Starting /dee2/code/volunteer_pipeline.sh SRR12919401 current disk space = 3050723639296 free memory = 1579452880 SRR12919401 SRAfilesize 2822fc42d6d255690dee88f7ac6d31a9 SRR12919401.sra SRR12919401.sra file validated SRR12919401 is paired end SRR12919401 is conventional basespace SRR12919401 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919401_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.62 37.0 37.0 37.0 37.0 37.0 2 36.178 37.0 37.0 37.0 37.0 37.0 3 36.4995 37.0 37.0 37.0 37.0 37.0 4 36.575 37.0 37.0 37.0 37.0 37.0 5 36.6735 37.0 37.0 37.0 37.0 37.0 6 36.625 37.0 37.0 37.0 37.0 37.0 7 36.5725 37.0 37.0 37.0 37.0 37.0 8 36.598 37.0 37.0 37.0 37.0 37.0 9 36.6365 37.0 37.0 37.0 37.0 37.0 10-14 36.628 37.0 37.0 37.0 37.0 37.0 15-19 36.573899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5854 37.0 37.0 37.0 37.0 37.0 25-29 36.5137 37.0 37.0 37.0 37.0 37.0 30-34 36.4899 37.0 37.0 37.0 37.0 37.0 35-39 36.4833 37.0 37.0 37.0 37.0 37.0 40-44 36.4751 37.0 37.0 37.0 37.0 37.0 45-49 36.4547 37.0 37.0 37.0 37.0 37.0 50-54 36.4358 37.0 37.0 37.0 37.0 37.0 55-59 36.4328 37.0 37.0 37.0 37.0 37.0 60-64 36.3269 37.0 37.0 37.0 37.0 37.0 65-69 36.3282 37.0 37.0 37.0 37.0 37.0 70-74 36.3084 37.0 37.0 37.0 37.0 37.0 75-79 36.257999999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2921 37.0 37.0 37.0 37.0 37.0 85-89 36.2121 37.0 37.0 37.0 37.0 37.0 90-94 36.203700000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.201499999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1526 37.0 37.0 37.0 37.0 37.0 105-109 36.057900000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.0905 37.0 37.0 37.0 37.0 37.0 115-119 36.0661 37.0 37.0 37.0 37.0 37.0 120-124 36.024300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9088 37.0 37.0 37.0 37.0 37.0 130-134 35.90899999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.8318 37.0 37.0 37.0 37.0 37.0 140-144 35.6784 37.0 37.0 37.0 37.0 37.0 145-149 35.6568 37.0 37.0 37.0 37.0 37.0 150-151 35.4475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 3.0 24 3.0 25 1.0 26 1.0 27 10.0 28 15.0 29 18.0 30 22.0 31 31.0 32 42.0 33 79.0 34 142.0 35 319.0 36 2889.0 37 422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.85 12.525 7.775 37.85 2 19.567404426559357 13.254527162977867 36.79577464788733 30.38229376257545 3 18.0 17.7 27.775 36.525 4 21.5 25.974999999999998 23.65 28.875 5 22.375 30.475 24.925 22.225 6 19.325 33.45 24.425 22.8 7 14.174999999999999 27.250000000000004 40.625 17.95 8 18.375 25.55 31.5 24.575 9 16.225 24.625 34.375 24.775 10-14 20.03 28.999999999999996 28.175 22.795 15-19 20.13 28.16 28.13 23.580000000000002 20-24 19.955000000000002 28.76 27.655 23.630000000000003 25-29 19.74 28.610000000000003 27.91 23.74 30-34 19.89 28.389999999999997 27.72 24.0 35-39 20.505000000000003 28.360000000000003 27.6 23.535 40-44 20.21 28.444999999999997 27.62 23.724999999999998 45-49 19.96 28.57 27.145000000000003 24.325 50-54 19.57 28.335 27.915 24.18 55-59 19.98 28.22 27.905 23.895 60-64 20.345 28.449999999999996 27.525 23.68 65-69 20.27 28.71 27.675 23.345 70-74 19.955000000000002 28.63 27.365000000000002 24.05 75-79 20.19 28.42 27.72 23.669999999999998 80-84 20.305 28.26 27.900000000000002 23.535 85-89 20.74 28.59 27.47 23.200000000000003 90-94 20.525 28.115000000000002 27.495000000000005 23.865 95-99 