Starting /dee2/code/volunteer_pipeline.sh SRR12919403 current disk space = 3050458025984 free memory = 1460503840 SRR12919403 SRAfilesize de483cbf297384754bc8e0440cdc7b94 SRR12919403.sra SRR12919403.sra file validated SRR12919403 is paired end SRR12919403 is conventional basespace SRR12919403 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919403_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.605 37.0 37.0 37.0 37.0 37.0 2 36.41475 37.0 37.0 37.0 37.0 37.0 3 36.6035 37.0 37.0 37.0 37.0 37.0 4 36.699 37.0 37.0 37.0 37.0 37.0 5 36.6535 37.0 37.0 37.0 37.0 37.0 6 36.63 37.0 37.0 37.0 37.0 37.0 7 36.5465 37.0 37.0 37.0 37.0 37.0 8 36.5505 37.0 37.0 37.0 37.0 37.0 9 36.603 37.0 37.0 37.0 37.0 37.0 10-14 36.6255 37.0 37.0 37.0 37.0 37.0 15-19 36.5854 37.0 37.0 37.0 37.0 37.0 20-24 36.613800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5424 37.0 37.0 37.0 37.0 37.0 30-34 36.5169 37.0 37.0 37.0 37.0 37.0 35-39 36.4961 37.0 37.0 37.0 37.0 37.0 40-44 36.479699999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.4727 37.0 37.0 37.0 37.0 37.0 50-54 36.3932 37.0 37.0 37.0 37.0 37.0 55-59 36.437599999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.350300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.329 37.0 37.0 37.0 37.0 37.0 70-74 36.3211 37.0 37.0 37.0 37.0 37.0 75-79 36.3517 37.0 37.0 37.0 37.0 37.0 80-84 36.306 37.0 37.0 37.0 37.0 37.0 85-89 36.1704 37.0 37.0 37.0 37.0 37.0 90-94 36.170100000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.1414 37.0 37.0 37.0 37.0 37.0 100-104 36.1312 37.0 37.0 37.0 37.0 37.0 105-109 36.1286 37.0 37.0 37.0 37.0 37.0 110-114 35.987 37.0 37.0 37.0 37.0 37.0 115-119 35.9795 37.0 37.0 37.0 37.0 37.0 120-124 35.955799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.863699999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.896100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.7897 37.0 37.0 37.0 37.0 37.0 140-144 35.746599999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.7213 37.0 37.0 37.0 37.0 37.0 150-151 35.6195 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 2.0 25 0.0 26 7.0 27 11.0 28 13.0 29 21.0 30 16.0 31 38.0 32 46.0 33 67.0 34 118.0 35 297.0 36 2954.0 37 404.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.3 12.325 5.775 39.6 2 19.121706398996235 12.421580928481808 38.46925972396487 29.98745294855709 3 15.299999999999999 17.349999999999998 29.65 37.7 4 21.224999999999998 24.95 24.05 29.775000000000002 5 20.674999999999997 32.2 25.124999999999996 22.0 6 20.05 35.699999999999996 24.6 19.650000000000002 7 15.275 26.5 40.575 17.65 8 16.025 25.224999999999998 34.050000000000004 24.7 9 17.175 23.575 35.75 23.5 10-14 20.064999999999998 29.544999999999998 27.55 22.84 15-19 19.685 28.345 28.525 23.445 20-24 19.545 28.715000000000003 28.08 23.66 25-29 19.355 28.38 28.384999999999998 23.880000000000003 30-34 19.355 28.599999999999998 28.26 23.785 35-39 20.18 28.08 27.900000000000002 23.84 40-44 19.455 28.73 28.28 23.535 45-49 19.945 28.96 27.175 23.919999999999998 50-54 19.775000000000002 28.95 28.225 23.05 55-59 19.78 27.805000000000003 28.07 24.345 60-64 19.43 28.605000000000004 28.08 23.885 65-69 20.349999999999998 27.76 28.29 23.599999999999998 70-74 20.21 28.384999999999998 27.68 23.724999999999998 75-79 19.2 28.82 28.27 23.71 80-84 19.55 28.08 27.950000000000003 24.42 85-89 19.99 28.17 27.905 23.935000000000002 90-94 19.52 28.22 28.26 24.0 95-99 19.78 28.660000000000004 27.725 23.835 100-104 19.915 28.555000000000003 28.095 23.435 105-109 19.665 28.825 27.365000000000002 24.145 110-114 20.419999999999998 28.425 27.605 23.549999999999997 115-119 19.634999999999998 29.244999999999997 26.974999999999998 24.145 120-124 20.005 28.925 27.334999999999997 23.735 125-129 20.805 28.345 27.555000000000003 23.294999999999998 130-134 20.560000000000002 28.725 27.450000000000003 23.265 135-139 20.755000000000003 28.27 