Starting /dee2/code/volunteer_pipeline.sh SRR13259383 current disk space = 3088249966592 free memory = 1579027708 SRR13259383 SRAfilesize 2f4b58994dcdd724b1384952e9168db6 SRR13259383.sra SRR13259383.sra file validated SRR13259383 is paired end SRR13259383 is conventional basespace SRR13259383 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259383_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6595 37.0 37.0 37.0 37.0 37.0 2 36.5935 37.0 37.0 37.0 37.0 37.0 3 36.633 37.0 37.0 37.0 37.0 37.0 4 36.5875 37.0 37.0 37.0 37.0 37.0 5 36.6605 37.0 37.0 37.0 37.0 37.0 6 36.535 37.0 37.0 37.0 37.0 37.0 7 36.6235 37.0 37.0 37.0 37.0 37.0 8 36.6835 37.0 37.0 37.0 37.0 37.0 9 36.7615 37.0 37.0 37.0 37.0 37.0 10-14 36.64399999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.6206 37.0 37.0 37.0 37.0 37.0 20-24 36.5919 37.0 37.0 37.0 37.0 37.0 25-29 36.574799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4736 37.0 37.0 37.0 37.0 37.0 35-39 36.4802 37.0 37.0 37.0 37.0 37.0 40-44 36.4795 37.0 37.0 37.0 37.0 37.0 45-49 36.449400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4209 37.0 37.0 37.0 37.0 37.0 55-59 36.3511 37.0 37.0 37.0 37.0 37.0 60-64 36.356500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2741 37.0 37.0 37.0 37.0 37.0 70-74 36.321600000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.23440000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.27420000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.237199999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.1854 37.0 37.0 37.0 37.0 37.0 95-99 36.1344 37.0 37.0 37.0 37.0 37.0 100-104 36.0195 37.0 37.0 37.0 37.0 37.0 105-109 36.049 37.0 37.0 37.0 37.0 37.0 110-114 36.0362 37.0 37.0 37.0 37.0 37.0 115-119 35.9495 37.0 37.0 37.0 37.0 37.0 120-124 35.9768 37.0 37.0 37.0 37.0 37.0 125-129 35.868700000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.651599999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.6842 37.0 37.0 37.0 37.0 37.0 140-144 35.84570000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.6152 37.0 37.0 37.0 37.0 37.0 150 35.5735 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 2.0 24 3.0 25 2.0 26 10.0 27 7.0 28 9.0 29 16.0 30 24.0 31 29.0 32 42.0 33 69.0 34 99.0 35 279.0 36 3206.0 37 199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.8 17.599999999999998 18.4 29.2 2 20.849999999999998 24.65 38.25 16.25 3 22.775000000000002 30.525000000000002 25.900000000000002 20.8 4 24.525 35.875 20.424999999999997 19.175 5 22.3 37.45 22.425 17.825 6 17.575 37.7 24.175 20.549999999999997 7 16.375 16.900000000000002 43.25 23.474999999999998 8 20.375 21.45 27.325 30.85 9 20.775 23.025000000000002 27.650000000000002 28.549999999999997 10-14 21.005 29.39 27.084999999999997 22.52 15-19 21.834999999999997 27.965 28.065 22.134999999999998 20-24 21.38 28.92 27.425 22.275 25-29 21.490000000000002 29.244999999999997 27.66 21.605 30-34 21.740000000000002 28.7 27.605 21.955 35-39 22.27 29.065 27.389999999999997 21.275 40-44 23.18 28.265 27.38 21.175 45-49 22.16 28.470000000000002 27.150000000000002 22.220000000000002 50-54 22.535 28.255000000000003 27.685 21.525 55-59 22.23 28.439999999999998 26.805 22.525000000000002 60-64 22.35 28.59 27.515 21.545 65-69 22.535 27.98 27.85 21.634999999999998 70-74 22.255 28.64 27.29 21.815 75-79 21.884999999999998 28.754999999999995 27.455000000000002 21.905 80-84 21.895 28.665000000000003 26.88 22.56 85-89 22.055 28.754999999999995 27.400000000000002 21.790000000000003 90-94 23.419999999999998 28.244999999999997 26.855 21.48 95-99 21.65 28.515 27.555000000000003 22.28 100-104 21.945 28.59 27.605 21.86 105-109 22.2 28.03 27.47 22.3 110-114 22.675 27.634999999999998 27.639999999999997 22.05 115-119 22.36 28.084999999999997 27.655 21.9 120-124 21.875 27.73 28.499999999999996 21.895 125-129 22.040000000000003 27.855 28.025 22.08 130-134 22.375 27.839999999999996 28.235 21.55 135-139 22.555 27.985 27.85 21.61 140-144 22.59 27.265 27.994999999999997 22.15 145-149 22.145 27.975 27.72 22.16 150 23.375 27.1 27.650000000000002 21.