Starting /dee2/code/volunteer_pipeline.sh SRR13259380 current disk space = 3088065765376 free memory = 1564058416 SRR13259380 SRAfilesize 33943a860d8c1ce174efebe5034637d5 SRR13259380.sra SRR13259380.sra file validated SRR13259380 is paired end SRR13259380 is conventional basespace SRR13259380 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259380_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5845 37.0 37.0 37.0 37.0 37.0 2 36.615 37.0 37.0 37.0 37.0 37.0 3 36.61 37.0 37.0 37.0 37.0 37.0 4 36.617 37.0 37.0 37.0 37.0 37.0 5 36.702 37.0 37.0 37.0 37.0 37.0 6 36.621 37.0 37.0 37.0 37.0 37.0 7 36.591 37.0 37.0 37.0 37.0 37.0 8 36.667 37.0 37.0 37.0 37.0 37.0 9 36.6595 37.0 37.0 37.0 37.0 37.0 10-14 36.6078 37.0 37.0 37.0 37.0 37.0 15-19 36.612 37.0 37.0 37.0 37.0 37.0 20-24 36.52140000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.4662 37.0 37.0 37.0 37.0 37.0 30-34 36.4388 37.0 37.0 37.0 37.0 37.0 35-39 36.415800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.397800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3471 37.0 37.0 37.0 37.0 37.0 50-54 36.3384 37.0 37.0 37.0 37.0 37.0 55-59 36.291700000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.260000000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.167500000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.202600000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.157500000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.186 37.0 37.0 37.0 37.0 37.0 85-89 36.1434 37.0 37.0 37.0 37.0 37.0 90-94 36.1216 37.0 37.0 37.0 37.0 37.0 95-99 36.0654 37.0 37.0 37.0 37.0 37.0 100-104 35.925599999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0067 37.0 37.0 37.0 37.0 37.0 110-114 35.986999999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.8496 37.0 37.0 37.0 37.0 37.0 120-124 35.896499999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.7496 37.0 37.0 37.0 37.0 37.0 130-134 35.5661 37.0 37.0 37.0 37.0 37.0 135-139 35.6534 37.0 37.0 37.0 37.0 37.0 140-144 35.7902 37.0 37.0 37.0 37.0 37.0 145-149 35.5671 37.0 37.0 37.0 37.0 37.0 150 35.471 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 3.0 19 1.0 20 2.0 21 3.0 22 4.0 23 0.0 24 6.0 25 0.0 26 7.0 27 11.0 28 13.0 29 20.0 30 24.0 31 42.0 32 44.0 33 62.0 34 85.0 35 303.0 36 3161.0 37 207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.125 16.825000000000003 22.0 31.05 2 22.825 23.325000000000003 35.175 18.675 3 21.975 29.625 27.375 21.025 4 23.724999999999998 35.375 20.45 20.45 5 22.225 36.95 21.625 19.2 6 18.375 38.675 22.675 20.275000000000002 7 18.05 17.125 41.325 23.5 8 19.625 21.775 28.825 29.775000000000002 9 19.950000000000003 22.900000000000002 28.725 28.425 10-14 21.235 29.459999999999997 26.705000000000002 22.6 15-19 21.505 27.935 27.955000000000002 22.605 20-24 20.635 29.154999999999998 28.065 22.145 25-29 21.959999999999997 28.23 28.225 21.584999999999997 30-34 21.84 28.32 27.515 22.325 35-39 22.055 28.470000000000002 27.58 21.895 40-44 22.075 28.87 26.810000000000002 22.245 45-49 22.400000000000002 28.515 27.365000000000002 21.72 50-54 20.919999999999998 28.185 28.1 22.795 55-59 22.037203720372037 28.44784478447845 27.522752275227525 21.992199219921993 60-64 21.177117711771174 29.282928292829286 27.357735773577357 22.182218221822183 65-69 22.18 28.360000000000003 27.76 21.7 70-74 21.945 28.595 27.084999999999997 22.375 75-79 22.255 28.37 27.584999999999997 21.790000000000003 80-84 22.17 28.735 27.195000000000004 21.9 85-89 21.59 28.34 27.884999999999998 22.185 90-94 22.53 28.665000000000003 27.345000000000002 21.46 95-99 21.77 27.765 28.51 21.955 100-104 22.439999999999998 28.439999999999998 27.185 21.935 105-109 21.59 27.889999999999997 28.13 22.39 110-114 21.815 27.589999999999996 28.410000000000004 22.185 115-119 22.185 27.755000000000003 27.565 22.495 120-124 22.305 27.3 28.28 22.115000000000002 125-129 22.325 28.139999999999997 27.805000000000003 21.73 130-134 22.805 27.6 27.565 22.03 135-139 22.16 27.415 28.275 22.15 140-144 22.1 27.32 28.075 22.505 145-149 22.08 28.07 28.395 21.455 150 22.375 28.1 27.325 22.