 27.450000000000003 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.5 22 2.5 23 0.5 24 1.0 25 3.0 26 5.0 27 6.0 28 10.5 29 12.0 30 10.5 31 27.0 32 39.5 33 39.0 34 48.5 35 70.5 36 86.0 37 109.5 38 147.0 39 160.5 40 193.0 41 226.5 42 235.5 43 250.0 44 268.5 45 284.0 46 272.0 47 244.5 48 224.0 49 199.5 50 164.0 51 141.5 52 127.5 53 99.5 54 69.5 55 55.5 56 44.5 57 27.0 58 21.0 59 18.0 60 12.0 61 12.5 62 10.0 63 4.5 64 1.5 65 0.5 66 2.0 67 4.0 68 2.0 69 0.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.35 #Duplication Level Percentage of deduplicated Percentage of total 1 90.81350304371887 82.05 2 8.107360265633647 14.649999999999999 3 0.8024349750968456 2.175 4 0.16602102933038185 0.6 5 0.08301051466519092 0.375 6 0.02767017155506364 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTTTCTCC 6 0.15 No Hit CTCACAACTGCTAAACCCTTGCCCATTCAATGGTGCACCTTCTCCACCTT 5 0.125 No Hit CCCTTGAGATTCAAGCATGTATATTCTTATAACATTATTGTACATAACTC 5 0.125 No Hit GTCAGGGATGGCCATTGCCAGGCGGTAGTCAAATCCAACTCCCCCCTCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.5375 0.0 0.0 0.0 0.0 126-127 4.012499999999999 0.0 0.0 0.0 0.0 128-129 4.4125 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.387499999999999 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138-139 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATTA 10 0.006830828 145.0 8 CACATCA 10 0.006830828 145.0 3 CCACATC 10 0.006830828 145.0 2 ATGAGGT 10 0.006830828 145.0 8 >>END_MODULE SRR12919399 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919399_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3035 37.0 37.0 37.0 37.0 37.0 2 36.258 37.0 37.0 37.0 37.0 37.0 3 36.361 37.0 37.0 37.0 37.0 37.0 4 36.1775 37.0 37.0 37.0 37.0 37.0 5 36.2625 37.0 37.0 37.0 37.0 37.0 6 36.281 37.0 37.0 37.0 37.0 37.0 7 36.191 37.0 37.0 37.0 37.0 37.0 8 36.337 37.0 37.0 37.0 37.0 37.0 9 36.3205 37.0 37.0 37.0 37.0 37.0 10-14 36.318599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3193 37.0 37.0 37.0 37.0 37.0 20-24 36.2986 37.0 37.0 37.0 37.0 37.0 25-29 36.2279 37.0 37.0 37.0 37.0 37.0 30-34 36.2061 37.0 37.0 37.0 37.0 37.0 35-39 36.1707 37.0 37.0 37.0 37.0 37.0 40-44 36.145399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.117000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.1024 37.0 37.0 37.0 37.0 37.0 55-59 36.03189999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.995999999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.0249 37.0 37.0 37.0 37.0 37.0 70-74 35.9647 37.0 37.0 37.0 37.0 37.0 75-79 35.9341 37.0 37.0 37.0 37.0 37.0 80-84 35.948 37.0 37.0 37.0 37.0 37.0 85-89 35.883300000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.757 37.0 37.0 37.0 37.0 37.0 95-99 35.858 37.0 37.0 37.0 37.0 37.0 100-104 35.778999999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.737899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.792 37.0 37.0 37.0 37.0 37.0 115-119 35.7084 37.0 37.0 37.0 37.0 37.0 120-124 35.6054 37.0 37.0 37.0 37.0 37.0 125-129 35.611399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.536500000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.4474 37.0 37.0 37.0 37.0 37.0 140-144 35.4413 37.0 37.0 37.0 37.0 37.0 145-149 35.2275 37.0 37.0 37.0 34.6 37.0 150-151 35.01825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 1.0 14 3.0 15 2.0 16 1.0 17 1.0 18 2.0 19 2.0 20 1.0 21 3.0 22 7.0 23 4.0 24 4.0 25 8.0 26 11.0 27 11.0 28 16.0 29 23.0 30 23.0 31 34.0 32 58.0 33 88.0 34 199.0 35 540.0 36 2631.0 37 324.