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 2.0 21 1.0 22 2.0 23 1.5 24 0.5 25 5.0 26 11.0 27 15.5 28 18.5 29 18.5 30 21.0 31 25.5 32 32.0 33 49.5 34 67.5 35 74.5 36 89.0 37 112.0 38 150.5 39 174.5 40 195.0 41 218.5 42 222.0 43 227.5 44 254.5 45 264.5 46 245.5 47 229.5 48 213.0 49 179.5 50 141.0 51 133.5 52 114.0 53 87.0 54 76.0 55 63.0 56 52.5 57 41.0 58 30.0 59 29.0 60 22.5 61 16.5 62 14.5 63 9.5 64 5.5 65 4.0 66 4.5 67 5.0 68 5.5 69 3.5 70 2.0 71 2.5 72 2.0 73 1.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.575 #Duplication Level Percentage of deduplicated Percentage of total 1 84.92462311557789 71.825 2 12.592373632870233 21.3 3 1.8918120011823827 4.8 4 0.5025125628140703 1.7000000000000002 5 0.08867868755542418 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCACTTTACAAACAACATTCATGGTCACCAGATATTGACAGGGATGAGGC 5 0.125 No Hit GTACTGGGTAGGCCCTGTGGAAAGAGATCTAATGGATTTGCATTTGGTCC 5 0.125 No Hit CAGAAATGCAGAGAAAAAGAAGATACCAGCTGAAAACTTGAAGAGCATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATTC 10 0.006973645 144.0 2 >>END_MODULE SRR13259383 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259383_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3155 37.0 37.0 37.0 37.0 37.0 2 36.425 37.0 37.0 37.0 37.0 37.0 3 36.4625 37.0 37.0 37.0 37.0 37.0 4 36.474 37.0 37.0 37.0 37.0 37.0 5 36.437 37.0 37.0 37.0 37.0 37.0 6 36.475 37.0 37.0 37.0 37.0 37.0 7 36.3435 37.0 37.0 37.0 37.0 37.0 8 36.5165 37.0 37.0 37.0 37.0 37.0 9 36.5435 37.0 37.0 37.0 37.0 37.0 10-14 36.4898 37.0 37.0 37.0 37.0 37.0 15-19 36.4375 37.0 37.0 37.0 37.0 37.0 20-24 36.434000000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.3707 37.0 37.0 37.0 37.0 37.0 30-34 36.3571 37.0 37.0 37.0 37.0 37.0 35-39 36.3377 37.0 37.0 37.0 37.0 37.0 40-44 36.2618 37.0 37.0 37.0 37.0 37.0 45-49 36.2335 37.0 37.0 37.0 37.0 37.0 50-54 36.1631 37.0 37.0 37.0 37.0 37.0 55-59 36.1199 37.0 37.0 37.0 37.0 37.0 60-64 36.0616 37.0 37.0 37.0 37.0 37.0 65-69 36.0518 37.0 37.0 37.0 37.0 37.0 70-74 36.097 37.0 37.0 37.0 37.0 37.0 75-79 35.970099999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.949 37.0 37.0 37.0 37.0 37.0 85-89 35.762 37.0 37.0 37.0 37.0 37.0 90-94 35.8053 37.0 37.0 37.0 37.0 37.0 95-99 35.821000000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8314 37.0 37.0 37.0 37.0 37.0 105-109 35.7352 37.0 37.0 37.0 37.0 37.0 110-114 35.706 37.0 37.0 37.0 37.0 37.0 115-119 35.7275 37.0 37.0 37.0 37.0 37.0 120-124 35.445 37.0 37.0 37.0 37.0 37.0 125-129 35.4932 37.0 37.0 37.0 37.0 37.0 130-134 35.4323 37.0 37.0 37.0 37.0 37.0 135-139 35.3427 37.0 37.0 37.0 34.6 37.0 140-144 35.4081 37.0 37.0 37.0 34.6 37.0 145-149 35.215700000000005 37.0 37.0 37.0 29.8 37.0 150 35.1405 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 3.0 23 4.0 24 3.0 25 5.0 26 4.0 27 7.0 28 12.0 29 13.0 30 33.0 31 21.0 32 42.0 33 63.0 34 158.0 35 739.0 36 2808.0 37 79.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.1 17.875 17.95 30.075000000000003 2 22.375 23.95 36.125 17.549999999999997 3 21.275 30.775000000000002 26.6 21.349999999999998 4 23.35 35.875 20.575 20.200000000000003 5 21.575 36.3 22.6 19.525000000000002 6 18.025 35.9 24.25 21.825 7 15.675 16.525000000000002 44.525 23.275000000000002 8 19.825 21.8 27.474999999999998 30.9 9 19.55 22.725 29.125 28.599999999999998 10-14 21.044999999999998 29.294999999999998 27.05 22.61 15-19 22.384999999999998 27.985 27.33 22.3 20-24 21.465 29.32 27.900000000000002 21.315 25-29 21.38 29.09 27.325 22.205 30-34 21.245 28.76 27.55 22.445 35-39 21.529999999999998 28.155 27.74 22.575 40-44 21.4 28.660000000000004 27.785 22.155 45-49 21.295 28.505000000000003 27.384999999999998 22.814999999999998 50-54 21.355 28.720000000000002 27.855 22.07 