20.585 28.21 27.12 24.085 100-104 21.025 28.645 26.529999999999998 23.799999999999997 105-109 21.075 27.785 27.125 24.015 110-114 20.515 28.32 27.560000000000002 23.605 115-119 20.66 28.32 26.86 24.16 120-124 20.474999999999998 28.595 26.995 23.935000000000002 125-129 21.04 27.72 27.12 24.12 130-134 20.835 28.249999999999996 26.674999999999997 24.240000000000002 135-139 20.724999999999998 28.12 26.66 24.495 140-144 21.12 28.01 26.700000000000003 24.169999999999998 145-149 21.46 27.800000000000004 26.810000000000002 23.93 150-151 21.087500000000002 28.5625 25.662499999999998 24.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 2.0 26 2.5 27 6.5 28 10.5 29 17.5 30 25.0 31 29.5 32 30.5 33 34.5 34 52.0 35 61.0 36 79.0 37 108.5 38 122.0 39 145.5 40 197.0 41 232.0 42 235.0 43 256.5 44 283.0 45 271.5 46 246.0 47 245.0 48 228.5 49 199.5 50 173.5 51 157.5 52 133.5 53 90.0 54 68.5 55 54.0 56 46.0 57 35.5 58 23.5 59 20.0 60 18.0 61 12.5 62 6.5 63 6.0 64 6.0 65 4.5 66 2.5 67 1.5 68 4.0 69 4.0 70 0.5 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.81446111869032 84.125 2 7.3669849931787175 13.5 3 0.7094133697135061 1.95 4 0.08185538881309685 0.3 5 0.027285129604365622 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTTGCTGGTGGTGGGGTGGCGGGAGGAGGAGTTGCTGGTGGTGGGGTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.6 0.0 0.0 0.0 0.0 110-111 2.9749999999999996 0.0 0.0 0.0 0.0 112-113 3.275 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.075 0.0 0.0 0.0 0.0 118-119 4.5875 0.0 0.0 0.0 0.0 120-121 5.0375 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 6.0125 0.0 0.0 0.0 0.0 126-127 6.6875 0.0 0.0 0.0 0.0 128-129 7.237500000000001 0.0 0.0 0.0 0.0 130-131 7.9625 0.0 0.0 0.0 0.0 132-133 8.425 0.0 0.0 0.0 0.0 134-135 9.075 0.0 0.0 0.0 0.0 136-137 9.45 0.0 0.0 0.0 0.0 138-139 9.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACACA 10 0.006830828 145.0 2 GTGAAGA 10 0.006830828 145.0 1 >>END_MODULE SRR12919401 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919401_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2365 37.0 37.0 37.0 37.0 37.0 2 36.2025 37.0 37.0 37.0 37.0 37.0 3 36.2125 37.0 37.0 37.0 37.0 37.0 4 36.2515 37.0 37.0 37.0 37.0 37.0 5 36.394 37.0 37.0 37.0 37.0 37.0 6 36.2815 37.0 37.0 37.0 37.0 37.0 7 36.353 37.0 37.0 37.0 37.0 37.0 8 36.323 37.0 37.0 37.0 37.0 37.0 9 36.4195 37.0 37.0 37.0 37.0 37.0 10-14 36.2787 37.0 37.0 37.0 37.0 37.0 15-19 36.29109999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2587 37.0 37.0 37.0 37.0 37.0 25-29 36.2067 37.0 37.0 37.0 37.0 37.0 30-34 36.145399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0799 37.0 37.0 37.0 37.0 37.0 40-44 36.126599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.08239999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.0601 37.0 37.0 37.0 37.0 37.0 55-59 36.0168 37.0 37.0 37.0 37.0 37.0 60-64 35.9662 37.0 37.0 37.0 37.0 37.0 65-69 35.9855 37.0 37.0 37.0 37.0 37.0 70-74 35.935199999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.9477 37.0 37.0 37.0 37.0 37.0 80-84 35.8876 37.0 37.0 37.0 37.0 37.0 85-89 35.8391 37.0 37.0 37.0 37.0 37.0 90-94 35.80740000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.7649 37.0 37.0 37.0 37.0 37.0 100-104 35.7573 37.0 37.0 37.0 37.0 37.0 105-109 35.743100000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6188 