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 2.5 25 7.5 26 11.0 27 12.5 28 15.5 29 16.5 30 25.0 31 32.5 32 40.5 33 52.5 34 68.0 35 88.5 36 94.0 37 112.5 38 144.0 39 177.5 40 198.0 41 201.5 42 223.0 43 248.0 44 251.0 45 246.0 46 252.5 47 225.0 48 198.5 49 197.5 50 158.0 51 115.0 52 108.5 53 97.0 54 77.5 55 62.0 56 41.5 57 31.0 58 28.5 59 23.5 60 24.0 61 19.5 62 11.5 63 10.5 64 9.0 65 8.0 66 5.5 67 4.5 68 3.0 69 2.0 70 3.0 71 3.0 72 3.0 73 2.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.29669687225957 72.95 2 12.774042677579656 21.85 3 1.7831043554516222 4.575 4 0.08769365682548962 0.3 5 0.0 0.0 6 0.029231218941829874 0.15 7 0.029231218941829874 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTTGGCCTAAGGGTCACAACTTCCAGTTCTTCAAATTAGACATCGAGGA 7 0.17500000000000002 No Hit GGCAAACCCGCATAGGATTCTCACAAAAAAAGAAGGTGTTTCACCAAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGTG 10 0.006973645 144.0 3 >>END_MODULE SRR13259380 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259380_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.529 37.0 37.0 37.0 37.0 37.0 2 36.429 37.0 37.0 37.0 37.0 37.0 3 36.4925 37.0 37.0 37.0 37.0 37.0 4 36.4745 37.0 37.0 37.0 37.0 37.0 5 36.548 37.0 37.0 37.0 37.0 37.0 6 36.437 37.0 37.0 37.0 37.0 37.0 7 36.444 37.0 37.0 37.0 37.0 37.0 8 36.5095 37.0 37.0 37.0 37.0 37.0 9 36.5125 37.0 37.0 37.0 37.0 37.0 10-14 36.5292 37.0 37.0 37.0 37.0 37.0 15-19 36.526599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5284 37.0 37.0 37.0 37.0 37.0 25-29 36.4302 37.0 37.0 37.0 37.0 37.0 30-34 36.4382 37.0 37.0 37.0 37.0 37.0 35-39 36.4273 37.0 37.0 37.0 37.0 37.0 40-44 36.343900000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.323 37.0 37.0 37.0 37.0 37.0 50-54 36.24929999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.2255 37.0 37.0 37.0 37.0 37.0 60-64 36.1247 37.0 37.0 37.0 37.0 37.0 65-69 36.159299999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.1718 37.0 37.0 37.0 37.0 37.0 75-79 36.011 37.0 37.0 37.0 37.0 37.0 80-84 36.0375 37.0 37.0 37.0 37.0 37.0 85-89 35.839600000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9142 37.0 37.0 37.0 37.0 37.0 95-99 35.8699 37.0 37.0 37.0 37.0 37.0 100-104 35.8442 37.0 37.0 37.0 37.0 37.0 105-109 35.8075 37.0 37.0 37.0 37.0 37.0 110-114 35.7649 37.0 37.0 37.0 37.0 37.0 115-119 35.7692 37.0 37.0 37.0 37.0 37.0 120-124 35.6217 37.0 37.0 37.0 37.0 37.0 125-129 35.6865 37.0 37.0 37.0 37.0 37.0 130-134 35.5447 37.0 37.0 37.0 37.0 37.0 135-139 35.4551 37.0 37.0 37.0 37.0 37.0 140-144 35.593599999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.3478 37.0 37.0 37.0 32.2 37.0 150 35.4525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 0.0 23 2.0 24 5.0 25 4.0 26 9.0 27 10.0 28 8.0 29 15.0 30 28.0 31 34.0 32 43.0 33 61.0 34 131.0 35 540.0 36 2971.0 37 134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.55 17.150000000000002 22.45 32.85 2 22.8 24.8 33.550000000000004 18.85 3 22.425 29.925 27.3 20.349999999999998 4 24.875 35.025 20.5 19.6 5 23.225 35.925000000000004 21.45 19.400000000000002 6 18.45 38.975 22.75 19.825 7 18.325 17.375 41.625 22.675 8 20.1 22.725 28.1 29.075 9 21.099999999999998 24.15 28.775000000000002 25.974999999999998 10-14 21.135 29.154999999999998 26.215 23.494999999999997 15-19 21.955 28.945 27.089999999999996 22.009999999999998 20-24 21.26 29.125 27.35 22.264999999999997 25-29 21.14 28.9 27.860000000000003 22.1 30-34 22.27 28.804999999999996 27.435 21.490000000000002 35-39 21.965 28.585 27.21 22.24 40-44 21.37 28.985 27.634999999999998 22.009999999999998 45-49 21.845 29.13 27.650000000000002 21.375 50-54 