Starting /dee2/code/volunteer_pipeline.sh SRR12919400 current disk space = 3050476601344 free memory = 1579899444 SRR12919400 SRAfilesize 7137b3280feaafe96ca236fde30ab8ec SRR12919400.sra SRR12919400.sra file validated SRR12919400 is paired end SRR12919400 is conventional basespace SRR12919400 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919400_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6025 37.0 37.0 37.0 37.0 37.0 2 36.2825 37.0 37.0 37.0 37.0 37.0 3 36.5885 37.0 37.0 37.0 37.0 37.0 4 36.6105 37.0 37.0 37.0 37.0 37.0 5 36.5985 37.0 37.0 37.0 37.0 37.0 6 36.655 37.0 37.0 37.0 37.0 37.0 7 36.625 37.0 37.0 37.0 37.0 37.0 8 36.6475 37.0 37.0 37.0 37.0 37.0 9 36.6675 37.0 37.0 37.0 37.0 37.0 10-14 36.671400000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.623000000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.606 37.0 37.0 37.0 37.0 37.0 25-29 36.58669999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.5663 37.0 37.0 37.0 37.0 37.0 35-39 36.557599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.5279 37.0 37.0 37.0 37.0 37.0 45-49 36.4538 37.0 37.0 37.0 37.0 37.0 50-54 36.4345 37.0 37.0 37.0 37.0 37.0 55-59 36.4577 37.0 37.0 37.0 37.0 37.0 60-64 36.4456 37.0 37.0 37.0 37.0 37.0 65-69 36.3905 37.0 37.0 37.0 37.0 37.0 70-74 36.3559 37.0 37.0 37.0 37.0 37.0 75-79 36.3498 37.0 37.0 37.0 37.0 37.0 80-84 36.29559999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2789 37.0 37.0 37.0 37.0 37.0 90-94 36.2472 37.0 37.0 37.0 37.0 37.0 95-99 36.2294 37.0 37.0 37.0 37.0 37.0 100-104 36.1892 37.0 37.0 37.0 37.0 37.0 105-109 36.1362 37.0 37.0 37.0 37.0 37.0 110-114 36.093599999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.0817 37.0 37.0 37.0 37.0 37.0 120-124 36.1028 37.0 37.0 37.0 37.0 37.0 125-129 35.992399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9807 37.0 37.0 37.0 37.0 37.0 135-139 35.855399999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8134 37.0 37.0 37.0 37.0 37.0 145-149 35.751099999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.54975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 4.0 25 1.0 26 4.0 27 7.0 28 9.0 29 9.0 30 16.0 31 30.0 32 55.0 33 75.0 34 123.0 35 303.0 36 2952.0 37 409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.975 12.725 5.3 40.0 2 19.642857142857142 12.90241448692153 36.116700201207244 31.338028169014088 3 17.7 16.225 27.825 38.25 4 21.05 24.625 24.6 29.725 5 22.2 29.7 25.775 22.325 6 20.75 34.599999999999994 23.599999999999998 21.05 7 14.475 26.200000000000003 41.4 17.925 8 17.75 25.874999999999996 32.875 23.5 9 18.0 24.7 34.575 22.725 10-14 20.085 29.470000000000002 27.54 22.905 15-19 19.655 27.955000000000002 28.134999999999998 24.255 20-24 19.305 28.99 27.82 23.885 25-29 19.57 28.17 28.060000000000002 24.2 30-34 20.16 28.494999999999997 27.51 23.835 35-39 20.135 28.665000000000003 27.529999999999998 23.669999999999998 40-44 20.125 28.810000000000002 27.26 23.805 45-49 19.72 28.215 27.51 24.555 50-54 20.095 28.53 27.62 23.755000000000003 55-59 19.5 28.09 28.144999999999996 24.265 60-64 19.835 28.634999999999998 27.575 23.955000000000002 65-69 20.175 28.62 27.134999999999998 24.07 70-74 19.695 28.665000000000003 27.715 23.925 75-79 20.605 28.754999999999995 26.950000000000003 23.69 80-84 20.155 28.21 27.925 23.71 85-89 20.830000000000002 27.939999999999998 27.63 