37.0 37.0 37.0 37.0 37.0 115-119 35.6293 37.0 37.0 37.0 37.0 37.0 120-124 35.532 37.0 37.0 37.0 37.0 37.0 125-129 35.550200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.42550000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.1874 37.0 37.0 37.0 29.8 37.0 140-144 35.12500000000001 37.0 37.0 37.0 29.8 37.0 145-149 34.887100000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.629999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 3.0 15 1.0 16 2.0 17 0.0 18 1.0 19 3.0 20 1.0 21 3.0 22 6.0 23 5.0 24 5.0 25 8.0 26 13.0 27 16.0 28 16.0 29 14.0 30 38.0 31 46.0 32 67.0 33 109.0 34 198.0 35 482.0 36 2642.0 37 315.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.1 24.875 9.525 26.5 2 26.875 27.250000000000004 29.9 15.975 3 20.175 28.875 31.8 19.15 4 23.875 34.925 24.15 17.05 5 24.15 37.1 22.2 16.55 6 21.825 38.675 21.575 17.925 7 19.725 22.575 38.675 19.025 8 21.65 24.925 26.650000000000002 26.775 9 21.8 25.724999999999998 30.65 21.825 10-14 24.125 29.154999999999998 26.055 20.665 15-19 23.535 27.47 27.46 21.535 20-24 22.634999999999998 28.04 27.825 21.5 25-29 23.435 27.875 28.139999999999997 20.549999999999997 30-34 24.145 27.955000000000002 27.08 20.82 35-39 23.565 27.735 27.3 21.4 40-44 24.19 27.85 27.555000000000003 20.405 45-49 23.76 27.79 27.884999999999998 20.565 50-54 24.13 27.975 27.505000000000003 20.39 55-59 23.355 28.144999999999996 27.944999999999997 20.555 60-64 23.94 27.22 28.525 20.315 65-69 23.64 27.715 27.61 21.035 70-74 23.549999999999997 27.875 27.51 21.065 75-79 24.11 28.199999999999996 27.58 20.11 80-84 23.400000000000002 28.244999999999997 27.279999999999998 21.075 85-89 23.635 28.26 27.075 21.029999999999998 90-94 24.14 27.655 27.925 20.28 95-99 24.47 28.155 27.3 20.075000000000003 100-104 24.345 27.935 27.32 20.4 105-109 24.945 28.410000000000004 26.72 19.925 110-114 24.52 27.834999999999997 27.589999999999996 20.055 115-119 24.91 28.389999999999997 26.834999999999997 19.865 120-124 24.224999999999998 28.444999999999997 27.200000000000003 20.13 125-129 25.39 27.955000000000002 26.625 20.03 130-134 26.314999999999998 27.985 26.595000000000002 19.105 135-139 25.66 28.384999999999998 26.31 19.645000000000003 140-144 26.235000000000003 28.13 26.165 19.470000000000002 145-149 26.96 27.405 26.235000000000003 19.400000000000002 150-151 27.2625 27.9375 26.3 18.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.0 23 1.0 24 1.5 25 2.0 26 3.0 27 5.0 28 6.5 29 8.5 30 14.0 31 23.5 32 32.5 33 32.5 34 35.0 35 54.5 36 77.0 37 96.5 38 131.5 39 169.5 40 189.0 41 220.5 42 248.5 43 263.0 44 267.0 45 274.0 46 285.5 47 265.0 48 234.5 49 205.5 50 174.0 51 144.5 52 111.0 53 85.0 54 72.0 55 54.5 56 41.0 57 42.5 58 35.5 59 22.5 60 17.5 61 12.5 62 7.0 63 4.0 64 4.0 65 2.0 66 2.0 67 3.0 68 1.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.95088676671213 84.25 2 7.175989085948157 13.15 3 0.7094133697135061 1.95 4 0.1364256480218281 0.5 5 0.0 0.0 6 0.027285129604365622 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGCTGGTCAAGCACCAGCAACGTCACCAACAGCAACACCAGCACCACC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.65 0.0 0.0 0.0 0.0 110-111 3.0250000000000004 0.0 0.0 0.0 0.0 112-113 3.3375000000000004 0.0 0.0 0.0 0.0 114-115 3.8625 0.0 0.0 0.0 0.0 116-117 4.1875 0.0 0.0 0.0 0.0 118-119 4.7125 0.0 0.0 0.0 0.0 120-121 5.1875 0.0 0.0 0.0 0.0 122-123 5.675 0.0 0.0 0.0 0.0 124-125 6.1875 0.0 0.0 0.0 0.0 126-127 6.8875 0.0 0.0 0.0 0.0 128-129 7.4625 0.0 0.0 0.0 0.0 130-131 8.162500000000001 0.0 0.0 0.0 0.0 132-133 8.625 0.0 0.0 0.0 0.0 134-135 9.275 0.0 0.0 0.0 0.0 136-137 9.675 0.0 0.0 0.0 0.0 138-139 10.