Starting /dee2/code/volunteer_pipeline.sh SRR12919402 current disk space = 3050457194496 free memory = 1413421152 SRR12919402 SRAfilesize bef240d73b21c013e1a9e24c9db461d3 SRR12919402.sra SRR12919402.sra file validated SRR12919402 is paired end SRR12919402 is conventional basespace SRR12919402 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919402_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4845 37.0 37.0 37.0 37.0 37.0 2 36.332 37.0 37.0 37.0 37.0 37.0 3 36.68 37.0 37.0 37.0 37.0 37.0 4 36.6245 37.0 37.0 37.0 37.0 37.0 5 36.6905 37.0 37.0 37.0 37.0 37.0 6 36.6115 37.0 37.0 37.0 37.0 37.0 7 36.6 37.0 37.0 37.0 37.0 37.0 8 36.687 37.0 37.0 37.0 37.0 37.0 9 36.6265 37.0 37.0 37.0 37.0 37.0 10-14 36.6469 37.0 37.0 37.0 37.0 37.0 15-19 36.613600000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.6302 37.0 37.0 37.0 37.0 37.0 25-29 36.565 37.0 37.0 37.0 37.0 37.0 30-34 36.543099999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.49400000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4955 37.0 37.0 37.0 37.0 37.0 45-49 36.4631 37.0 37.0 37.0 37.0 37.0 50-54 36.4485 37.0 37.0 37.0 37.0 37.0 55-59 36.4219 37.0 37.0 37.0 37.0 37.0 60-64 36.4461 37.0 37.0 37.0 37.0 37.0 65-69 36.38590000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3527 37.0 37.0 37.0 37.0 37.0 75-79 36.2976 37.0 37.0 37.0 37.0 37.0 80-84 36.283500000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1974 37.0 37.0 37.0 37.0 37.0 90-94 36.204899999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.204899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1466 37.0 37.0 37.0 37.0 37.0 105-109 36.112300000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.051 37.0 37.0 37.0 37.0 37.0 115-119 36.02419999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.021899999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.93910000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.9007 37.0 37.0 37.0 37.0 37.0 135-139 35.847699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.6786 37.0 37.0 37.0 37.0 37.0 145-149 35.6963 37.0 37.0 37.0 37.0 37.0 150-151 35.50675 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 3.0 24 2.0 25 2.0 26 5.0 27 8.0 28 8.0 29 22.0 30 26.0 31 27.0 32 45.0 33 53.0 34 132.0 35 315.0 36 2956.0 37 393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.125 12.9 7.8 45.175 2 19.26559356136821 13.380281690140844 38.179074446680076 29.175050301810867 3 17.575 17.45 27.0 37.974999999999994 4 20.875 26.125 24.224999999999998 28.775000000000002 5 21.525 34.325 23.9 20.25 6 21.0 34.825 23.5 20.674999999999997 7 15.4 27.0 40.5 17.1 8 17.2 26.6 31.6 24.6 9 15.925 24.4 35.375 24.3 10-14 18.72 29.875 28.54 22.865 15-19 19.595000000000002 28.21 28.105000000000004 24.09 20-24 19.205 28.28 28.494999999999997 24.02 25-29 18.775 28.465 28.62 24.14 30-34 19.655 28.71 27.589999999999996 24.044999999999998 35-39 19.605 28.625 27.644999999999996 24.125 40-44 19.435 29.18 27.315 24.07 45-49 18.935 28.384999999999998 28.595 24.085 50-54 19.395 28.144999999999996 28.465 23.995 55-59 19.49 29.23 27.284999999999997 23.995 60-64 19.994999999999997 28.01 28.115000000000002 23.880000000000003 65-69 19.21 28.084999999999997 28.749999999999996 23.955000000000002 70-74 19.68 28.415000000000003 27.96 23.945 75-79 20.05 28.455000000000002 27.965 23.53 80-84 20.485 27.439999999999998 27.99 24.085 85-89 20.215 28.38 27.73 23.674999999999997 90-94 20.255000000000003 29.07 27.785 22.89 95-99 20.305 28.144999999999996 28.28 23.27 100-104 19.900000000000002 28.59 27.700000000000003 23.810000000000002 105-109 19.794999999999998 28.365000000000002 28.084999999999997 23.755000000000003 110-114 20.25 28.555000000000003 27.365000000000002 23.830000000000002 115-119 20.155 29.115000000000002 27.265 23.465 120-124 20.235 27.88 27.925 23.96 125-129 20.345 28.34 27.855 23.46 130-134 20.14 27.889999999999997 28.235 23.735 135-139 20.595 27.625 28.29 23.49 140-144 20.335 28.375 27.200000000000003 24.09 145-149 21.04 28.694999999999997 27.060000000000002 23.205000000000002 150-151 21.125 29.075 26.187500000000004 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 3.0 24 4.0 25 4.5 26 4.0 27 4.0 28 6.0 29 14.0 30 20.5 31 23.5 32 34.0 33 48.0 34 59.5 35 70.0 36 91.5 37 117.5 38 133.0 39 160.5 40 200.0 41 226.0 42 261.0 43 274.0 44 266.0 45 260.0 46 271.0 47 271.5 48 232.0 49 196.5 50 171.0 51 142.0 52 111.5 53 80.5 54 60.0 55 51.5 56 30.5 57 19.5 58 16.0 59 15.5 60 11.5 61 5.0 62 5.5 63 4.0 64 4.0 65 5.5 66 2.5 67 1.