27.284999999999997 23.69 140-144 20.24 28.13 27.375 24.255 145-149 21.145 28.634999999999998 26.525 23.695 150-151 21.212500000000002 28.075 26.737499999999997 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 3.5 25 3.5 26 5.0 27 7.5 28 9.0 29 13.0 30 18.0 31 27.0 32 38.0 33 42.5 34 54.0 35 66.5 36 86.0 37 120.5 38 137.0 39 161.5 40 199.5 41 240.5 42 249.0 43 235.5 44 274.5 45 297.0 46 259.0 47 231.5 48 222.0 49 212.0 50 181.0 51 130.5 52 103.5 53 87.0 54 72.0 55 55.0 56 40.0 57 33.5 58 22.0 59 12.5 60 11.5 61 10.0 62 5.0 63 2.5 64 2.5 65 1.5 66 1.5 67 2.0 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.14411441144115 82.85 2 7.81078107810781 14.2 3 0.935093509350935 2.55 4 0.11001100110011 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.7249999999999996 0.0 0.0 0.0 0.0 128-129 3.9875 0.0 0.0 0.0 0.0 130-131 4.3625 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.175 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATCGA 10 0.006830828 145.0 4 CATCGAA 10 0.006830828 145.0 5 TTTTATA 25 8.7132835E-4 87.0 6 AAAAAAA 50 0.0013298223 17.4 75-79 >>END_MODULE SRR12919403 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12919403_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3045 37.0 37.0 37.0 37.0 37.0 2 36.261 37.0 37.0 37.0 37.0 37.0 3 36.3 37.0 37.0 37.0 37.0 37.0 4 36.298 37.0 37.0 37.0 37.0 37.0 5 36.438 37.0 37.0 37.0 37.0 37.0 6 36.3305 37.0 37.0 37.0 37.0 37.0 7 36.3955 37.0 37.0 37.0 37.0 37.0 8 36.429 37.0 37.0 37.0 37.0 37.0 9 36.483 37.0 37.0 37.0 37.0 37.0 10-14 36.4365 37.0 37.0 37.0 37.0 37.0 15-19 36.3972 37.0 37.0 37.0 37.0 37.0 20-24 36.3712 37.0 37.0 37.0 37.0 37.0 25-29 36.34400000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.3115 37.0 37.0 37.0 37.0 37.0 35-39 36.2337 37.0 37.0 37.0 37.0 37.0 40-44 36.2629 37.0 37.0 37.0 37.0 37.0 45-49 36.2601 37.0 37.0 37.0 37.0 37.0 50-54 36.2524 37.0 37.0 37.0 37.0 37.0 55-59 36.1648 37.0 37.0 37.0 37.0 37.0 60-64 36.158899999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.1714 37.0 37.0 37.0 37.0 37.0 70-74 36.102799999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.092200000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.02590000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.06420000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.9675 37.0 37.0 37.0 37.0 37.0 95-99 36.0027 37.0 37.0 37.0 37.0 37.0 100-104 35.974399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8729 37.0 37.0 37.0 37.0 37.0 110-114 35.9092 37.0 37.0 37.0 37.0 37.0 115-119 35.8295 37.0 37.0 37.0 37.0 37.0 120-124 35.816700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.728 37.0 37.0 37.0 37.0 37.0 130-134 35.6884 37.0 37.0 37.0 37.0 37.0 135-139 35.6023 37.0 37.0 37.0 37.0 37.0 140-144 35.5791 37.0 37.0 37.0 37.0 37.0 145-149 35.5125 37.0 37.0 37.0 37.0 37.0 150-151 35.36225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 2.0 19 0.0 20 2.0 21 4.0 22 1.0 23 4.0 24 4.0 25 6.0 26 6.0 27 11.0 28 20.0 29 24.0 30 18.0 31 25.0 32 51.0 33 98.0 34 175.0 35 462.0 36 2729.0 37 356.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.35 24.325 9.049999999999999 26.275 2 25.575 25.7 33.225 15.5 3 19.45 26.05 34.9 19.6 4 22.575 34.449999999999996 25.25 17.724999999999998 5 25.25 36.8 21.975 15.975 6 20.875 38.9 22.650000000000002 17.575 7 20.549999999999997 22.8 38.275 18.375 8 22.025 27.150000000000002 27.125 23.7 9 22.35 23.925 30.3 23.425 10-14 22.285 29.49 27.675 20.549999999999997 15-19 23.73 28.225 27.26 20.785 20-24 22.605 28.38 28.215 20.8 25-29 22.925 28.725 27.474999999999998 20.875 30-34 22.68 28.7 28.060000000000002 20.560000000000002 35-39 22.7 28.54 28.13 20.630000000000003 40-44 22.965 28.535 28.144999999999996 20.355 45-49 23.119999999999997 28.194999999999997 28.03 20.655 50-54 23.095 28.110000000000003 28.265 20.53 55-59 22.515 28.65 28.355000000000004 20.48 60-64 23.385 27.91 28.775000000000002 