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.775000000000006 25.900000000000002 9.125 28.199999999999996 2 26.650000000000002 27.275 30.475 15.6 3 19.025 30.0 32.6 18.375 4 21.875 34.975 26.125 17.025000000000002 5 24.85 36.025 21.95 17.175 6 21.475 40.1 21.775 16.650000000000002 7 20.599999999999998 23.150000000000002 37.45 18.8 8 21.7 25.7 28.749999999999996 23.849999999999998 9 21.475 26.174999999999997 31.05 21.3 10-14 23.105 30.115 26.529999999999998 20.25 15-19 23.205000000000002 28.76 27.685 20.349999999999998 20-24 23.055 29.375 27.05 20.52 25-29 23.150000000000002 27.939999999999998 28.02 20.89 30-34 22.994999999999997 28.71 28.134999999999998 20.16 35-39 22.935 28.189999999999998 27.82 21.055 40-44 23.35 28.255000000000003 27.845 20.549999999999997 45-49 23.549999999999997 28.07 27.63 20.75 50-54 23.865 28.499999999999996 27.52 20.115 55-59 23.150000000000002 28.275 28.134999999999998 20.44 60-64 23.64 27.655 28.315 20.39 65-69 23.255 27.935 28.33 20.48 70-74 23.905 28.08 27.46 20.555 75-79 23.575 27.87 28.12 20.435 80-84 23.645 28.675 27.465 20.215 85-89 23.715 28.57 27.79 19.925 90-94 24.04 27.165 28.165000000000003 20.630000000000003 95-99 23.44 27.584999999999997 28.205000000000002 20.77 100-104 24.295 28.315 27.05 20.34 105-109 24.104999999999997 27.715 27.950000000000003 20.23 110-114 24.005000000000003 28.185 27.63 20.18 115-119 24.735 27.91 27.22 20.135 120-124 24.610000000000003 28.044999999999998 27.334999999999997 20.01 125-129 25.295 28.599999999999998 26.779999999999998 19.325 130-134 25.014999999999997 29.03 26.405 19.55 135-139 25.0 28.455000000000002 26.87 19.675 140-144 24.75 27.72 27.639999999999997 19.89 145-149 25.285000000000004 28.52 26.555 19.64 150-151 25.825 28.262500000000003 26.487500000000004 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 1.5 25 1.5 26 3.5 27 6.0 28 9.0 29 8.5 30 14.0 31 28.0 32 34.0 33 44.0 34 59.0 35 64.0 36 84.0 37 119.5 38 154.0 39 187.0 40 209.5 41 232.0 42 256.0 43 264.0 44 284.0 45 293.5 46 261.0 47 235.5 48 212.0 49 188.0 50 162.5 51 136.5 52 104.0 53 70.0 54 54.5 55 44.5 56 37.0 57 32.0 58 24.5 59 14.0 60 10.0 61 7.0 62 5.5 63 4.5 64 4.5 65 4.0 66 3.0 67 2.5 68 2.5 69 1.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.25 #Duplication Level Percentage of deduplicated Percentage of total 1 91.16343490304709 82.27499999999999 2 7.42382271468144 13.4 3 1.080332409972299 2.9250000000000003 4 0.19390581717451524 0.7000000000000001 5 0.08310249307479224 0.375 6 0.02770083102493075 0.15 7 0.02770083102493075 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GTTGCATTTATCTAAAGTATTGTCACTTTACTTAACACTTGAGCTGCATA 6 0.15 No Hit CATTAGGGGGAGGATTGAAGGGGAAATTGGATCATTTCCATATCAGAAAT 5 0.125 No Hit CCAAAATCAAAAACCTTATATACCCGCCCTCGCCGCTTACTGATCGTTGT 5 0.125 No Hit CTTGAGCTACATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.9125 0.0 0.0 0.0 0.0 122-123 3.3375 0.0 0.0 0.0 0.0 124-125 3.6500000000000004 0.0 0.0 0.0 0.0 126-127 4.137499999999999 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.512499999999999 0.0 0.0 0.0 0.0 134-135 5.975 0.0 0.0 0.0 0.0 136-137 6.525 0.0 0.0 0.0 0.0 138-139 7.