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.41524958859023 83.325 2 7.652221612726276 13.950000000000001 3 0.7953922106417993 2.175 4 0.08228195282501372 0.3 5 0.054854635216675815 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAATCAGATTTAAACACCAAAGATGCTGAAGCCAAAGCTGCTGCAGTTTC 5 0.125 No Hit CTAGTCAATATTCTTTTAAAATCTTGGTAATTTTCAGATACAATGCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 2.9625000000000004 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.9375 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.15 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTCACG 10 0.006830828 145.0 145 >>END_MODULE SRR12919402 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919402_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3075 37.0 37.0 37.0 37.0 37.0 2 36.2275 37.0 37.0 37.0 37.0 37.0 3 36.2515 37.0 37.0 37.0 37.0 37.0 4 36.2115 37.0 37.0 37.0 37.0 37.0 5 36.2675 37.0 37.0 37.0 37.0 37.0 6 36.2115 37.0 37.0 37.0 37.0 37.0 7 36.316 37.0 37.0 37.0 37.0 37.0 8 36.2725 37.0 37.0 37.0 37.0 37.0 9 36.283 37.0 37.0 37.0 37.0 37.0 10-14 36.3365 37.0 37.0 37.0 37.0 37.0 15-19 36.2667 37.0 37.0 37.0 37.0 37.0 20-24 36.238299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.178700000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.103500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.109 37.0 37.0 37.0 37.0 37.0 40-44 36.13960000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.063 37.0 37.0 37.0 37.0 37.0 50-54 36.0715 37.0 37.0 37.0 37.0 37.0 55-59 36.0613 37.0 37.0 37.0 37.0 37.0 60-64 35.995400000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9068 37.0 37.0 37.0 37.0 37.0 70-74 35.8778 37.0 37.0 37.0 37.0 37.0 75-79 35.84439999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.8507 37.0 37.0 37.0 37.0 37.0 85-89 35.8284 37.0 37.0 37.0 37.0 37.0 90-94 35.757999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7838 37.0 37.0 37.0 37.0 37.0 100-104 35.7044 37.0 37.0 37.0 37.0 37.0 105-109 35.711200000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6649 37.0 37.0 37.0 37.0 37.0 115-119 35.6042 37.0 37.0 37.0 37.0 37.0 120-124 35.544200000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.546299999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4268 37.0 37.0 37.0 37.0 37.0 135-139 35.272600000000004 37.0 37.0 37.0 32.2 37.0 140-144 35.2537 37.0 37.0 37.0 32.2 37.0 145-149 35.1276 37.0 37.0 37.0 27.4 37.0 150-151 34.8925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 2.0 15 3.0 16 1.0 17 2.0 18 1.0 19 2.0 20 0.0 21 1.0 22 8.0 23 4.0 24 7.0 25 6.0 26 11.0 27 9.0 28 13.0 29 21.0 30 27.0 31 41.0 32 59.0 33 115.0 34 222.0 35 577.0 36 2603.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.725 23.75 12.675 28.849999999999998 2 28.125 26.125 30.9 14.85 3 19.775000000000002 28.449999999999996 33.175 18.6 4 23.05 34.150000000000006 25.45 17.349999999999998 5 25.0 35.375 21.2 18.425 6 20.525 41.275 21.625 16.575 7 20.625 21.775 38.525 19.075 8 20.25 26.25 28.575 24.925 9 21.525 25.3 30.65 22.525000000000002 10-14 23.03 28.305000000000003 27.334999999999997 21.33 15-19 23.895 27.750000000000004 27.61 20.745 20-24 22.96 28.83 27.175 21.035 25-29 23.04 28.115000000000002 28.03 20.815 30-34 22.62 28.144999999999996 28.575 20.66 35-39 23.09 28.410000000000004 27.525 20.974999999999998 40-44 23.34 28.615000000000002 27.49 20.555 45-49 23.29 27.939999999999998 28.07 20.7 50-54 23.5 28.825 27.565 20.11 55-59 23.265 27.584999999999997 28.585 20.565 60-64 22.73 29.110000000000003 27.834999999999997 20.325 65-69 23.49 27.97 28.82 19.72 70-74 23.294999999999998 28.585 27.295 20.825 75-79 23.044999999999998 28.53 27.965 20.46 80-84 23.255 28.134999999999998 