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027559 spots for SRR12919401.sra Written 1027559 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra Read 1027558 spots for SRR12919401.sra Written 1027558 spots for SRR12919401.sra SRR ids: ['SRR12919401.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_okmfefdi SRR12919401.sra spots: 20551161 blocks: [[1, 1027558], [1027559, 2055116], [2055117, 3082674], [3082675, 4110232], [4110233, 5137790], [5137791, 6165348], [6165349, 7192906], [7192907, 8220464], [8220465, 9248022], [9248023, 10275580], [10275581, 11303138], [11303139, 12330696], [12330697, 13358254], [13358255, 14385812], [14385813, 15413370], [15413371, 16440928], [16440929, 17468486], [17468487, 18496044], [18496045, 19523602], [19523603, 20551161]] SRR12919401 file size 6962483 SRR12919401 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919401 SRR12919401_1.fastq SRR12919401_2.fastq Input file: SRR12919401_1.fastq Paired file: SRR12919401_2.fastq trimmed: SRR12919401-trimmed-pair1.fastq, SRR12919401-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:42:27 2025 >> started Thu Feb 13 00:49:37 2025 >> done (430.394s) 20551161 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 1735 ( 0.01%) empty read pairs filtered out after trimming by size control 20549395 (99.99%) read pairs available; of these: 3142508 (15.29%) trimmed read pairs available after processing 17406887 (84.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 7 0.00% 22 5 0.00% 23 5 0.00% 24 11 0.00% 25 9 0.00% 26 8 0.00% 27 14 0.00% 28 9 0.00% 29 10 0.00% 30 19 0.00% 31 9 0.00% 32 22 0.00% 33 13 0.00% 34 12 0.00% 35 11 0.00% 36 22 0.00% 37 23 0.00% 38 24 0.00% 39 21 0.00% 40 28 0.00% 41 40 0.00% 42 46 0.00% 43 53 0.00% 44 45 0.00% 45 47 0.00% 46 48 0.00% 47 64 0.00% 48 81 0.00% 49 86 0.00% 50 119 0.00% 51 115 0.00% 52 138 0.00% 53 132 0.00% 54 147 0.00% 55 189 0.00% 56 203 0.00% 57 226 0.00% 58 317 0.00% 59 336 0.00% 60 427 0.00% 61 533 0.00% 62 612 0.00% 63 703 0.00% 64 745 0.00% 65 867 0.00% 66 861 0.00% 67 959 0.00% 68 1097 0.01% 69 1339 0.01% 70 1552 0.01% 71 1909 0.01% 72 2244 0.01% 73 2634 0.01% 74 2921 0.01% 75 3220 0.02% 76 3576 0.02% 77 3885 0.02% 78 4148 0.02% 79 4663 0.02% 80 5386 0.03% 81 6304 0.03% 82 7194 0.04% 83 8223 0.04% 84 9027 0.04% 85 10107 0.05% 86 10381 0.05% 87 11061 0.05% 88 11615 0.06% 89 12716 0.06% 90 13841 0.07% 91 15375 0.07% 92 16925 0.08% 93 18644 0.09% 94 19915 0.10% 95 21391 0.10% 96 22269 0.11% 97 23050 0.11% 98 23458 0.11% 99 24932 0.12% 100 26065 0.13% 101 27187 0.13% 102 29487 0.14% 103 31656 0.15% 104 33321 0.16% 105 34100 0.17% 106 35786 0.17% 107 36362 0.18% 108 37007 0.18% 109 38077 0.19% 110 38424 0.19% 111 39713 0.19% 112 41795 0.20% 113 43159 0.21% 114 45457 0.22% 115 47475 0.23% 116 47999 0.23% 117 49095 0.24% 118 49320 0.24% 119 49804 0.24% 120 50478 0.25% 121 51820 0.25% 122 53200 0.26% 123 54682 0.27% 124 56709 0.28% 125 58131 0.28% 126 59651 0.29% 127 60329 0.29% 128 60362 0.29% 129 60528 0.29% 130 61105 0.30% 131 60644 0.30% 132 