Starting /dee2/code/volunteer_pipeline.sh SRR13259382 current disk space = 3087994515456 free memory = 1408335020 SRR13259382 SRAfilesize 0794f79025c7a02b3bcd1005356a9667 SRR13259382.sra SRR13259382.sra file validated SRR13259382 is paired end SRR13259382 is conventional basespace SRR13259382 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259382_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.672 37.0 37.0 37.0 37.0 37.0 2 36.601 37.0 37.0 37.0 37.0 37.0 3 36.642 37.0 37.0 37.0 37.0 37.0 4 36.634 37.0 37.0 37.0 37.0 37.0 5 36.738 37.0 37.0 37.0 37.0 37.0 6 36.633 37.0 37.0 37.0 37.0 37.0 7 36.6885 37.0 37.0 37.0 37.0 37.0 8 36.648 37.0 37.0 37.0 37.0 37.0 9 36.666 37.0 37.0 37.0 37.0 37.0 10-14 36.6611 37.0 37.0 37.0 37.0 37.0 15-19 36.6289 37.0 37.0 37.0 37.0 37.0 20-24 36.5993 37.0 37.0 37.0 37.0 37.0 25-29 36.549099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5225 37.0 37.0 37.0 37.0 37.0 35-39 36.4602 37.0 37.0 37.0 37.0 37.0 40-44 36.4666 37.0 37.0 37.0 37.0 37.0 45-49 36.4144 37.0 37.0 37.0 37.0 37.0 50-54 36.4255 37.0 37.0 37.0 37.0 37.0 55-59 36.309000000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.344 37.0 37.0 37.0 37.0 37.0 65-69 36.2634 37.0 37.0 37.0 37.0 37.0 70-74 36.266999999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.202600000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2141 37.0 37.0 37.0 37.0 37.0 85-89 36.236599999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.162099999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.18770000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.0229 37.0 37.0 37.0 37.0 37.0 105-109 36.091899999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.059 37.0 37.0 37.0 37.0 37.0 115-119 35.977999999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.944500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.935199999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.7346 37.0 37.0 37.0 37.0 37.0 135-139 35.7451 37.0 37.0 37.0 37.0 37.0 140-144 35.8033 37.0 37.0 37.0 37.0 37.0 145-149 35.6309 37.0 37.0 37.0 37.0 37.0 150 35.4875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 4.0 19 0.0 20 0.0 21 2.0 22 1.0 23 1.0 24 0.0 25 5.0 26 7.0 27 11.0 28 11.0 29 15.0 30 22.0 31 34.0 32 45.0 33 47.0 34 96.0 35 266.0 36 3222.0 37 209.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.925 15.950000000000001 16.825000000000003 32.300000000000004 2 22.775000000000002 22.15 37.2 17.875 3 22.2 29.15 27.1 21.55 4 24.275 33.275 21.65 20.8 5 24.425 34.325 22.400000000000002 18.85 6 18.45 38.65 22.650000000000002 20.25 7 18.05 17.9 42.325 21.725 8 21.625 21.3 28.299999999999997 28.775000000000002 9 19.825 23.724999999999998 29.975 26.474999999999998 10-14 22.485 28.71 26.6 22.205 15-19 22.36 28.27 26.915 22.455 20-24 21.75 28.04 28.075 22.134999999999998 25-29 21.705 28.165000000000003 27.765 22.365 30-34 21.634999999999998 28.16 27.900000000000002 22.305 35-39 22.02 27.555000000000003 28.065 22.36 40-44 22.355 27.875 27.91 21.86 45-49 22.29 27.279999999999998 27.55 22.88 50-54 22.21 27.71 27.54 22.54 55-59 21.245 28.410000000000004 27.834999999999997 22.509999999999998 60-64 21.845 28.139999999999997 27.650000000000002 22.365 65-69 22.555 27.66 27.555000000000003 22.23 70-74 22.259999999999998 27.994999999999997 27.49 22.255 75-79 21.335 28.12 27.750000000000004 22.795 80-84 21.85 27.88 27.310000000000002 22.96 85-89 22.189999999999998 28.49 27.834999999999997 21.485000000000003 90-94 22.18 27.865000000000002 27.744999999999997 22.21 95-99 21.905 27.935 27.74 22.42 100-104 22.125 27.650000000000002 27.955000000000002 22.27 105-109 22.905 26.795 27.725 22.575 110-114 21.855 27.985 27.87 22.29 115-119 22.49 27.744999999999997 27.779999999999998 21.985 120-124 22.34 27.625 27.860000000000003 22.175 125-129 22.39 27.68 27.1 22.830000000000002 130-134 22.615 28.125 26.939999999999998 22.32 135-139 22.245 28.15 27.72 21.884999999999998 140-144 22.07 27.13 27.694999999999997 23.105 145-149 22.065 27.655 28.055000000000003 22.225 150 21.9 28.349999999999998 27.025 22.