Starting /dee2/code/volunteer_pipeline.sh SRR13259381 current disk space = 3088057110528 free memory = 1582654692 SRR13259381 SRAfilesize d5d0a4f4c2c225872064fceb9bc9b481 SRR13259381.sra SRR13259381.sra file validated SRR13259381 is paired end SRR13259381 is conventional basespace SRR13259381 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259381_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5875 37.0 37.0 37.0 37.0 37.0 2 36.513 37.0 37.0 37.0 37.0 37.0 3 36.59 37.0 37.0 37.0 37.0 37.0 4 36.6025 37.0 37.0 37.0 37.0 37.0 5 36.7215 37.0 37.0 37.0 37.0 37.0 6 36.5735 37.0 37.0 37.0 37.0 37.0 7 36.6385 37.0 37.0 37.0 37.0 37.0 8 36.6885 37.0 37.0 37.0 37.0 37.0 9 36.586 37.0 37.0 37.0 37.0 37.0 10-14 36.6114 37.0 37.0 37.0 37.0 37.0 15-19 36.5789 37.0 37.0 37.0 37.0 37.0 20-24 36.5518 37.0 37.0 37.0 37.0 37.0 25-29 36.48440000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.429500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3948 37.0 37.0 37.0 37.0 37.0 40-44 36.3668 37.0 37.0 37.0 37.0 37.0 45-49 36.3514 37.0 37.0 37.0 37.0 37.0 50-54 36.340199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2648 37.0 37.0 37.0 37.0 37.0 60-64 36.248 37.0 37.0 37.0 37.0 37.0 65-69 36.1647 37.0 37.0 37.0 37.0 37.0 70-74 36.199799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.1378 37.0 37.0 37.0 37.0 37.0 80-84 36.1652 37.0 37.0 37.0 37.0 37.0 85-89 36.0804 37.0 37.0 37.0 37.0 37.0 90-94 36.0071 37.0 37.0 37.0 37.0 37.0 95-99 36.061099999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.919599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.9745 37.0 37.0 37.0 37.0 37.0 110-114 35.9508 37.0 37.0 37.0 37.0 37.0 115-119 35.7964 37.0 37.0 37.0 37.0 37.0 120-124 35.822799999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.7734 37.0 37.0 37.0 37.0 37.0 130-134 35.55140000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.6125 37.0 37.0 37.0 37.0 37.0 140-144 35.737700000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.604200000000006 37.0 37.0 37.0 37.0 37.0 150 35.514 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 0.0 19 4.0 20 5.0 21 1.0 22 0.0 23 1.0 24 3.0 25 8.0 26 7.0 27 12.0 28 17.0 29 27.0 30 26.0 31 28.0 32 53.0 33 71.0 34 94.0 35 278.0 36 3107.0 37 256.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.025000000000006 12.55 15.6 34.825 2 24.575 20.65 34.2 20.575 3 25.025 25.75 25.074999999999996 24.15 4 25.974999999999998 32.975 19.2 21.85 5 26.0 33.125 21.9 18.975 6 21.125 35.825 21.4 21.65 7 20.424999999999997 16.45 38.65 24.474999999999998 8 22.225 21.375 27.825 28.575 9 23.625 21.075 27.3 28.000000000000004 10-14 23.68 26.290000000000003 25.45 24.58 15-19 23.815 26.165 25.41 24.610000000000003 20-24 23.32 26.68 25.525 24.474999999999998 25-29 23.855 26.590000000000003 25.865 23.69 30-34 23.755000000000003 26.63 25.41 24.205 35-39 24.310000000000002 26.38 25.430000000000003 23.880000000000003 40-44 23.46 25.990000000000002 26.590000000000003 23.96 45-49 23.825 25.71 25.840000000000003 24.625 50-54 23.005 27.060000000000002 25.705 24.23 55-59 24.834999999999997 26.245 24.959999999999997 23.96 60-64 23.669999999999998 26.619999999999997 25.835 23.875 65-69 24.335 26.075 25.39 24.2 70-74 23.685000000000002 26.305 25.7 24.310000000000002 75-79 