19.93 65-69 23.745 28.134999999999998 28.199999999999996 19.919999999999998 70-74 23.605 28.07 28.015 20.31 75-79 23.7 27.189999999999998 28.84 20.27 80-84 23.26 28.46 28.17 20.11 85-89 23.674999999999997 28.13 27.975 20.22 90-94 23.565 28.51 28.09 19.835 95-99 23.185 28.23 28.34 20.244999999999997 100-104 23.5 28.599999999999998 27.425 20.474999999999998 105-109 23.669999999999998 28.865000000000002 27.834999999999997 19.63 110-114 23.65 27.76 28.22 20.369999999999997 115-119 24.57 28.244999999999997 27.655 19.53 120-124 24.805 28.465 26.935 19.794999999999998 125-129 24.845 28.03 27.355 19.77 130-134 24.23 28.65 27.47 19.650000000000002 135-139 25.09 28.044999999999998 26.979999999999997 19.885 140-144 24.72 28.7 26.695 19.885 145-149 25.575 28.535 26.56 19.33 150-151 24.8125 28.3125 28.050000000000004 18.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 3.5 24 3.5 25 5.0 26 6.0 27 4.5 28 8.5 29 11.0 30 17.5 31 28.5 32 35.5 33 44.5 34 59.0 35 66.0 36 82.0 37 112.0 38 145.5 39 173.5 40 193.0 41 238.5 42 273.5 43 295.5 44 304.0 45 281.0 46 265.5 47 253.5 48 224.5 49 182.0 50 143.0 51 121.0 52 106.0 53 81.5 54 54.5 55 40.0 56 37.5 57 29.0 58 18.0 59 12.5 60 9.5 61 8.5 62 5.5 63 1.0 64 1.5 65 1.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.54310818231741 83.35000000000001 2 7.303679297089512 13.3 3 0.9884678747940692 2.7 4 0.10982976386600769 0.4 5 0.054914881933003847 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTAGATACTAGTAGTAGTTGCAGACAGAGAGCTAGTGTTAGACAGGTTC 5 0.125 No Hit CTAAAAGTCTGTTGGCTGATAGGGAGGGCAATCGGATCATAAAGATTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.4625000000000004 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.05 0.0 0.0 0.0 0.0 130-131 4.425000000000001 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.6625 0.0 0.0 0.0 0.0 138-139 6.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra Read 866288 spots for SRR12919403.sra Written 866288 spots for SRR12919403.sra Read 866284 spots for SRR12919403.sra Written 866284 spots for SRR12919403.sra SRR ids: ['SRR12919403.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jazvptbs SRR12919403.sra spots: 17325684 blocks: [[1, 866284], [866285, 1732568], [1732569, 2598852], [2598853, 3465136], [3465137, 4331420], [4331421, 5197704], [5197705, 6063988], [6063989, 6930272], [6930273, 7796556], [7796557, 8662840], [8662841, 9529124], [9529125, 10395408], [10395409, 11261692], [11261693, 12127976], [12127977, 12994260], [12994261, 13860544], [13860545, 14726828], [14726829, 15593112], [15593113, 16459396], [16459397, 17325684]] SRR12919403 file size 5866325 SRR12919403 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12919403 SRR12919403_1.fastq SRR12919403_2.fastq Input file: SRR12919403_1.fastq Paired file: SRR12919403_2.fastq trimmed: SRR12919403-trimmed-pair1.fastq, SRR12919403-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 23:28:00 2025 >> started Wed Feb 12 23:34:37 2025 >> done (396.995s) 17325684 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 149 ( 0.00%) empty read pairs filtered out after trimming by size control 17325511 (100.00%) read pairs available; of these: 1754814 (10.13%) trimmed read pairs available after processing 15570697 (89.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 0 0.00% 21 5 0.00% 22 8 0.00% 23 6 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 5 0.00% 28 6 0.00% 29 10 0.00% 30 7 0.00% 31 16 0.00% 32 8 0.00% 33 12 0.00% 34 11 0.00% 35 10 0.00% 36 11 0.00% 37 16 0.00% 38 14 0.00% 39 13 0.00% 40 21 0.00% 41 20 0.00% 42 25 0.00% 43 18 0.00% 44 21 0.00% 45 21 0.00% 46 27 0.00% 47 23 0.00% 48 41 0.00% 49 33 0.00% 50 35 0.00% 51 54 0.00% 52 53 0.00% 53 57 0.00% 54 60 0.00% 55 74 0.00% 56 83 0.00% 57 69 0.00% 58 93 0.00% 59 105 0.00% 60 141 0.00% 61 154 0.00% 62 202 0.00% 63 213 0.00% 64 232 0.00% 65 251 0.00% 66 273 0.00% 67 321 0.00% 68 370 0.00% 69 452 0.00% 