Starting /dee2/code/volunteer_pipeline.sh SRR13259384 current disk space = 3088279535616 free memory = 1579887020 SRR13259384 SRAfilesize 99e8aae6ebeae2ac518e81026c39f928 SRR13259384.sra SRR13259384.sra file validated SRR13259384 is paired end SRR13259384 is conventional basespace SRR13259384 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259384_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5895 37.0 37.0 37.0 37.0 37.0 2 36.598 37.0 37.0 37.0 37.0 37.0 3 36.6025 37.0 37.0 37.0 37.0 37.0 4 36.538 37.0 37.0 37.0 37.0 37.0 5 36.6665 37.0 37.0 37.0 37.0 37.0 6 36.594 37.0 37.0 37.0 37.0 37.0 7 36.603 37.0 37.0 37.0 37.0 37.0 8 36.598 37.0 37.0 37.0 37.0 37.0 9 36.647 37.0 37.0 37.0 37.0 37.0 10-14 36.5751 37.0 37.0 37.0 37.0 37.0 15-19 36.57339999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.514900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4832 37.0 37.0 37.0 37.0 37.0 30-34 36.4408 37.0 37.0 37.0 37.0 37.0 35-39 36.3762 37.0 37.0 37.0 37.0 37.0 40-44 36.3757 37.0 37.0 37.0 37.0 37.0 45-49 36.3399 37.0 37.0 37.0 37.0 37.0 50-54 36.3716 37.0 37.0 37.0 37.0 37.0 55-59 36.32895 37.0 37.0 37.0 37.0 37.0 60-64 36.23695 37.0 37.0 37.0 37.0 37.0 65-69 36.2091 37.0 37.0 37.0 37.0 37.0 70-74 36.2201 37.0 37.0 37.0 37.0 37.0 75-79 36.164300000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1802 37.0 37.0 37.0 37.0 37.0 85-89 36.1164 37.0 37.0 37.0 37.0 37.0 90-94 36.0925 37.0 37.0 37.0 37.0 37.0 95-99 36.0625 37.0 37.0 37.0 37.0 37.0 100-104 35.969100000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.9619 37.0 37.0 37.0 37.0 37.0 110-114 35.980999999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.9246 37.0 37.0 37.0 37.0 37.0 120-124 35.8984 37.0 37.0 37.0 37.0 37.0 125-129 35.763999999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.531499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.6689 37.0 37.0 37.0 37.0 37.0 140-144 35.697 37.0 37.0 37.0 37.0 37.0 145-149 35.451 37.0 37.0 37.0 34.6 37.0 150 35.457 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 0.0 19 1.0 20 1.0 21 1.0 22 0.0 23 2.0 24 1.0 25 5.0 26 9.0 27 8.0 28 14.0 29 16.0 30 37.0 31 33.0 32 50.0 33 75.0 34 111.0 35 332.0 36 3084.0 37 218.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.725 17.599999999999998 17.7 30.975 2 20.25 24.3 38.074999999999996 17.375 3 20.150000000000002 29.95 28.075 21.825 4 23.35 35.125 20.875 20.65 5 23.75 35.699999999999996 20.525 20.025000000000002 6 17.974999999999998 36.25 25.324999999999996 20.45 7 18.65 15.925 42.125 23.3 8 20.875 21.15 27.750000000000004 30.225 9 20.25 24.349999999999998 28.15 27.250000000000004 10-14 21.115000000000002 28.735 27.005000000000003 23.145 15-19 21.335 28.694999999999997 27.534999999999997 22.435 20-24 21.725 28.315 27.675 22.285 25-29 20.715 28.715000000000003 27.805000000000003 22.765 30-34 21.455 28.904999999999998 27.765 21.875 35-39 21.595 28.965000000000003 27.084999999999997 22.355 40-44 21.98 29.54 27.055 21.425 45-49 22.02 28.99 26.845000000000002 22.145 50-54 21.59 28.185 27.800000000000004 22.425 55-59 21.741087054352718 28.8064403220161 26.991349567478373 22.461123056152807 60-64 21.806090304515227 28.97644882244112 27.096354817740888 22.121106055302764 65-69 22.08 28.689999999999998 27.805000000000003 21.425 70-74 22.040000000000003 28.205000000000002 27.345000000000002 22.41 75-79 22.655 28.475 26.634999999999998 22.235 80-84 21.97 28.625 27.32 22.085 85-89 22.335 27.79 27.305 22.57 90-94 22.275 28.95 26.645000000000003 22.13 95-99 22.13 27.845 27.339999999999996 22.685 100-104 22.759999999999998 28.03 27.169999999999998 22.040000000000003 105-109 21.790000000000003 28.175 27.79 22.245 110-114 22.295 27.845 27.084999999999997 22.775000000000002 115-119 22.06 28.345 27.61 21.985 120-124 21.95 27.72 28.42 