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 4.0 25 4.0 26 3.5 27 7.0 28 12.0 29 16.0 30 11.0 31 14.0 32 36.0 33 50.0 34 65.5 35 71.0 36 79.0 37 110.0 38 133.5 39 141.5 40 180.5 41 219.0 42 235.0 43 250.0 44 255.0 45 252.5 46 263.5 47 255.5 48 209.0 49 196.5 50 166.5 51 133.5 52 127.5 53 103.5 54 78.0 55 64.5 56 54.0 57 42.5 58 39.5 59 29.0 60 14.5 61 11.0 62 8.5 63 11.0 64 10.5 65 6.0 66 4.5 67 5.0 68 3.5 69 0.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 1.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.3 #Duplication Level Percentage of deduplicated Percentage of total 1 83.55342136854742 69.6 2 13.685474189675869 22.8 3 2.1908763505402162 5.475 4 0.39015606242497 1.3 5 0.09003601440576231 0.375 6 0.09003601440576231 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATACTTTCTCTCCGTCTCGCGATTTAGTTTTTGTTGCTTCTTTAGTGAAT 6 0.15 No Hit CCTGATTGTAGTATTTGAGCAACACAGTCTTTGACAATGGAACCTTCTCC 6 0.15 No Hit AAAAGCTTCTGCTGGGATGTGAGATAGCACTGTAATATTGGAGCAAAATT 6 0.15 No Hit TGCCTGGGGGCCATATGTGGATGTGGACTCGTGAAAGCTTTCCAAAAGTC 5 0.125 No Hit GAAAGATTGAAAAATTTTGATTAATATAATGGATACATGGTATTAAGAGA 5 0.125 No Hit CGTTGGTGTCATGGTGGAGTTGTCAGAGGAGGCAGTGATTGTTCCTCTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTAACA 10 0.006973645 144.0 2 >>END_MODULE SRR13259382 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259382_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.487 37.0 37.0 37.0 37.0 37.0 2 36.4315 37.0 37.0 37.0 37.0 37.0 3 36.556 37.0 37.0 37.0 37.0 37.0 4 36.426 37.0 37.0 37.0 37.0 37.0 5 36.431 37.0 37.0 37.0 37.0 37.0 6 36.482 37.0 37.0 37.0 37.0 37.0 7 36.4815 37.0 37.0 37.0 37.0 37.0 8 36.4745 37.0 37.0 37.0 37.0 37.0 9 36.589 37.0 37.0 37.0 37.0 37.0 10-14 36.53189999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4727 37.0 37.0 37.0 37.0 37.0 20-24 36.45290000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.398199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4702 37.0 37.0 37.0 37.0 37.0 35-39 36.407300000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.318 37.0 37.0 37.0 37.0 37.0 45-49 36.245400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2864 37.0 37.0 37.0 37.0 37.0 55-59 36.2621 37.0 37.0 37.0 37.0 37.0 60-64 36.1516 37.0 37.0 37.0 37.0 37.0 65-69 36.1396 37.0 37.0 37.0 37.0 37.0 70-74 36.1542 37.0 37.0 37.0 37.0 37.0 75-79 36.0287 37.0 37.0 37.0 37.0 37.0 80-84 35.9846 37.0 37.0 37.0 37.0 37.0 85-89 35.831 37.0 37.0 37.0 37.0 37.0 90-94 35.921299999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8046 37.0 37.0 37.0 37.0 37.0 100-104 35.799099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.802 37.0 37.0 37.0 37.0 37.0 110-114 35.7444 37.0 37.0 37.0 37.0 37.0 115-119 35.6796 37.0 37.0 37.0 37.0 37.0 120-124 35.4974 37.0 37.0 37.0 37.0 37.0 125-129 35.6472 37.0 37.0 37.0 37.0 37.0 130-134 35.4608 37.0 37.0 37.0 37.0 37.0 135-139 35.4118 37.0 37.0 37.0 32.2 37.0 140-144 35.4998 37.0 37.0 37.0 37.0 37.0 145-149 35.315400000000004 37.0 37.0 37.0 29.8 37.0 150 35.2775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 3.0 24 3.0 25 7.0 26 4.0 27 9.0 28 13.0 29 11.0 30 23.0 31 28.0 32 36.0 33 66.0 34 139.0 35 674.0 36 2880.0 37 100.