28.000000000000004 20.61 85-89 23.49 28.449999999999996 27.775 20.285 90-94 23.285 27.985 28.560000000000002 20.169999999999998 95-99 23.630000000000003 28.175 27.615000000000002 20.580000000000002 100-104 23.62 28.27 27.889999999999997 20.22 105-109 23.805 28.310000000000002 27.860000000000003 20.025000000000002 110-114 24.33 27.595 27.725 20.349999999999998 115-119 24.490000000000002 28.470000000000002 27.235 19.805 120-124 24.67 28.139999999999997 27.05 20.14 125-129 24.25 28.59 27.265 19.895 130-134 24.965 27.395000000000003 27.810000000000002 19.830000000000002 135-139 24.985 28.720000000000002 26.87 19.425 140-144 25.169999999999998 28.215 27.250000000000004 19.365 145-149 25.8 27.894999999999996 27.229999999999997 19.075 150-151 26.3625 28.5875 26.150000000000002 18.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 1.5 18 1.5 19 0.0 20 0.5 21 2.0 22 1.5 23 1.5 24 2.5 25 4.5 26 5.5 27 5.0 28 8.0 29 12.0 30 18.0 31 26.5 32 40.0 33 49.0 34 53.0 35 66.5 36 92.5 37 117.5 38 139.0 39 165.0 40 202.5 41 233.0 42 260.0 43 290.5 44 296.5 45 273.0 46 242.0 47 235.5 48 230.5 49 194.0 50 159.0 51 127.0 52 100.0 53 80.5 54 57.5 55 45.5 56 33.5 57 30.5 58 24.0 59 12.0 60 10.0 61 8.5 62 5.0 63 4.0 64 3.0 65 1.0 66 2.0 67 2.0 68 1.0 69 2.0 70 2.5 71 1.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.7054475773337 83.75 2 7.445934848070079 13.600000000000001 3 0.6296194908294552 1.725 4 0.16424856282507527 0.6 5 0.027374760470845878 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027374760470845878 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GCTACAGTACTTTCATGGGCCATCCTTGAGTATGGAGGTCAAATGGCTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.3 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 4.975 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.637499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGTGA 10 0.006830828 145.0 145 CTAAACA 10 0.006830828 145.0 8 >>END_MODULE Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra Read 1099554 spots for SRR12919402.sra Written 1099554 spots for SRR12919402.sra Read 1099551 spots for SRR12919402.sra Written 1099551 spots for SRR12919402.sra SRR ids: ['SRR12919402.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jadcejxh SRR12919402.sra spots: 21991023 blocks: [[1, 1099551], [1099552, 2199102], [2199103, 3298653], [3298654, 4398204], [4398205, 5497755], [5497756, 6597306], [6597307, 7696857], [7696858, 8796408], [8796409, 9895959], [9895960, 10995510], [10995511, 12095061], [12095062, 13194612], [13194613, 14294163], [14294164, 15393714], [15393715, 16493265], [16493266, 17592816], [17592817, 18692367], [18692368, 19791918], [19791919, 20891469], [20891470, 21991023]] SRR12919402 file size 7451811 SRR12919402 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919402 SRR12919402_1.fastq SRR12919402_2.fastq Input file: SRR12919402_1.fastq Paired file: SRR12919402_2.fastq trimmed: SRR12919402-trimmed-pair1.fastq, SRR12919402-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 23:00:53 2025 >> started Wed Feb 12 23:08:05 2025 >> done (431.474s) 21991023 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 304 ( 0.00%) empty read pairs filtered out after trimming by size control 21990689 (100.00%) read pairs available; of these: 1927884 ( 8.77%) trimmed read pairs available after processing 20062805 (91.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 10 0.00% 25 5 0.00% 26 6 0.00% 27 11 0.00% 28 9 0.00% 29 14 0.00% 30 12 0.00% 31 11 0.00% 32 13 0.00% 33 11 0.00% 34 13 0.00% 35 12 0.00% 36 20 0.00% 37 15 0.00% 38 21 0.00% 39 25 0.00% 40 20 0.00% 41 31 0.00% 42 26 0.00% 43 25 0.00% 44 26 0.00% 45 29 0.00% 46 37 0.00% 47 52 0.00% 48 49 0.00% 49 48 0.00% 50 50 0.00% 51 78 0.00% 52 77 0.00% 53 80 0.00% 54 77 0.00% 55 103 0.00% 56 72 0.00% 57 136 0.00% 58 137 0.00% 59 185 0.00% 60 185 0.00% 61 237 0.00% 62 280 0.00% 63 275 0.00% 64 296 0.00% 65 337 0.00% 66 355 0.00% 67 402 0.00% 68 441 0.00% 69 609 0.00% 70 708 0.00% 71 796 0.00% 72 951 0.00% 73 1015 0.00% 74 1089 0.00% 75 1203 0.01% 76 1282 0.01% 77 1503 0.01% 78 1669 0.01% 79 