24.42 26.26 25.535000000000004 23.785 80-84 23.494999999999997 25.715 26.25 24.54 85-89 24.349999999999998 25.874999999999996 25.629999999999995 24.145 90-94 23.46 25.495 26.415 24.63 95-99 23.400000000000002 25.86 26.1 24.64 100-104 23.65 25.245 26.21 24.895 105-109 24.295 25.69 25.985000000000003 24.03 110-114 24.55 26.145000000000003 25.295 24.01 115-119 24.565 26.22 25.580000000000002 23.635 120-124 23.995 26.590000000000003 25.205 24.21 125-129 24.740000000000002 26.490000000000002 25.045 23.724999999999998 130-134 24.29 26.724999999999998 25.240000000000002 23.745 135-139 23.64 26.3 26.229999999999997 23.830000000000002 140-144 24.545 26.11 25.509999999999998 23.835 145-149 24.065 24.654999999999998 26.6 24.68 150 24.25 26.075 24.85 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.5 27 5.0 28 4.5 29 4.5 30 5.5 31 7.0 32 18.0 33 30.5 34 25.5 35 29.0 36 49.0 37 65.5 38 79.0 39 88.5 40 104.5 41 119.5 42 137.5 43 162.5 44 181.0 45 194.5 46 196.5 47 193.5 48 214.5 49 223.5 50 215.0 51 218.0 52 217.5 53 201.0 54 169.0 55 143.0 56 126.5 57 105.0 58 83.0 59 77.0 60 69.5 61 49.5 62 44.0 63 41.0 64 28.5 65 18.5 66 14.0 67 13.0 68 8.0 69 4.5 70 3.0 71 2.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 84.26698450536352 70.7 2 12.693682955899883 21.3 3 2.7115613825983313 6.825 4 0.23837902264600713 0.8 5 0.08939213349225268 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTGAGTGCGGAGATTAGCTGCCGTTTGGCTCGAGGCAGGAGACTGAGG 5 0.125 No Hit GCGCTTTCCTGGCGGCTTTACGGGCAGCATTGCGCTCAGCCTTGGTCCTG 5 0.125 No Hit CTCAAGTCTAGTGGTCTGAAGTCTGGCGGTCTTAAATCTGGCCTGAAGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.0 0.025 0.0 0.0 0.0 118-119 0.0 0.025 0.0 0.0 0.0 120-121 0.0125 0.025 0.0 0.0 0.0 122-123 0.025 0.025 0.0 0.0 0.0 124-125 0.025 0.025 0.0 0.0 0.0 126-127 0.025 0.025 0.0 0.0 0.0 128-129 0.025 0.025 0.0 0.0 0.0 130-131 0.025 0.025 0.0 0.0 0.0 132-133 0.025 0.025 0.0 0.0 0.0 134-135 0.025 0.025 0.0 0.0 0.0 136-137 0.025 0.025 0.0 0.0 0.0 138 0.025 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCCCG 10 0.006973645 144.0 8 GGGGCAG 10 0.006973645 144.0 1 CAGCGCC 10 0.006973645 144.0 5 GGCAGCG 10 0.006973645 144.0 3 GCCCCGC 10 0.006973645 144.0 9 >>END_MODULE SRR13259381 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259381_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.389 37.0 37.0 37.0 37.0 37.0 2 36.511 37.0 37.0 37.0 37.0 37.0 3 36.4955 37.0 37.0 37.0 37.0 37.0 4 36.4605 37.0 37.0 37.0 37.0 37.0 5 36.521 37.0 37.0 37.0 37.0 37.0 6 36.501 37.0 37.0 37.0 37.0 37.0 7 36.4315 37.0 37.0 37.0 37.0 37.0 8 36.484 37.0 37.0 37.0 37.0 37.0 9 36.4955 37.0 37.0 37.0 37.0 37.0 10-14 36.5082 37.0 37.0 37.0 37.0 37.0 15-19 36.469 37.0 37.0 37.0 37.0 37.0 20-24 36.4261 37.0 37.0 37.0 37.0 37.0 25-29 36.4423 37.0 37.0 37.0 37.0 37.0 30-34 36.4455 37.0 37.0 37.0 37.0 37.0 35-39 36.42909999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.373000000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.30069999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.2259 37.0 37.0 37.0 37.0 37.0 55-59 36.2333 37.0 37.0 37.0 37.0 37.0 60-64 36.1537 37.0 37.0 37.0 37.0 37.0 65-69 36.199 37.0 37.0 37.0 37.0 37.0 70-74 36.12049999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.087700000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.0345 