21.91 125-129 21.85 27.455000000000002 28.310000000000002 22.384999999999998 130-134 22.545 27.705000000000002 27.675 22.075 135-139 22.43 27.455000000000002 28.02 22.095000000000002 140-144 22.145 27.57 27.750000000000004 22.535 145-149 22.264999999999997 28.22 27.85 21.665 150 21.9 26.974999999999998 27.975 23.150000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 3.0 23 3.5 24 3.0 25 5.5 26 5.5 27 7.0 28 14.5 29 18.0 30 20.5 31 29.5 32 37.0 33 47.5 34 65.0 35 75.0 36 90.0 37 116.5 38 144.5 39 163.5 40 183.5 41 230.5 42 253.0 43 236.0 44 247.0 45 255.0 46 234.5 47 227.0 48 203.5 49 182.0 50 160.0 51 132.5 52 113.5 53 89.5 54 76.0 55 67.5 56 49.0 57 37.0 58 33.5 59 24.0 60 18.0 61 14.5 62 14.5 63 14.0 64 10.5 65 6.5 66 4.5 67 10.0 68 10.5 69 4.5 70 2.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.625 #Duplication Level Percentage of deduplicated Percentage of total 1 83.70702541106128 70.0 2 13.51270553064275 22.6 3 2.301943198804185 5.775 4 0.4484304932735426 1.5 5 0.029895366218236175 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCAACTGTGACAACGACCCGGGGGCGCCGCTCGCCCTCTCCGCTTCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0125 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCCTC 10 0.006973645 144.0 9 TACTTCT 10 0.006973645 144.0 9 CTACTTC 10 0.006973645 144.0 8 >>END_MODULE SRR13259384 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259384_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4375 37.0 37.0 37.0 37.0 37.0 2 36.417 37.0 37.0 37.0 37.0 37.0 3 36.428 37.0 37.0 37.0 37.0 37.0 4 36.5285 37.0 37.0 37.0 37.0 37.0 5 36.538 37.0 37.0 37.0 37.0 37.0 6 36.5195 37.0 37.0 37.0 37.0 37.0 7 36.451 37.0 37.0 37.0 37.0 37.0 8 36.526 37.0 37.0 37.0 37.0 37.0 9 36.617 37.0 37.0 37.0 37.0 37.0 10-14 36.522200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.510299999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4384 37.0 37.0 37.0 37.0 37.0 25-29 36.4336 37.0 37.0 37.0 37.0 37.0 30-34 36.435500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4125 37.0 37.0 37.0 37.0 37.0 40-44 36.4118 37.0 37.0 37.0 37.0 37.0 45-49 36.305600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.226800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.232600000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.2078 37.0 37.0 37.0 37.0 37.0 65-69 36.1573 37.0 37.0 37.0 37.0 37.0 70-74 36.1702 37.0 37.0 37.0 37.0 37.0 75-79 36.0534 37.0 37.0 37.0 37.0 37.0 80-84 36.055600000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8921 37.0 37.0 37.0 37.0 37.0 90-94 35.932900000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8705 37.0 37.0 37.0 37.0 37.0 100-104 35.8574 37.0 37.0 37.0 37.0 37.0 105-109 35.8695 37.0 37.0 37.0 37.0 37.0 110-114 35.7752 37.0 37.0 37.0 37.0 37.0 115-119 35.806799999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.6035 37.0 37.0 37.0 37.0 37.0 125-129 35.6432 37.0 37.0 37.0 37.0 37.0 130-134 35.552 37.0 37.0 37.0 37.0 37.0 135-139 35.4457 37.0 37.0 37.0 34.6 37.0 140-144 35.529399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.3944 37.0 37.0 37.0 34.6 37.0 150 35.569 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 3.0 20 0.0 21 0.0 22 1.0 23 6.0 24 2.0 25 4.0 26 6.0 27 11.0 28 9.0 29 13.0 30 20.0 31 18.0 32 50.0 33 51.0 34 132.0 35 644.0 36 2905.0 37 124.