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.275 14.85 18.175 32.7 2 22.675 23.200000000000003 35.925000000000004 18.2 3 21.5 29.025000000000002 27.750000000000004 21.725 4 24.875 32.425 21.224999999999998 21.475 5 23.375 35.275 23.200000000000003 18.15 6 16.400000000000002 39.175 24.275 20.150000000000002 7 17.65 18.025 41.449999999999996 22.875 8 20.349999999999998 22.375 28.675 28.599999999999998 9 21.9 23.400000000000002 28.725 25.974999999999998 10-14 22.055 28.58 26.810000000000002 22.555 15-19 21.085 28.59 27.224999999999998 23.1 20-24 21.654999999999998 27.625 27.884999999999998 22.835 25-29 21.645 27.82 27.994999999999997 22.54 30-34 21.465 28.735 27.544999999999998 22.255 35-39 21.705 28.7 27.755000000000003 21.84 40-44 21.455 28.405 27.935 22.205 45-49 22.264999999999997 27.985 27.544999999999998 22.205 50-54 22.145 29.020000000000003 26.939999999999998 21.895 55-59 21.884999999999998 28.375 27.139999999999997 22.6 60-64 22.115000000000002 28.849999999999998 26.735 22.3 65-69 22.48 27.99 27.405 22.125 70-74 21.73 28.12 27.735 22.415 75-79 21.78 27.735 28.03 22.455 80-84 22.53 27.595 27.075 22.8 85-89 22.89 27.889999999999997 27.49 21.73 90-94 22.495 28.08 27.229999999999997 22.195 95-99 22.36 27.500000000000004 27.575 22.564999999999998 100-104 22.220000000000002 27.834999999999997 27.284999999999997 22.66 105-109 22.755 27.275 27.685 22.285 110-114 22.28 28.050000000000004 27.16 22.509999999999998 115-119 22.41 28.38 27.1 22.11 120-124 22.17 27.61 28.17 22.05 125-129 21.86 28.23 27.18 22.73 130-134 22.675 27.99 27.405 21.93 135-139 22.805 27.57 27.67 21.955 140-144 22.035 27.589999999999996 28.21 22.165000000000003 145-149 22.21 27.155 28.59 22.045 150 22.775000000000002 28.325 27.825 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 2.5 26 5.0 27 9.5 28 11.5 29 10.5 30 14.5 31 30.5 32 36.0 33 34.5 34 50.0 35 69.0 36 96.0 37 121.5 38 131.0 39 148.0 40 171.5 41 214.5 42 235.5 43 249.0 44 283.0 45 286.0 46 256.0 47 229.5 48 201.0 49 174.0 50 162.0 51 142.5 52 125.5 53 108.5 54 81.0 55 61.5 56 60.0 57 42.0 58 30.0 59 24.5 60 17.5 61 19.0 62 14.5 63 10.0 64 7.0 65 7.0 66 6.0 67 2.0 68 1.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.34704830053667 70.72500000000001 2 12.880143112701253 21.6 3 2.206320810971974 5.55 4 0.3875968992248062 1.3 5 0.08944543828264759 0.375 6 0.08944543828264759 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGACTGTGTAGACCAAATTATCTACATAACAAGAGAGAATTTCTGCCA 6 0.15 No Hit CAAAACTGGAATATCTTCATAACGTTTCCCAATATTGTTGTACTCCCATA 6 0.15 No Hit ATAGATATGGCGATGCTGTTGGTAGGCTTAGGGTTTTTATCAATGGTGAA 6 0.15 No Hit CTCAGGTGGACACATTAACCCGGCTGTGACTTTCGGTTTGTTCTTGGCTA 5 0.125 No Hit GTCAAAGCCAGCAGTGACTGGGTCATGGACAGCATGAGCAAGGGCACAGA 5 0.125 No Hit TTTCCCCTTATGGGCTCTGGCAGAATACCGCAAAAATGTTCCATTGCCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331241 spots for SRR13259382.sra Written 1331241 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra Read 1331230 spots for SRR13259382.sra Written 1331230 spots for SRR13259382.sra SRR ids: ['SRR13259382.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dea466l0 SRR13259382.sra spots: 26624611 blocks: [[1, 1331230], [1331231, 2662460], [2662461, 3993690], [3993691, 5324920], [5324921, 6656150], [6656151, 7987380], [7987381, 9318610], [9318611, 10649840], [10649841, 11981070], [11981071, 13312300], [13312301, 14643530], [14643531, 15974760], [15974761, 17305990], [17305991, 18637220], [18637221, 19968450], [19968451, 21299680], [21299681, 22630910], [22630911, 23962140], [23962141, 25293370], [25293371, 26624611]] SRR13259382 file size 8974506 SRR13259382 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259382 SRR13259382_1.fastq SRR13259382_2.fastq Input file: SRR13259382_1.fastq Paired file: SRR13259382_2.fastq trimmed: SRR13259382-trimmed-pair1.fastq, SRR13259382-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:28:52 2025 >> started Fri Feb 14 02:29:30 2025 >> done (37.875s) 26624611 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 86 ( 0.00%) empty read pairs filtered out after trimming by size control 26624524 (100.00%) read pairs available; of these: 9904 ( 0.04%) trimmed read pairs available after