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATTTT 10 0.006830828 145.0 8 AGATTGG 10 0.006830828 145.0 4 AACATTT 10 0.006830828 145.0 7 >>END_MODULE Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961183 spots for SRR12919399.sra Written 961183 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra Read 961180 spots for SRR12919399.sra Written 961180 spots for SRR12919399.sra SRR ids: ['SRR12919399.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kbqh_rjr SRR12919399.sra spots: 19223603 blocks: [[1, 961180], [961181, 1922360], [1922361, 2883540], [2883541, 3844720], [3844721, 4805900], [4805901, 5767080], [5767081, 6728260], [6728261, 7689440], [7689441, 8650620], [8650621, 9611800], [9611801, 10572980], [10572981, 11534160], [11534161, 12495340], [12495341, 13456520], [13456521, 14417700], [14417701, 15378880], [15378881, 16340060], [16340061, 17301240], [17301241, 18262420], [18262421, 19223603]] SRR12919399 file size 6511320 SRR12919399 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919399 SRR12919399_1.fastq SRR12919399_2.fastq Input file: SRR12919399_1.fastq Paired file: SRR12919399_2.fastq trimmed: SRR12919399-trimmed-pair1.fastq, SRR12919399-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:32:36 2025 >> started Thu Feb 13 00:39:53 2025 >> done (437.291s) 19223603 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 2189 ( 0.01%) empty read pairs filtered out after trimming by size control 19221381 (99.99%) read pairs available; of these: 2119179 (11.03%) trimmed read pairs available after processing 17102202 (88.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 5 0.00% 21 5 0.00% 22 6 0.00% 23 5 0.00% 24 4 0.00% 25 11 0.00% 26 9 0.00% 27 12 0.00% 28 12 0.00% 29 5 0.00% 30 18 0.00% 31 17 0.00% 32 11 0.00% 33 17 0.00% 34 23 0.00% 35 18 0.00% 36 13 0.00% 37 20 0.00% 38 33 0.00% 39 27 0.00% 40 22 0.00% 41 32 0.00% 42 24 0.00% 43 44 0.00% 44 33 0.00% 45 31 0.00% 46 36 0.00% 47 46 0.00% 48 47 0.00% 49 48 0.00% 50 63 0.00% 51 85 0.00% 52 65 0.00% 53 86 0.00% 54 72 0.00% 55 106 0.00% 56 111 0.00% 57 132 0.00% 58 130 0.00% 59 186 0.00% 60 208 0.00% 61 246 0.00% 62 270 0.00% 63 303 0.00% 64 368 0.00% 65 403 0.00% 66 474 0.00% 67 498 0.00% 68 560 0.00% 69 659 0.00% 70 743 0.00% 71 977 0.01% 72 1033 0.01% 73 1209 0.01% 74 1374 0.01% 75 1485 0.01% 76 1796 0.01% 77 1839 0.01% 78 2041 0.01% 79 2358 0.01% 80 2682 0.01% 81 3005 0.02% 82 3557 0.02% 83 3946 0.02% 84 4504 0.02% 85 4909 0.03% 86 5307 0.03% 87 5784 0.03% 88 6230 0.03% 89 6578 0.03% 90 7261 0.04% 91 8034 0.04% 92 8807 0.05% 93 9691 0.05% 94 10718 0.06% 95 11460 0.06% 96 12093 0.06% 97 13120 0.07% 98 13386 0.07% 99 14343 0.07% 100 14892 0.08% 101 16000 0.08% 102 17408 0.09% 103 18324 0.10% 104 19955 0.10% 105 20619 0.11% 106 21521 0.11% 107 22170 0.12% 108 23245 0.12% 109 23566 0.12% 110 23822 0.12% 111 24969 0.13% 112 26419 0.14% 113 26903 0.14% 114 28382 0.15% 115 30262 0.16% 116 30995 0.16% 117 31448 0.16% 118 32489 0.17% 119 32518 0.17% 120 33725 0.18% 121 34393 0.18% 122 35031 0.18% 123 36218 0.19% 124 37937 0.20% 125 39114 0.20% 126 40718 0.21% 127 40898 0.21% 128 41390 0.22% 129 41990 0.22% 130 42522 0.22% 