23.599999999999998 90-94 20.544999999999998 28.345 27.36 23.75 95-99 20.415 28.395 27.625 23.565 100-104 20.355 28.134999999999998 27.625 23.885 105-109 21.145 27.345000000000002 27.92 23.59 110-114 21.195 28.025 26.810000000000002 23.97 115-119 21.43 28.025 27.015 23.53 120-124 21.195 28.32 27.02 23.465 125-129 20.685000000000002 28.925 26.375 24.015 130-134 20.724999999999998 27.775 27.224999999999998 24.275 135-139 21.295 27.61 26.674999999999997 24.42 140-144 20.89 28.73 26.005 24.375 145-149 20.845 28.34 26.939999999999998 23.875 150-151 21.2625 27.1125 26.8 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 3.5 25 5.0 26 5.5 27 6.0 28 6.5 29 13.5 30 18.0 31 20.0 32 25.5 33 36.0 34 53.5 35 76.0 36 90.5 37 91.5 38 113.0 39 145.5 40 189.5 41 232.5 42 243.5 43 255.5 44 274.5 45 291.5 46 283.0 47 253.5 48 229.0 49 190.0 50 166.0 51 143.0 52 120.0 53 104.5 54 72.0 55 58.5 56 42.5 57 26.5 58 23.0 59 19.0 60 14.5 61 11.5 62 9.5 63 6.0 64 7.5 65 5.5 66 3.5 67 3.0 68 0.5 69 3.0 70 2.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.31744727471926 83.35000000000001 2 7.970419063270337 14.549999999999999 3 0.5477951246233909 1.5 4 0.16433853738701726 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2625000000000002 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.025 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 4.075 0.0 0.0 0.0 0.0 118-119 4.4 0.0 0.0 0.0 0.0 120-121 4.775 0.0 0.0 0.0 0.0 122-123 5.3125 0.0 0.0 0.0 0.0 124-125 6.075 0.0 0.0 0.0 0.0 126-127 6.5375 0.0 0.0 0.0 0.0 128-129 6.825 0.0 0.0 0.0 0.0 130-131 7.4625 0.0 0.0 0.0 0.0 132-133 8.1125 0.0 0.0 0.0 0.0 134-135 8.725000000000001 0.0 0.0 0.0 0.0 136-137 9.4375 0.0 0.0 0.0 0.0 138-139 10.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGTGA 10 0.006830828 145.0 6 >>END_MODULE SRR12919400 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919400_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.311 37.0 37.0 37.0 37.0 37.0 2 36.2905 37.0 37.0 37.0 37.0 37.0 3 36.323 37.0 37.0 37.0 37.0 37.0 4 36.45 37.0 37.0 37.0 37.0 37.0 5 36.411 37.0 37.0 37.0 37.0 37.0 6 36.408 37.0 37.0 37.0 37.0 37.0 7 36.385 37.0 37.0 37.0 37.0 37.0 8 36.3985 37.0 37.0 37.0 37.0 37.0 9 36.4025 37.0 37.0 37.0 37.0 37.0 10-14 36.38099999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.3178 37.0 37.0 37.0 37.0 37.0 20-24 36.300599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.29670000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.2184 37.0 37.0 37.0 37.0 37.0 35-39 36.2005 37.0 37.0 37.0 37.0 37.0 40-44 36.1503 37.0 37.0 37.0 37.0 37.0 45-49 36.1082 37.0 37.0 37.0 37.0 37.0 50-54 36.130900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.0318 37.0 37.0 37.0 37.0 37.0 60-64 36.044599999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.9954 37.0 37.0 37.0 37.0 37.0 70-74 36.000299999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9397 37.0 37.0 37.0 37.0 37.0 80-84 35.8972 37.0 37.0 37.0 37.0 37.0 85-89 35.8911 37.0 37.0 37.0 37.0 37.0 90-94 35.867000000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8317 37.0 37.0 37.0 37.0 37.0 100-104 35.7911 37.0 37.0 37.0 37.0 37.0 105-109 35.7769 37.0 37.0 37.0 37.0 37.0 110-114 35.705200000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6497 37.0 37.0 37.0 37.0 37.0 120-124 35.619 37.0 37.0 37.0 37.0 37.0 125-129 