55-59 21.065 28.610000000000003 28.235 22.09 60-64 21.685 28.33 27.825 22.16 65-69 21.825 28.78 27.279999999999998 22.115000000000002 70-74 21.695 28.705000000000002 27.205000000000002 22.395 75-79 21.58 28.79 27.505000000000003 22.125 80-84 21.505 28.860000000000003 27.060000000000002 22.575 85-89 21.94 28.27 26.845000000000002 22.945 90-94 21.959999999999997 28.349999999999998 27.735 21.955 95-99 21.295 28.299999999999997 27.455000000000002 22.95 100-104 22.035 28.22 27.400000000000002 22.345000000000002 105-109 21.75 28.655 27.21 22.384999999999998 110-114 22.134999999999998 27.49 27.71 22.665 115-119 21.675 28.03 28.095 22.2 120-124 21.965 27.700000000000003 27.565 22.770000000000003 125-129 21.685 28.345 27.41 22.56 130-134 22.275 28.055000000000003 27.134999999999998 22.535 135-139 21.675 28.335 27.865000000000002 22.125 140-144 21.855 27.889999999999997 27.694999999999997 22.56 145-149 21.75 27.92 27.944999999999997 22.384999999999998 150 21.425 28.725 28.025 21.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 3.0 25 3.0 26 1.0 27 5.0 28 13.0 29 19.5 30 30.0 31 43.5 32 50.0 33 57.5 34 71.5 35 84.5 36 108.0 37 125.5 38 137.5 39 169.5 40 192.0 41 197.5 42 230.5 43 251.0 44 248.5 45 252.5 46 227.5 47 218.5 48 222.0 49 187.5 50 145.5 51 122.5 52 97.5 53 82.0 54 75.5 55 61.5 56 52.5 57 37.0 58 26.5 59 25.5 60 22.0 61 17.5 62 15.0 63 14.0 64 9.0 65 5.5 66 4.5 67 6.0 68 5.5 69 2.5 70 1.5 71 2.0 72 3.0 73 1.0 74 0.0 75 2.0 76 2.5 77 0.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.075 #Duplication Level Percentage of deduplicated Percentage of total 1 85.42462533059066 72.675 2 12.253893623273582 20.849999999999998 3 1.7043784895680283 4.35 4 0.5877167205406993 2.0 5 0.02938583602703497 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGATTGTAACAAGGTCATAATAAATAAATACAGGTAGCTCAAACTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0125 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.0 0.025 0.0 0.0 0.0 118-119 0.0 0.025 0.0 0.0 0.0 120-121 0.0 0.025 0.0 0.0 0.0 122-123 0.0 0.025 0.0 0.0 0.0 124-125 0.0 0.025 0.0 0.0 0.0 126-127 0.0 0.025 0.0 0.0 0.0 128-129 0.0 0.025 0.0 0.0 0.0 130-131 0.0 0.025 0.0 0.0 0.0 132-133 0.0 0.025 0.0 0.0 0.0 134-135 0.0 0.025 0.0 0.0 0.0 136-137 0.0 0.025 0.0 0.0 0.0 138 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCGCCA 10 0.006973645 144.0 4 >>END_MODULE Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126025 spots for SRR13259383.sra Written 1126025 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra Read 1126015 spots for SRR13259383.sra Written 1126015 spots for SRR13259383.sra SRR ids: ['SRR13259383.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u8b68qm2 SRR13259383.sra spots: 22520310 blocks: [[1, 1126015], [1126016, 2252030], [2252031, 3378045], [3378046, 4504060], [4504061, 5630075], [5630076, 6756090], [6756091, 7882105], [7882106, 9008120], [9008121, 10134135], [10134136, 11260150], [11260151, 12386165], [12386166, 13512180], [13512181, 14638195], [14638196, 15764210], [15764211, 16890225], [16890226, 18016240], [18016241, 19142255], [19142256, 20268270], [20268271, 21394285], [21394286, 22520310]] SRR13259383 file size 7587701 SRR13259383 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259383 SRR13259383_1.fastq SRR13259383_2.fastq Input file: SRR13259383_1.fastq Paired file: SRR13259383_2.fastq trimmed: SRR13259383-trimmed-pair1.fastq, SRR13259383-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:32:53 2025 >> started Fri Feb 14 03:33:20 2025 >> done (27.354s) 22520310 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 89 ( 0.00%) empty read pairs filtered out after trimming by size control 22520221 (100.00%) read pairs available; of these: 8823 ( 0.04%) trimmed read pairs available after processing 22511398 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 2 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 