62526 0.30% 133 63980 0.31% 134 65409 0.32% 135 66893 0.33% 136 68191 0.33% 137 68171 0.33% 138 69409 0.34% 139 68816 0.33% 140 68891 0.34% 141 69459 0.34% 142 70909 0.35% 143 71097 0.35% 144 73643 0.36% 145 74729 0.36% 146 75160 0.37% 147 75485 0.37% 148 76071 0.37% 149 75424 0.37% 150 75886 0.37% 151 17406887 84.71% 20549395 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=5.74 fanout-score-rank=26 prefix-density=0.42 prefix-fanout=3.6 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=357.91 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=32.3 sequence=CTTCTTCTTGAG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=35 prefix-density=0.29 prefix-fanout=2.6 sequence=CATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTGACATCGTTGACACATTTAGGCTCCAGGAGCAACCTCCATTTGACAAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=298.72 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=27.0 sequence=TTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGATACATTAGCATGGGATAACATCATAGGATTTCGATCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGTCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATTGGCGGATGTTGCTTTTAGGACTCCGCCAGCACCTTATGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTTGATTCT SRR12919401 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:17:58 Started mapping on | Feb 13 01:17:58 Finished on | Feb 13 01:21:19 Mapping speed, Million of reads per hour | 368.05 Number of input reads | 20549395 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18510017 Uniquely mapped reads % | 90.08% Average mapped length | 292.59 Number of splices: Total | 17004834 Number of splices: Annotated (sjdb) | 16625599 Number of splices: GT/AG | 16677132 Number of splices: GC/AG | 257133 Number of splices: AT/AC | 21577 Number of splices: Non-canonical | 48992 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483631 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 157219 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.57% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1555747 1555747 1555747 N_multimapping 483631 483631 483631 N_noFeature 652918 18264296 767695 N_ambiguous 232716 1429 100781 UnstrandedReadsAssigned:17624383 PositiveStrandReadsAssigned:244292 NegativeStrandReadsAssigned:17641541 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919401 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919401-trimmed-pair1.fastq SRR12919401-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,549,395 reads, 17,867,613 reads pseudoaligned [quant] estimated average fragment length: 243.391 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR12919401.ke.tsv 34699 SRR12919401.se.tsv 87100 total ==> SRR12919401.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.61 860 27.1056 Potri.005G024800.1.v4.1 1035 792.609 275 19.417 Potri.004G059700.1.v4.1 961 718.753 46 3.58167 Potri.007G009000.2.v4.1 1416 1173.61 0 0 Potri.003G141000.2.v4.1 2943 2700.61 592.18 12.2716 Potri.016G087400.1.v4.1 270 93.8929 1856.17 1106.35 Potri.015G069301.1.v4.1 564 334.799 0 0 Potri.010G195200.1.v4.1 1773 1530.61 73 2.66911 Potri.012G127500.1.v4.1 977 734.685 12519 953.622 ==> SRR12919401.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 151 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12919401 completed mapping pipeline successfully