37.0 37.0 37.0 37.0 37.0 85-89 35.8941 37.0 37.0 37.0 37.0 37.0 90-94 35.959999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8721 37.0 37.0 37.0 37.0 37.0 100-104 35.889599999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.8069 37.0 37.0 37.0 37.0 37.0 110-114 35.7825 37.0 37.0 37.0 37.0 37.0 115-119 35.8065 37.0 37.0 37.0 37.0 37.0 120-124 35.60359999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.589 37.0 37.0 37.0 37.0 37.0 130-134 35.467200000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.4194 37.0 37.0 37.0 37.0 37.0 140-144 35.511 37.0 37.0 37.0 37.0 37.0 145-149 35.318200000000004 37.0 37.0 37.0 34.6 37.0 150 35.4215 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 0.0 23 5.0 24 6.0 25 4.0 26 6.0 27 7.0 28 12.0 29 19.0 30 23.0 31 20.0 32 41.0 33 69.0 34 144.0 35 604.0 36 2910.0 37 127.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.4 13.275 15.85 35.475 2 24.575 21.975 33.324999999999996 20.125 3 25.624999999999996 25.474999999999998 24.425 24.474999999999998 4 27.650000000000002 31.525 18.15 22.675 5 24.9 33.275 21.5 20.325 6 18.85 35.525 23.75 21.875 7 19.825 17.549999999999997 38.25 24.375 8 22.8 21.45 26.625 29.125 9 22.475 21.925 27.775 27.825 10-14 22.975 26.490000000000002 25.564999999999998 24.97 15-19 23.57 26.27 25.825 24.335 20-24 23.735 26.55 25.56 24.154999999999998 25-29 22.770000000000003 26.51 26.484999999999996 24.235 30-34 23.095 26.590000000000003 26.115 24.2 35-39 23.815 26.44 25.474999999999998 24.27 40-44 23.415 25.855 26.6 24.13 45-49 23.935000000000002 25.34 25.324999999999996 25.4 50-54 23.715 27.145000000000003 25.69 23.45 55-59 24.26 26.56 25.16 24.02 60-64 24.055 26.424999999999997 25.345000000000002 24.175 65-69 24.01 25.755 26.375 23.86 70-74 23.72 25.985000000000003 25.985000000000003 24.310000000000002 75-79 24.205 26.229999999999997 25.34 24.224999999999998 80-84 24.645 25.895000000000003 25.05 24.41 85-89 23.845 25.91 25.45 24.795 90-94 23.674999999999997 25.435000000000002 26.11 24.779999999999998 95-99 23.265 25.595000000000002 26.27 24.87 100-104 23.735 25.919999999999998 25.935000000000002 24.41 105-109 23.849999999999998 25.71 26.0 24.44 110-114 24.025 25.740000000000002 26.0 24.235 115-119 24.2 25.130000000000003 25.81 24.86 120-124 24.404999999999998 26.255 25.295 24.044999999999998 125-129 24.04 25.474999999999998 26.365 24.12 130-134 23.79 25.979999999999997 25.785000000000004 24.445 135-139 24.545 26.669999999999998 25.575 23.21 140-144 24.154999999999998 26.334999999999997 25.785000000000004 23.724999999999998 145-149 24.085 25.415 26.08 24.42 150 24.099999999999998 26.224999999999998 25.724999999999998 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 4.0 26 5.5 27 4.0 28 4.0 29 5.0 30 8.0 31 12.0 32 19.0 33 24.5 34 31.5 35 43.0 36 48.5 37 50.5 38 63.0 39 85.5 40 117.0 41 138.0 42 146.5 43 169.0 44 180.5 45 191.0 46 187.5 47 202.5 48 217.0 49 197.5 50 186.5 51 193.5 52 192.5 53 162.5 54 162.5 55 177.5 56 168.0 57 130.0 58 93.5 59 70.0 60 69.0 61 61.0 62 41.5 63 34.5 64 27.0 65 22.5 66 17.0 67 12.5 68 6.5 69 5.0 70 3.