22.165000000000003 28.215 27.474999999999998 22.145 55-59 22.314999999999998 28.199999999999996 27.700000000000003 21.785 60-64 21.975 28.615000000000002 27.250000000000004 22.16 65-69 22.3 28.410000000000004 27.18 22.11 70-74 22.035 29.13 26.784999999999997 22.05 75-79 22.365 28.34 27.275 22.02 80-84 21.945 28.095 27.48 22.48 85-89 21.335 27.76 27.88 23.025000000000002 90-94 22.28 28.15 27.555000000000003 22.015 95-99 21.38 28.384999999999998 27.705000000000002 22.53 100-104 21.87 28.299999999999997 27.750000000000004 22.08 105-109 21.855 28.360000000000003 27.474999999999998 22.31 110-114 21.8 28.325 28.035 21.84 115-119 22.939999999999998 28.38 27.189999999999998 21.490000000000002 120-124 22.33 27.889999999999997 27.85 21.93 125-129 21.654999999999998 27.894999999999996 27.584999999999997 22.865 130-134 21.85 27.779999999999998 28.27 22.1 135-139 21.92 27.435 28.42 22.225 140-144 21.560000000000002 27.905 28.095 22.439999999999998 145-149 22.770000000000003 27.765 27.575 21.89 150 21.175 28.999999999999996 27.150000000000002 22.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 1.5 19 2.0 20 1.0 21 0.5 22 1.5 23 5.0 24 6.0 25 6.0 26 7.0 27 9.5 28 12.0 29 17.0 30 24.5 31 33.0 32 44.5 33 58.0 34 67.5 35 72.5 36 91.5 37 116.5 38 145.0 39 176.5 40 193.0 41 204.5 42 228.5 43 243.5 44 227.5 45 232.0 46 244.0 47 234.5 48 216.5 49 182.5 50 150.0 51 124.5 52 109.0 53 94.5 54 75.0 55 60.5 56 52.0 57 48.0 58 39.5 59 29.0 60 22.0 61 14.5 62 9.5 63 8.5 64 8.5 65 7.5 66 5.0 67 5.5 68 7.0 69 5.0 70 3.5 71 2.5 72 1.0 73 0.5 74 1.0 75 1.0 76 2.5 77 2.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.625 #Duplication Level Percentage of deduplicated Percentage of total 1 85.40145985401459 73.125 2 12.671532846715328 21.7 3 1.7810218978102188 4.575 4 0.0875912408759124 0.3 5 0.0 0.0 6 0.05839416058394161 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACAAACTATCAACAAGTCCATTCCTGTAATTGGTATGTATATATATGTG 6 0.15 No Hit TATTCCTCCTGGAAATACTAAAGAGGACACGTGCGTGTTCGTGGATACCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257202 spots for SRR13259380.sra Written 1257202 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra Read 1257184 spots for SRR13259380.sra Written 1257184 spots for SRR13259380.sra SRR ids: ['SRR13259380.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5jwofyyn SRR13259380.sra spots: 25143698 blocks: [[1, 1257184], [1257185, 2514368], [2514369, 3771552], [3771553, 5028736], [5028737, 6285920], [6285921, 7543104], [7543105, 8800288], [8800289, 10057472], [10057473, 11314656], [11314657, 12571840], [12571841, 13829024], [13829025, 15086208], [15086209, 16343392], [16343393, 17600576], [17600577, 18857760], [18857761, 20114944], [20114945, 21372128], [21372129, 22629312], [22629313, 23886496], [23886497, 25143698]] SRR13259380 file size 8474119 SRR13259380 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259380 SRR13259380_1.fastq SRR13259380_2.fastq Input file: SRR13259380_1.fastq Paired file: SRR13259380_2.fastq trimmed: SRR13259380-trimmed-pair1.fastq, SRR13259380-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:22:49 2025 >> started Fri Feb 14 03:23:17 2025 >> done (27.856s) 25143698 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 130 ( 0.00%) empty read pairs filtered out after trimming by size control 25143568 (100.00%) read pairs available; of these: 9212 ( 0.04%) trimmed read pairs available after processing 25134356 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 1 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 1 0.00% 40 2 0.00% 41 1 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 2 0.00% 46 2 0.00% 47 2 0.00% 48 3 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 1 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 1 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 1 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 