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.8 16.1 18.675 30.425 2 21.55 25.7 35.25 17.5 3 21.05 31.275 28.125 19.55 4 23.849999999999998 35.525 20.65 19.975 5 22.75 35.65 22.45 19.15 6 18.675 34.4 25.124999999999996 21.8 7 17.275 17.45 42.325 22.95 8 20.825 21.224999999999998 27.250000000000004 30.7 9 19.3 24.05 27.875 28.775000000000002 10-14 21.41 29.62 26.47 22.5 15-19 21.560000000000002 27.79 27.615000000000002 23.035 20-24 21.36 28.525 27.935 22.18 25-29 21.38 28.799999999999997 27.83 21.990000000000002 30-34 21.065 28.88 27.67 22.384999999999998 35-39 21.790000000000003 27.845 28.015 22.35 40-44 21.5 27.860000000000003 28.63 22.009999999999998 45-49 22.125 28.389999999999997 26.840000000000003 22.645 50-54 21.865000000000002 28.01 27.57 22.555 55-59 21.92 28.49 27.505000000000003 22.085 60-64 22.185 27.785 27.765 22.264999999999997 65-69 21.63 29.265 27.084999999999997 22.02 70-74 22.065 28.18 27.525 22.23 75-79 21.855 28.634999999999998 27.255000000000003 22.255 80-84 21.709999999999997 28.955 26.619999999999997 22.715 85-89 22.23 28.389999999999997 27.450000000000003 21.93 90-94 22.355 27.97 27.1 22.575 95-99 22.18 27.66 28.125 22.035 100-104 22.62 28.22 27.22 21.94 105-109 22.470000000000002 27.810000000000002 27.834999999999997 21.884999999999998 110-114 22.32 28.285 27.63 21.765 115-119 22.7 27.57 27.295 22.435 120-124 22.13 26.77 28.67 22.43 125-129 22.015 27.750000000000004 28.275 21.959999999999997 130-134 22.515 27.91 27.994999999999997 21.58 135-139 22.33 27.215 27.83 22.625 140-144 21.825 27.544999999999998 28.555000000000003 22.075 145-149 22.81 27.27 27.955000000000002 21.965 150 21.349999999999998 26.825 29.125 22.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.0 23 1.0 24 3.0 25 3.5 26 3.5 27 7.0 28 10.0 29 12.5 30 17.0 31 32.0 32 49.0 33 55.5 34 71.0 35 81.5 36 93.0 37 111.0 38 130.0 39 158.5 40 195.0 41 209.5 42 225.5 43 246.0 44 232.5 45 238.0 46 256.5 47 243.5 48 213.5 49 191.5 50 163.0 51 135.0 52 117.0 53 102.0 54 89.0 55 67.5 56 42.5 57 29.0 58 29.0 59 23.5 60 14.5 61 14.5 62 15.0 63 14.5 64 8.5 65 4.5 66 6.5 67 5.0 68 4.5 69 3.5 70 2.0 71 1.5 72 2.0 73 2.5 74 1.0 75 0.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.96536279486413 70.3 2 13.138250223947448 22.0 3 2.4186324275903255 6.075 4 0.4478948939982084 1.5 5 0.029859659599880562 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTCTCTGGCGCGAATTCGCGAGGTAGTTCTAACGACGCAACAAGCCCACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0125 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCTAC 10 0.006973645 144.0 4 >>END_MODULE Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150396 spots for SRR13259384.sra Written 1150396 spots for SRR13259384.sra Read 1150398 spots for SRR13259384.sra Written 1150398 spots for SRR13259384.sra SRR ids: ['SRR13259384.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u_g3pld2 SRR13259384.sra spots: 23007922 blocks: [[1, 1150396], [1150397, 2300792], [2300793, 3451188], [3451189, 4601584], [4601585, 5751980], [5751981, 6902376], [6902377, 8052772], [8052773, 9203168], [9203169, 10353564], [10353565, 11503960], [11503961, 12654356], [12654357, 13804752], [13804753, 14955148], [14955149, 16105544], [16105545, 17255940], [17255941, 18406336], [18406337, 19556732], [19556733, 20707128], [20707129, 21857524], [21857525, 23007922]] SRR13259384 file size 7752460 SRR13259384 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259384 SRR13259384_1.fastq SRR13259384_2.fastq Input file: SRR13259384_1.fastq Paired file: SRR13259384_2.fastq trimmed: SRR13259384-trimmed-pair1.fastq, SRR13259384-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:31:40 2025 >> started Fri Feb 14 03:32:05 2025 >> done (25.223s) 23007922 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 145 ( 0.00%) empty read pairs filtered out after trimming by size control 23007777 (100.00%) read pairs available; of these: 9493 ( 0.04%) trimmed read pairs available after processing 22998284 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 1 0.00% 39 1 0.00% 40 1 0.00% 41 0 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 1 0.00% 47 0 0.00% 48 1 0.00% 49 1 0.00% 50 2 0.00% 51 0 0.00% 52 0 0.00% 53 1 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 1 