3 0.00% 41 2 0.00% 42 1 0.00% 43 2 0.00% 44 2 0.00% 45 2 0.00% 46 0 0.00% 47 2 0.00% 48 1 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 1 0.00% 66 2 0.00% 67 2 0.00% 68 2 0.00% 69 0 0.00% 70 3 0.00% 71 3 0.00% 72 5 0.00% 73 5 0.00% 74 3 0.00% 75 10 0.00% 76 10 0.00% 77 8 0.00% 78 8 0.00% 79 8 0.00% 80 11 0.00% 81 9 0.00% 82 6 0.00% 83 8 0.00% 84 9 0.00% 85 13 0.00% 86 11 0.00% 87 11 0.00% 88 16 0.00% 89 9 0.00% 90 16 0.00% 91 22 0.00% 92 22 0.00% 93 22 0.00% 94 32 0.00% 95 36 0.00% 96 37 0.00% 97 41 0.00% 98 40 0.00% 99 34 0.00% 100 39 0.00% 101 39 0.00% 102 46 0.00% 103 49 0.00% 104 47 0.00% 105 59 0.00% 106 51 0.00% 107 66 0.00% 108 65 0.00% 109 51 0.00% 110 75 0.00% 111 71 0.00% 112 84 0.00% 113 93 0.00% 114 80 0.00% 115 94 0.00% 116 92 0.00% 117 97 0.00% 118 123 0.00% 119 101 0.00% 120 105 0.00% 121 115 0.00% 122 124 0.00% 123 120 0.00% 124 135 0.00% 125 123 0.00% 126 128 0.00% 127 136 0.00% 128 170 0.00% 129 154 0.00% 130 150 0.00% 131 184 0.00% 132 183 0.00% 133 172 0.00% 134 183 0.00% 135 219 0.00% 136 235 0.00% 137 214 0.00% 138 237 0.00% 139 239 0.00% 140 244 0.00% 141 242 0.00% 142 308 0.00% 143 289 0.00% 144 284 0.00% 145 321 0.00% 146 396 0.00% 147 445 0.00% 148 508 0.00% 149 541 0.00% 150 22511398 99.96% 22520221 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=25 prefix-density=0.18 prefix-fanout=2.6 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=40.59 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.2 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=28 prefix-density=0.18 prefix-fanout=2.4 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=42.07 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.1 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC SRR13259383 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:34:08 Started mapping on | Feb 14 03:34:08 Finished on | Feb 14 03:38:16 Mapping speed, Million of reads per hour | 326.91 Number of input reads | 22520221 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20077579 Uniquely mapped reads % | 89.15% Average mapped length | 298.16 Number of splices: Total | 18006714 Number of splices: Annotated (sjdb) | 17615849 Number of splices: GT/AG | 17693742 Number of splices: GC/AG | 246730 Number of splices: AT/AC | 14791 Number of splices: Non-canonical | 51451 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 643283 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 98074 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.36% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1799359 1799359 1799359 N_multimapping 643283 643283 643283 N_noFeature 657418 10253675 10287124 N_ambiguous 310241 58623 58215 UnstrandedReadsAssigned:19109920 PositiveStrandReadsAssigned:9765281 NegativeStrandReadsAssigned:9732240 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259383 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259383-trimmed-pair1.fastq SRR13259383-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,520,221 reads, 19,776,420 reads pseudoaligned [quant] estimated average fragment length: 245.604 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR13259383.ke.tsv 34699 SRR13259383.se.tsv 87100 total ==> SRR13259383.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.4 1501 31.4573 Potri.005G024800.1.v4.1 1035 790.396 1918 90.1885 Potri.004G059700.1.v4.1 961 716.401 20 1.03758 Potri.007G009000.2.v4.1 1416 1171.4 0 0 Potri.003G141000.2.v4.1 2943 2698.4 897.299 12.3589 Potri.016G087400.1.v4.1 270 51.2718 1433 1038.76 Potri.015G069301.1.v4.1 564 319.553 0 0 Potri.010G195200.1.v4.1 1773 1528.4 1516.93 36.8872 Potri.012G127500.1.v4.1 977 732.401 2119 107.53 ==> SRR13259383.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 394 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 9 Potri.001G452600.v4.1 33 SRR13259383 completed mapping pipeline successfully