processing 26614620 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 0 0.00% 41 2 0.00% 42 0 0.00% 43 1 0.00% 44 1 0.00% 45 1 0.00% 46 0 0.00% 47 2 0.00% 48 5 0.00% 49 6 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 1 0.00% 66 1 0.00% 67 1 0.00% 68 4 0.00% 69 2 0.00% 70 1 0.00% 71 3 0.00% 72 5 0.00% 73 5 0.00% 74 3 0.00% 75 4 0.00% 76 5 0.00% 77 5 0.00% 78 6 0.00% 79 7 0.00% 80 9 0.00% 81 7 0.00% 82 7 0.00% 83 5 0.00% 84 4 0.00% 85 13 0.00% 86 9 0.00% 87 6 0.00% 88 7 0.00% 89 12 0.00% 90 19 0.00% 91 14 0.00% 92 18 0.00% 93 21 0.00% 94 28 0.00% 95 22 0.00% 96 22 0.00% 97 22 0.00% 98 25 0.00% 99 21 0.00% 100 32 0.00% 101 39 0.00% 102 31 0.00% 103 29 0.00% 104 58 0.00% 105 42 0.00% 106 59 0.00% 107 52 0.00% 108 76 0.00% 109 52 0.00% 110 74 0.00% 111 62 0.00% 112 65 0.00% 113 83 0.00% 114 80 0.00% 115 83 0.00% 116 96 0.00% 117 87 0.00% 118 119 0.00% 119 98 0.00% 120 117 0.00% 121 124 0.00% 122 113 0.00% 123 124 0.00% 124 145 0.00% 125 143 0.00% 126 167 0.00% 127 161 0.00% 128 162 0.00% 129 178 0.00% 130 216 0.00% 131 218 0.00% 132 183 0.00% 133 235 0.00% 134 247 0.00% 135 243 0.00% 136 259 0.00% 137 272 0.00% 138 296 0.00% 139 281 0.00% 140 312 0.00% 141 327 0.00% 142 356 0.00% 143 372 0.00% 144 369 0.00% 145 382 0.00% 146 460 0.00% 147 516 0.00% 148 573 0.00% 149 666 0.00% 150 26614620 99.96% 26624524 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=36.69 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.7 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.77 fanout-score-rank=22 prefix-density=0.34 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=41.97 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=11.2 sequence=CCTTCCTTGTCCTGGATCTT SRR13259382 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:30:26 Started mapping on | Feb 14 02:30:26 Finished on | Feb 14 02:39:15 Mapping speed, Million of reads per hour | 181.19 Number of input reads | 26624524 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22375435 Uniquely mapped reads % | 84.04% Average mapped length | 297.96 Number of splices: Total | 21764102 Number of splices: Annotated (sjdb) | 21299965 Number of splices: GT/AG | 21402564 Number of splices: GC/AG | 292567 Number of splices: AT/AC | 21783 Number of splices: Non-canonical | 47188 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 565917 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 108384 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.29% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3683172 3683172 3683172 N_multimapping 565917 565917 565917 N_noFeature 741224 11481932 11515572 N_ambiguous 240602 61228 60828 UnstrandedReadsAssigned:21393609 PositiveStrandReadsAssigned:10832275 NegativeStrandReadsAssigned:10799035 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259382 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259382-trimmed-pair1.fastq SRR13259382-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,624,524 reads, 21,977,986 reads pseudoaligned [quant] estimated average fragment length: 239.072 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR13259382.ke.tsv 34699 SRR13259382.se.tsv 87100 total ==> SRR13259382.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.93 2367 51.6671 Potri.005G024800.1.v4.1 1035 796.928 704 34.3219 Potri.004G059700.1.v4.1 961 722.94 10 0.537423 Potri.007G009000.2.v4.1 1416 1177.93 0 0 Potri.003G141000.2.v4.1 2943 2704.93 1205.91 17.3212 Potri.016G087400.1.v4.1 270 53.4257 1088 791.22 Potri.015G069301.1.v4.1 564 326.073 0 0 Potri.010G195200.1.v4.1 1773 1534.93 750 18.9842 Potri.012G127500.1.v4.1 977 738.94 5096 267.941 ==> SRR13259382.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 433 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 630 SRR13259382 completed mapping pipeline successfully