1 0.00% 70 1 0.00% 71 1 0.00% 72 5 0.00% 73 5 0.00% 74 1 0.00% 75 1 0.00% 76 4 0.00% 77 4 0.00% 78 1 0.00% 79 4 0.00% 80 4 0.00% 81 4 0.00% 82 7 0.00% 83 4 0.00% 84 2 0.00% 85 5 0.00% 86 8 0.00% 87 5 0.00% 88 3 0.00% 89 4 0.00% 90 6 0.00% 91 7 0.00% 92 6 0.00% 93 13 0.00% 94 15 0.00% 95 19 0.00% 96 21 0.00% 97 18 0.00% 98 20 0.00% 99 17 0.00% 100 20 0.00% 101 28 0.00% 102 29 0.00% 103 35 0.00% 104 35 0.00% 105 39 0.00% 106 40 0.00% 107 36 0.00% 108 42 0.00% 109 44 0.00% 110 62 0.00% 111 50 0.00% 112 51 0.00% 113 63 0.00% 114 60 0.00% 115 57 0.00% 116 65 0.00% 117 94 0.00% 118 86 0.00% 119 93 0.00% 120 93 0.00% 121 100 0.00% 122 119 0.00% 123 122 0.00% 124 111 0.00% 125 123 0.00% 126 150 0.00% 127 145 0.00% 128 172 0.00% 129 126 0.00% 130 174 0.00% 131 177 0.00% 132 183 0.00% 133 212 0.00% 134 212 0.00% 135 225 0.00% 136 249 0.00% 137 285 0.00% 138 259 0.00% 139 267 0.00% 140 283 0.00% 141 340 0.00% 142 357 0.00% 143 380 0.00% 144 362 0.00% 145 429 0.00% 146 461 0.00% 147 522 0.00% 148 568 0.00% 149 739 0.00% 150 25134356 99.96% 25143568 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=24 prefix-density=0.26 prefix-fanout=2.1 sequence=GAGACTGAGAAGAGCCATGTCTACACTGGAGTCATGGAGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=11.93 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.2 sequence=TGCAAATGTGGATCAAACTGCACCTG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=8.63 fanout-score-rank=3 prefix-density=0.50 prefix-fanout=4.0 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=15.84 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=4.1 sequence=AGGAAAAGGGACGGTACTGGGAGCCAAGCGATTGACAACTTTGCCTAGTGGGACGCATGAGCATT SRR13259380 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:24:05 Started mapping on | Feb 14 03:24:06 Finished on | Feb 14 03:28:02 Mapping speed, Million of reads per hour | 383.55 Number of input reads | 25143568 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22721322 Uniquely mapped reads % | 90.37% Average mapped length | 298.26 Number of splices: Total | 19638157 Number of splices: Annotated (sjdb) | 19226502 Number of splices: GT/AG | 19291223 Number of splices: GC/AG | 269980 Number of splices: AT/AC | 16882 Number of splices: Non-canonical | 60072 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 731394 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 85434 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.24% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1690852 1690852 1690852 N_multimapping 731394 731394 731394 N_noFeature 728968 11567854 11636767 N_ambiguous 376857 66264 65813 UnstrandedReadsAssigned:21615497 PositiveStrandReadsAssigned:11087204 NegativeStrandReadsAssigned:11018742 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259380 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259380-trimmed-pair1.fastq SRR13259380-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,143,568 reads, 22,441,506 reads pseudoaligned [quant] estimated average fragment length: 238.776 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR13259380.ke.tsv 34699 SRR13259380.se.tsv 87100 total ==> SRR13259380.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.22 1598 26.1126 Potri.005G024800.1.v4.1 1035 797.224 3446 125.743 Potri.004G059700.1.v4.1 961 723.224 32 1.28714 Potri.007G009000.2.v4.1 1416 1178.22 0 0 Potri.003G141000.2.v4.1 2943 2705.22 1032 11.0975 Potri.016G087400.1.v4.1 270 52.8483 1419 781.087 Potri.015G069301.1.v4.1 564 326.362 0 0 Potri.010G195200.1.v4.1 1773 1535.22 1111.98 21.0705 Potri.012G127500.1.v4.1 977 739.224 868 34.158 ==> SRR13259380.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 62 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 465 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 27 SRR13259380 completed mapping pipeline successfully