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.175 #Duplication Level Percentage of deduplicated Percentage of total 1 84.46688446688447 71.1 2 12.592812592812594 21.2 3 2.6433026433026434 6.675000000000001 4 0.2673002673002673 0.8999999999999999 5 0.029700029700029697 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTGGGTACTGTTTTGTTCAATCCAGGAACGGGTGACGATCGATCTGGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0125 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.05 0.0 0.0 0.0 0.0 138 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGACT 10 0.006973645 144.0 9 TAACTAT 10 0.006973645 144.0 5 AACTATG 10 0.006973645 144.0 6 GGCTCCA 10 0.006973645 144.0 7 CTATGAC 10 0.006973645 144.0 8 ACGGCTC 10 0.006973645 144.0 5 AACGGCT 10 0.006973645 144.0 4 GGAGTAA 10 0.006973645 144.0 1 >>END_MODULE Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330160 spots for SRR13259381.sra Written 1330160 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra Read 1330149 spots for SRR13259381.sra Written 1330149 spots for SRR13259381.sra SRR ids: ['SRR13259381.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ahdoc4p8 SRR13259381.sra spots: 26602991 blocks: [[1, 1330149], [1330150, 2660298], [2660299, 3990447], [3990448, 5320596], [5320597, 6650745], [6650746, 7980894], [7980895, 9311043], [9311044, 10641192], [10641193, 11971341], [11971342, 13301490], [13301491, 14631639], [14631640, 15961788], [15961789, 17291937], [17291938, 18622086], [18622087, 19952235], [19952236, 21282384], [21282385, 22612533], [22612534, 23942682], [23942683, 25272831], [25272832, 26602991]] SRR13259381 file size 8967200 SRR13259381 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259381 SRR13259381_1.fastq SRR13259381_2.fastq Input file: SRR13259381_1.fastq Paired file: SRR13259381_2.fastq trimmed: SRR13259381-trimmed-pair1.fastq, SRR13259381-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:24:08 2025 >> started Fri Feb 14 03:24:37 2025 >> done (29.639s) 26602991 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 77 ( 0.00%) empty read pairs filtered out after trimming by size control 26602914 (100.00%) read pairs available; of these: 11206 ( 0.04%) trimmed read pairs available after processing 26591708 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 2 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 3 0.00% 35 1 0.00% 36 3 0.00% 37 2 0.00% 38 3 0.00% 39 3 0.00% 40 0 0.00% 41 2 0.00% 42 2 0.00% 43 0 0.00% 44 1 0.00% 45 1 0.00% 46 1 0.00% 47 3 0.00% 48 2 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 1 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 1 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 2 0.00% 69 2 0.00% 70 1 0.00% 71 6 0.00% 72 4 0.00% 73 2 0.00% 74 6 0.00% 75 3 0.00% 76 0 0.00% 77 6 0.00% 78 4 0.00% 79 3 0.00% 80 7 0.00% 81 14 0.00% 82 8 0.00% 83 9 0.00% 84 10 0.00% 85 12 0.00% 86 11 0.00% 87 21 0.00% 88 6 0.00% 89 16 0.00% 90 19 0.00% 91 20 0.00% 92 16 0.00% 93 20 0.00% 94 20 0.00% 95 24 0.00% 96 32 0.00% 97 34 0.00% 98 33 0.00% 99 37 0.00% 100 42 0.00% 101 43 0.00% 102 54 0.00% 103 51 0.00% 104 60 0.00% 105 52 0.00% 106 72 0.00% 107 58 0.00% 108 64 0.00% 109 71 0.00% 110 68 0.00% 111 75 0.00% 112 80 0.00% 113 90 0.00% 114 105 0.00% 115 96 0.00% 116 104 0.00% 117 112 0.00% 118 121 0.00% 119 146 0.00% 120 120 0.00% 121 133 0.00% 122 125 0.00% 123 174 0.00% 124 157 0.00% 125 159 0.00% 126 193 