35.576600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.3663 37.0 37.0 37.0 37.0 37.0 135-139 35.3436 37.0 37.0 37.0 37.0 37.0 140-144 35.2543 37.0 37.0 37.0 32.2 37.0 145-149 35.07430000000001 37.0 37.0 37.0 29.8 37.0 150-151 34.8065 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 3.0 15 1.0 16 1.0 17 1.0 18 1.0 19 2.0 20 5.0 21 5.0 22 1.0 23 3.0 24 9.0 25 14.0 26 5.0 27 8.0 28 10.0 29 18.0 30 27.0 31 42.0 32 56.0 33 103.0 34 189.0 35 494.0 36 2711.0 37 286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.2 25.025 9.725 25.05 2 28.425 25.324999999999996 30.349999999999998 15.9 3 21.525 27.175 33.225 18.075 4 25.174999999999997 34.050000000000004 22.15 18.625 5 24.075 36.025 21.7 18.2 6 21.375 37.925 22.575 18.125 7 20.275000000000002 22.6 38.574999999999996 18.55 8 22.2 25.924999999999997 28.675 23.200000000000003 9 22.475 25.2 31.175000000000004 21.15 10-14 22.900000000000002 29.830000000000002 26.05 21.22 15-19 22.720000000000002 28.48 27.915 20.885 20-24 23.169999999999998 28.34 27.685 20.805 25-29 23.21 28.025 27.32 21.445 30-34 22.945 28.82 27.26 20.974999999999998 35-39 23.41 27.99 27.505000000000003 21.095 40-44 23.165 27.925 27.884999999999998 21.025 45-49 23.715 27.705000000000002 27.705000000000002 20.875 50-54 22.720000000000002 28.035 28.24 21.005 55-59 23.465 27.46 27.925 21.15 60-64 23.665 27.339999999999996 28.189999999999998 20.805 65-69 23.189999999999998 27.93 28.155 20.724999999999998 70-74 23.325000000000003 27.98 27.63 21.065 75-79 23.305 27.855 28.01 20.830000000000002 80-84 23.36 27.975 27.985 20.68 85-89 23.715 28.294999999999998 27.83 20.16 90-94 23.77 27.855 27.96 20.415 95-99 24.185000000000002 28.115000000000002 27.55 20.150000000000002 100-104 23.51 28.294999999999998 27.115000000000002 21.08 105-109 24.22 28.355000000000004 26.83 20.595 110-114 24.5 28.04 27.245 20.215 115-119 24.610000000000003 27.529999999999998 27.6 20.26 120-124 24.884999999999998 28.005000000000003 26.745 20.365 125-129 24.89 27.715 27.029999999999998 20.365 130-134 25.224999999999998 28.71 26.590000000000003 19.475 135-139 25.895000000000003 28.28 26.450000000000003 19.375 140-144 26.355 27.925 26.135 19.585 145-149 26.755000000000003 27.794999999999998 26.085 19.365 150-151 27.0125 28.787499999999998 25.2 19.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 1.5 12 1.5 13 0.0 14 0.5 15 1.0 16 2.0 17 2.0 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 2.0 26 4.0 27 4.5 28 7.0 29 10.0 30 16.0 31 18.0 32 27.0 33 38.0 34 51.0 35 67.0 36 73.5 37 101.5 38 135.0 39 158.5 40 193.0 41 229.0 42 267.0 43 284.0 44 293.5 45 304.0 46 283.5 47 240.5 48 213.5 49 199.0 50 158.5 51 120.5 52 98.5 53 75.5 54 60.0 55 51.5 56 38.0 57 31.0 58 25.5 59 19.5 60 19.0 61 15.0 62 9.5 63 7.5 64 4.5 65 1.5 66 3.5 67 4.0 68 3.0 69 3.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.69398907103825 83.89999999999999 2 7.5683060109289615 13.850000000000001 3 0.5737704918032787 1.575 4 0.1092896174863388 0.4 5 0.0273224043715847 0.125 6 0.0273224043715847 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit TATTTGTTGAAAATGAGGGGAAGAAGCTACAGTTACAGCAGTGATATTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2625000000000002 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.025 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 3.0875000000000004 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 4.075 0.0 0.0 0.0 0.0 118-119 4.4 0.0 0.0 0.0 0.0 120-121 4.775 0.0 0.0 0.0 0.0 122-123 5.3125 0.0 0.0 0.0 0.0 124-125 6.05 0.0 0.0 0.0 0.0 126-127 6.512499999999999 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.425000000000001 0.0 0.0 0.0 0.0 132-133 8.087499999999999 0.0 0.0 0.0 0.0 134-135 8.725000000000001 0.0 0.0 0.0 0.0 136-137 9.4625 0.0 0.0 0.0 0.0 138-139 10.