1867 0.01% 80 2129 0.01% 81 2550 0.01% 82 2985 0.01% 83 3362 0.02% 84 3649 0.02% 85 3957 0.02% 86 4221 0.02% 87 4524 0.02% 88 4979 0.02% 89 5384 0.02% 90 6038 0.03% 91 6701 0.03% 92 7493 0.03% 93 8336 0.04% 94 9265 0.04% 95 9615 0.04% 96 10080 0.05% 97 10908 0.05% 98 11262 0.05% 99 11853 0.05% 100 12677 0.06% 101 13414 0.06% 102 14797 0.07% 103 15851 0.07% 104 16919 0.08% 105 17839 0.08% 106 18471 0.08% 107 18820 0.09% 108 19753 0.09% 109 20124 0.09% 110 20539 0.09% 111 21873 0.10% 112 22984 0.10% 113 24020 0.11% 114 25645 0.12% 115 26547 0.12% 116 27566 0.13% 117 27925 0.13% 118 28510 0.13% 119 28766 0.13% 120 29976 0.14% 121 30785 0.14% 122 31409 0.14% 123 33133 0.15% 124 34432 0.16% 125 35621 0.16% 126 37071 0.17% 127 37622 0.17% 128 37753 0.17% 129 38225 0.17% 130 38658 0.18% 131 39228 0.18% 132 40674 0.18% 133 42435 0.19% 134 43639 0.20% 135 44754 0.20% 136 45834 0.21% 137 46289 0.21% 138 46696 0.21% 139 46919 0.21% 140 47649 0.22% 141 48543 0.22% 142 49489 0.23% 143 50011 0.23% 144 52527 0.24% 145 53476 0.24% 146 54220 0.25% 147 54880 0.25% 148 55196 0.25% 149 55277 0.25% 150 56059 0.25% 151 20062805 91.23% 21990689 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=30 prefix-density=0.28 prefix-fanout=2.1 sequence=GCTTTATTTCGAACGTAAAAATCAGAAGTAGAACTCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATT criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=136.85 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=19.1 sequence=TCCTTCTTCACAAT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=28 prefix-density=0.50 prefix-fanout=2.0 sequence=TTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=359.10 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=12.7 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGAATGCTAACACTGACGCTATTTCTGCTGTTTGTCAAGATGGGGTTCTGACTGTTACTGTTGAGAAATTACCACCTCCTGAGCCTAAGAAGCCTAAGACTAT SRR12919402 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 23:25:49 Started mapping on | Feb 12 23:26:03 Finished on | Feb 13 00:33:30 Mapping speed, Million of reads per hour | 19.56 Number of input reads | 21990689 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20392135 Uniquely mapped reads % | 92.73% Average mapped length | 296.37 Number of splices: Total | 19444933 Number of splices: Annotated (sjdb) | 18945039 Number of splices: GT/AG | 19074591 Number of splices: GC/AG | 286006 Number of splices: AT/AC | 23623 Number of splices: Non-canonical | 60713 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.03% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 570745 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 46896 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.30% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1027809 1027809 1027809 N_multimapping 570745 570745 570745 N_noFeature 795183 20161046 908893 N_ambiguous 246151 1252 128057 UnstrandedReadsAssigned:19350801 PositiveStrandReadsAssigned:229837 NegativeStrandReadsAssigned:19355185 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919402 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919402-trimmed-pair1.fastq SRR12919402-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,990,689 reads, 19,406,832 reads pseudoaligned [quant] estimated average fragment length: 273.334 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR12919402.ke.tsv 34699 SRR12919402.se.tsv 87100 total ==> SRR12919402.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.67 1196 38.2086 Potri.005G024800.1.v4.1 1035 762.666 261 19.0852 Potri.004G059700.1.v4.1 961 688.88 61 4.9383 Potri.007G009000.2.v4.1 1416 1143.67 1 0.0487632 Potri.003G141000.2.v4.1 2943 2670.67 617.211 12.8886 Potri.016G087400.1.v4.1 270 82.1963 1408 955.304 Potri.015G069301.1.v4.1 564 308.808 0 0 Potri.010G195200.1.v4.1 1773 1500.67 76 2.82437 Potri.012G127500.1.v4.1 977 704.755 10882 861.116 ==> SRR12919402.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 236 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 195 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 49 SRR12919402 completed mapping pipeline successfully