131 43629 0.23% 132 44577 0.23% 133 45359 0.24% 134 45432 0.24% 135 48034 0.25% 136 48558 0.25% 137 49848 0.26% 138 49914 0.26% 139 50763 0.26% 140 51465 0.27% 141 51960 0.27% 142 52879 0.28% 143 52619 0.27% 144 56171 0.29% 145 55800 0.29% 146 57017 0.30% 147 56928 0.30% 148 57481 0.30% 149 57058 0.30% 150 57903 0.30% 151 17102202 88.97% 19221381 reads passed initial QC criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=21 prefix-density=1.11 prefix-fanout=2.1 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=16.51 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=4.5 sequence=CATCCTCATCACCTCCTTCAGCTGAAGGATTTGCACCAATGTCTACATCAACGGCTCCTTGAACAACCCACTTTCCTTCAACTTCCCACAGTATCCCATTCTCAATCTCCTTGTATGGGAACGAATCCGAGAGAAGCTCATCACCAGAGAGAAGATCTTGATAGACCAACATGATTGCGCAGAAGAGCTCCTCTCTTTCGGATCGACCCAAAGACAGACAAAGAAGCAGCGATTG criterion=sequence-density sequence-density=1.64 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=1.62 prefix-fanout=2.0 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=198.62 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=6.8 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCG SRR12919399 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:19:59 Started mapping on | Feb 13 01:20:00 Finished on | Feb 13 01:22:35 Mapping speed, Million of reads per hour | 446.43 Number of input reads | 19221381 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17887512 Uniquely mapped reads % | 93.06% Average mapped length | 295.38 Number of splices: Total | 16652708 Number of splices: Annotated (sjdb) | 16251292 Number of splices: GT/AG | 16367217 Number of splices: GC/AG | 215653 Number of splices: AT/AC | 17132 Number of splices: Non-canonical | 52706 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 610268 % of reads mapped to multiple loci | 3.17% Number of reads mapped to too many loci | 69000 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 723601 723601 723601 N_multimapping 610268 610268 610268 N_noFeature 639054 17709019 734407 N_ambiguous 195875 902 112223 UnstrandedReadsAssigned:17052583 PositiveStrandReadsAssigned:177591 NegativeStrandReadsAssigned:17040882 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919399 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919399-trimmed-pair1.fastq SRR12919399-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,221,381 reads, 17,063,851 reads pseudoaligned [quant] estimated average fragment length: 262.385 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR12919399.ke.tsv 34699 SRR12919399.se.tsv 87100 total ==> SRR12919399.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.62 1254 44.3857 Potri.005G024800.1.v4.1 1035 773.615 407 32.7108 Potri.004G059700.1.v4.1 961 699.791 48 4.26476 Potri.007G009000.2.v4.1 1416 1154.62 0 0 Potri.003G141000.2.v4.1 2943 2681.62 417 9.66856 Potri.016G087400.1.v4.1 270 86.4774 1559 1120.9 Potri.015G069301.1.v4.1 564 318.518 0 0 Potri.010G195200.1.v4.1 1773 1511.62 51 2.09774 Potri.012G127500.1.v4.1 977 715.705 708 61.5066 ==> SRR12919399.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 136 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 132 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 125 SRR12919399 completed mapping pipeline successfully