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACAGC 10 0.006830828 145.0 145 >>END_MODULE Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867932 spots for SRR12919400.sra Written 867932 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra Read 867930 spots for SRR12919400.sra Written 867930 spots for SRR12919400.sra SRR ids: ['SRR12919400.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5pr3cn7s SRR12919400.sra spots: 17358602 blocks: [[1, 867930], [867931, 1735860], [1735861, 2603790], [2603791, 3471720], [3471721, 4339650], [4339651, 5207580], [5207581, 6075510], [6075511, 6943440], [6943441, 7811370], [7811371, 8679300], [8679301, 9547230], [9547231, 10415160], [10415161, 11283090], [11283091, 12151020], [12151021, 13018950], [13018951, 13886880], [13886881, 14754810], [14754811, 15622740], [15622741, 16490670], [16490671, 17358602]] SRR12919400 file size 5877512 SRR12919400 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919400 SRR12919400_1.fastq SRR12919400_2.fastq Input file: SRR12919400_1.fastq Paired file: SRR12919400_2.fastq trimmed: SRR12919400-trimmed-pair1.fastq, SRR12919400-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:26:08 2025 >> started Thu Feb 13 00:35:43 2025 >> done (575.222s) 17358602 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 4060 ( 0.02%) empty read pairs filtered out after trimming by size control 17354516 (99.98%) read pairs available; of these: 2501910 (14.42%) trimmed read pairs available after processing 14852606 (85.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 2 0.00% 24 5 0.00% 25 3 0.00% 26 7 0.00% 27 8 0.00% 28 9 0.00% 29 9 0.00% 30 9 0.00% 31 19 0.00% 32 12 0.00% 33 26 0.00% 34 20 0.00% 35 15 0.00% 36 15 0.00% 37 38 0.00% 38 30 0.00% 39 28 0.00% 40 45 0.00% 41 41 0.00% 42 47 0.00% 43 50 0.00% 44 47 0.00% 45 53 0.00% 46 54 0.00% 47 44 0.00% 48 96 0.00% 49 87 0.00% 50 109 0.00% 51 156 0.00% 52 144 0.00% 53 143 0.00% 54 158 0.00% 55 195 0.00% 56 178 0.00% 57 200 0.00% 58 269 0.00% 59 269 0.00% 60 389 0.00% 61 403 0.00% 62 469 0.00% 63 544 0.00% 64 566 0.00% 65 558 0.00% 66 674 0.00% 67 733 0.00% 68 753 0.00% 69 918 0.01% 70 1189 0.01% 71 1382 0.01% 72 1527 0.01% 73 1789 0.01% 74 1906 0.01% 75 2220 0.01% 76 2293 0.01% 77 2505 0.01% 78 2890 0.02% 79 3182 0.02% 80 3662 0.02% 81 4295 0.02% 82 4918 0.03% 83 5331 0.03% 84 6122 0.04% 85 6462 0.04% 86 7140 0.04% 87 7531 0.04% 88 8319 0.05% 89 8856 0.05% 90 9508 0.05% 91 10803 0.06% 92 11718 0.07% 93 13300 0.08% 94 14232 0.08% 95 15175 0.09% 96 16163 0.09% 97 16937 0.10% 98 17730 0.10% 99 18361 0.11% 100 19461 0.11% 101 20572 0.12% 102 22345 0.13% 103 23492 0.14% 104 24892 0.14% 105 26696 0.15% 106 27560 0.16% 107 28103 0.16% 108 29037 0.17% 109 29524 0.17% 110 30116 0.17% 111 31636 0.18% 112 33035 0.19% 113 34181 0.20% 114 35827 0.21% 115 37623 0.22% 116 38367 0.22% 117 39083 0.23% 118 39694 0.23% 119 39943 0.23% 120 40811 0.24% 121 41111 