70 518 0.00% 71 604 0.00% 72 663 0.00% 73 805 0.00% 74 845 0.00% 75 968 0.01% 76 1094 0.01% 77 1104 0.01% 78 1337 0.01% 79 1534 0.01% 80 1735 0.01% 81 2045 0.01% 82 2283 0.01% 83 2582 0.01% 84 3069 0.02% 85 3303 0.02% 86 3480 0.02% 87 3902 0.02% 88 4244 0.02% 89 4565 0.03% 90 5098 0.03% 91 5647 0.03% 92 6400 0.04% 93 6976 0.04% 94 7699 0.04% 95 8297 0.05% 96 8813 0.05% 97 9403 0.05% 98 9862 0.06% 99 10698 0.06% 100 11121 0.06% 101 11943 0.07% 102 12796 0.07% 103 13948 0.08% 104 14929 0.09% 105 15956 0.09% 106 16499 0.10% 107 16965 0.10% 108 17713 0.10% 109 18468 0.11% 110 18615 0.11% 111 19719 0.11% 112 21014 0.12% 113 22287 0.13% 114 23363 0.13% 115 24409 0.14% 116 24683 0.14% 117 25467 0.15% 118 26616 0.15% 119 26359 0.15% 120 27395 0.16% 121 28448 0.16% 122 29213 0.17% 123 30452 0.18% 124 31864 0.18% 125 32667 0.19% 126 33767 0.19% 127 33981 0.20% 128 34531 0.20% 129 35577 0.21% 130 36003 0.21% 131 36540 0.21% 132 38451 0.22% 133 39001 0.23% 134 39637 0.23% 135 41180 0.24% 136 41997 0.24% 137 42295 0.24% 138 42992 0.25% 139 43602 0.25% 140 43502 0.25% 141 44906 0.26% 142 45834 0.26% 143 45922 0.27% 144 48396 0.28% 145 49393 0.29% 146 48798 0.28% 147 50084 0.29% 148 50281 0.29% 149 50482 0.29% 150 51461 0.30% 151 15570697 89.87% 17325511 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=10.67 fanout-score-rank=19 prefix-density=0.20 prefix-fanout=5.9 sequence=CAATTTTCTCAATAGCTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=420.55 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=33.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=35 prefix-density=0.20 prefix-fanout=2.8 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=521.89 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=9.5 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGA SRR12919403 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 00:17:57 Started mapping on | Feb 13 00:18:07 Finished on | Feb 13 01:12:47 Mapping speed, Million of reads per hour | 19.02 Number of input reads | 17325511 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16122242 Uniquely mapped reads % | 93.05% Average mapped length | 295.96 Number of splices: Total | 15191745 Number of splices: Annotated (sjdb) | 14833937 Number of splices: GT/AG | 14911147 Number of splices: GC/AG | 218288 Number of splices: AT/AC | 16707 Number of splices: Non-canonical | 45603 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.03 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 387984 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 46590 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.33% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 815285 815285 815285 N_multimapping 387984 387984 387984 N_noFeature 643305 15933407 739368 N_ambiguous 186361 939 93014 UnstrandedReadsAssigned:15292576 PositiveStrandReadsAssigned:187896 NegativeStrandReadsAssigned:15289860 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12919403 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12919403-trimmed-pair1.fastq SRR12919403-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,325,511 reads, 15,337,931 reads pseudoaligned [quant] estimated average fragment length: 263.188 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR12919403.ke.tsv 34699 SRR12919403.se.tsv 87100 total ==> SRR12919403.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.81 677 27.054 Potri.005G024800.1.v4.1 1035 772.812 188 17.0689 Potri.004G059700.1.v4.1 961 699.044 34 3.41268 Potri.007G009000.2.v4.1 1416 1153.81 0 0 Potri.003G141000.2.v4.1 2943 2680.81 642 16.8031 Potri.016G087400.1.v4.1 270 83.8965 1035 865.6 Potri.015G069301.1.v4.1 564 318.661 0 0 Potri.010G195200.1.v4.1 1773 1510.81 85 3.94757 Potri.012G127500.1.v4.1 977 714.938 7640 749.801 ==> SRR12919403.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 104 SRR12919403 completed mapping pipeline successfully