0.00% 127 218 0.00% 128 180 0.00% 129 214 0.00% 130 235 0.00% 131 188 0.00% 132 230 0.00% 133 263 0.00% 134 270 0.00% 135 262 0.00% 136 316 0.00% 137 308 0.00% 138 320 0.00% 139 300 0.00% 140 324 0.00% 141 393 0.00% 142 384 0.00% 143 400 0.00% 144 394 0.00% 145 465 0.00% 146 560 0.00% 147 540 0.00% 148 672 0.00% 149 696 0.00% 150 26591708 99.96% 26602914 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=24 prefix-density=0.18 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGT criterion=fanout-score sequence-density=0.11 sequence-density-rank=5 fanout-score=104.09 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=20.4 sequence=AAGAAGAAGCAC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=27 prefix-density=0.18 prefix-fanout=2.8 sequence=ATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=110.28 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=13.7 sequence=GAAGAAGGCGAAGACTGACAAGGTCACGGATGCGAAGAGCCTGAAGGTGTCCAAGACCGAGGCATCCAAGACTTCTGCTGACAAGACCGTGGAGTCGTCGCTTCCCTCGACCAGCGAGAAGCCCCTCCACAAGCACCATCACTACAGGACCAAGGCTGAGCGCAATGCTGCCCGTAAAGCCGCCAGGAAAGCGCGCAAGGCCAAGTTGGCTAAGTTGGCGGAGGAGGATGACTACCCTTCGTACTCTCACAAGTCCTTGAGGAAGTCTCACTACGTTGACGCCCCCGCTTCCTCTCCCTCGACTACTGCCGTCTCTCGTCTTTAAG SRR13259381 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:26:17 Started mapping on | Feb 14 03:26:17 Finished on | Feb 14 03:56:27 Mapping speed, Million of reads per hour | 52.91 Number of input reads | 26602914 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11324981 Uniquely mapped reads % | 42.57% Average mapped length | 297.88 Number of splices: Total | 10847466 Number of splices: Annotated (sjdb) | 10614162 Number of splices: GT/AG | 10666806 Number of splices: GC/AG | 145706 Number of splices: AT/AC | 10458 Number of splices: Non-canonical | 24496 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309861 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 78644 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 55.69% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 14968072 14968072 14968072 N_multimapping 309861 309861 309861 N_noFeature 376488 5813020 5824736 N_ambiguous 124333 30362 30562 UnstrandedReadsAssigned:10824160 PositiveStrandReadsAssigned:5481599 NegativeStrandReadsAssigned:5469683 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259381 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259381-trimmed-pair1.fastq SRR13259381-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,602,914 reads, 11,434,183 reads pseudoaligned [quant] estimated average fragment length: 235.917 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR13259381.ke.tsv 34699 SRR13259381.se.tsv 87100 total ==> SRR13259381.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.08 1620 66.315 Potri.005G024800.1.v4.1 1035 800.083 393 35.8531 Potri.004G059700.1.v4.1 961 726.094 23 2.31209 Potri.007G009000.2.v4.1 1416 1181.08 0 0 Potri.003G141000.2.v4.1 2943 2708.08 563 15.1745 Potri.016G087400.1.v4.1 270 54.3804 625 838.892 Potri.015G069301.1.v4.1 564 329.191 0 0 Potri.010G195200.1.v4.1 1773 1538.08 505 23.9652 Potri.012G127500.1.v4.1 977 742.094 2929 288.091 ==> SRR13259381.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 336 SRR13259381 completed mapping pipeline successfully