0.24% 122 42663 0.25% 123 44238 0.25% 124 45662 0.26% 125 47092 0.27% 126 48110 0.28% 127 48819 0.28% 128 48944 0.28% 129 49244 0.28% 130 50018 0.29% 131 50224 0.29% 132 51253 0.30% 133 52691 0.30% 134 53591 0.31% 135 54559 0.31% 136 56213 0.32% 137 55530 0.32% 138 56135 0.32% 139 56598 0.33% 140 56894 0.33% 141 57368 0.33% 142 58022 0.33% 143 58191 0.34% 144 59980 0.35% 145 61066 0.35% 146 61423 0.35% 147 62063 0.36% 148 62099 0.36% 149 61520 0.35% 150 62482 0.36% 151 14852606 85.58% 17354516 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=8.11 fanout-score-rank=17 prefix-density=0.33 prefix-fanout=4.3 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=393.04 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=34.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=14.25 fanout-score-rank=15 prefix-density=0.31 prefix-fanout=7.0 sequence=TTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAATCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTGTTTGGTCTTTGCTTATTACAAAGAAGGTGCTACCGATCCAACATTCTTGTACTTTGCCCCTTCTTTGAAGGAGGTCAAGTGCTGAAGAGTGCCAATAGCTGGCCTTGATGTGCAAGTGCTAGCTTTATTAGTTTTAGTTTTATCCTTGAATGCTTTGCTATCTTTTGTTCTGGTGGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=382.32 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=32.0 sequence=AAGAAGAAGAAA SRR12919400 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 00:43:02 Started mapping on | Feb 13 00:43:19 Finished on | Feb 13 01:12:47 Mapping speed, Million of reads per hour | 35.34 Number of input reads | 17354516 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16234722 Uniquely mapped reads % | 93.55% Average mapped length | 293.26 Number of splices: Total | 15383276 Number of splices: Annotated (sjdb) | 15047712 Number of splices: GT/AG | 15100375 Number of splices: GC/AG | 223849 Number of splices: AT/AC | 16627 Number of splices: Non-canonical | 42425 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425438 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 49991 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 694356 694356 694356 N_multimapping 425438 425438 425438 N_noFeature 560525 16034580 660675 N_ambiguous 190074 1030 89396 UnstrandedReadsAssigned:15484123 PositiveStrandReadsAssigned:199112 NegativeStrandReadsAssigned:15484651 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919400 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919400-trimmed-pair1.fastq SRR12919400-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,354,516 reads, 15,573,781 reads pseudoaligned [quant] estimated average fragment length: 247.921 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR12919400.ke.tsv 34699 SRR12919400.se.tsv 87100 total ==> SRR12919400.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.08 750 28.7324 Potri.005G024800.1.v4.1 1035 788.079 174 14.9806 Potri.004G059700.1.v4.1 961 714.199 21 1.99503 Potri.007G009000.2.v4.1 1416 1169.08 0 0 Potri.003G141000.2.v4.1 2943 2696.08 699.099 17.5936 Potri.016G087400.1.v4.1 270 92.8016 1016 742.826 Potri.015G069301.1.v4.1 564 330.613 0 0 Potri.010G195200.1.v4.1 1773 1526.08 53 2.35639 Potri.012G127500.1.v4.1 977 730.129 8855 822.883 ==> SRR12919400.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 127 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 36 SRR12919400 completed mapping pipeline successfully