0.00% 68 1 0.00% 69 1 0.00% 70 3 0.00% 71 2 0.00% 72 3 0.00% 73 3 0.00% 74 9 0.00% 75 6 0.00% 76 5 0.00% 77 7 0.00% 78 7 0.00% 79 4 0.00% 80 5 0.00% 81 9 0.00% 82 9 0.00% 83 9 0.00% 84 7 0.00% 85 7 0.00% 86 11 0.00% 87 10 0.00% 88 15 0.00% 89 11 0.00% 90 14 0.00% 91 18 0.00% 92 14 0.00% 93 22 0.00% 94 25 0.00% 95 31 0.00% 96 26 0.00% 97 33 0.00% 98 32 0.00% 99 25 0.00% 100 28 0.00% 101 32 0.00% 102 46 0.00% 103 41 0.00% 104 39 0.00% 105 39 0.00% 106 63 0.00% 107 41 0.00% 108 66 0.00% 109 55 0.00% 110 46 0.00% 111 75 0.00% 112 62 0.00% 113 71 0.00% 114 83 0.00% 115 70 0.00% 116 83 0.00% 117 88 0.00% 118 98 0.00% 119 83 0.00% 120 87 0.00% 121 113 0.00% 122 131 0.00% 123 127 0.00% 124 132 0.00% 125 142 0.00% 126 135 0.00% 127 143 0.00% 128 149 0.00% 129 147 0.00% 130 152 0.00% 131 190 0.00% 132 185 0.00% 133 203 0.00% 134 241 0.00% 135 216 0.00% 136 260 0.00% 137 240 0.00% 138 286 0.00% 139 282 0.00% 140 267 0.00% 141 307 0.00% 142 333 0.00% 143 349 0.00% 144 405 0.00% 145 405 0.00% 146 447 0.00% 147 563 0.00% 148 559 0.00% 149 687 0.00% 150 22998284 99.96% 23007777 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=10.18 fanout-score-rank=4 prefix-density=0.34 prefix-fanout=4.8 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=42.85 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.3 sequence=AGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCATTCTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=10.10 fanout-score-rank=4 prefix-density=0.33 prefix-fanout=4.7 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=36.29 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.6 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATT SRR13259384 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:32:51 Started mapping on | Feb 14 03:32:51 Finished on | Feb 14 03:36:28 Mapping speed, Million of reads per hour | 381.70 Number of input reads | 23007777 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20918367 Uniquely mapped reads % | 90.92% Average mapped length | 298.27 Number of splices: Total | 19309267 Number of splices: Annotated (sjdb) | 18925535 Number of splices: GT/AG | 18974011 Number of splices: GC/AG | 271185 Number of splices: AT/AC | 15479 Number of splices: Non-canonical | 48592 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 575420 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 93805 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.02% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1513990 1513990 1513990 N_multimapping 575420 575420 575420 N_noFeature 672188 10688244 10707505 N_ambiguous 310197 57994 58129 UnstrandedReadsAssigned:19935982 PositiveStrandReadsAssigned:10172129 NegativeStrandReadsAssigned:10152733 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259384 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259384-trimmed-pair1.fastq SRR13259384-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,007,777 reads, 20,579,035 reads pseudoaligned [quant] estimated average fragment length: 233.711 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR13259384.ke.tsv 34699 SRR13259384.se.tsv 87100 total ==> SRR13259384.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.29 1404 29.2276 Potri.005G024800.1.v4.1 1035 802.289 1698 78.6577 Potri.004G059700.1.v4.1 961 728.294 37 1.88812 Potri.007G009000.2.v4.1 1416 1183.29 0 0 Potri.003G141000.2.v4.1 2943 2710.29 970 13.3012 Potri.016G087400.1.v4.1 270 54.9774 1246.47 842.618 Potri.015G069301.1.v4.1 564 331.377 0 0 Potri.010G195200.1.v4.1 1773 1540.29 790 19.0616 Potri.012G127500.1.v4.1 977 744.289 3317 165.63 ==> SRR13259384.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 465 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 37 SRR13259384 completed mapping pipeline successfully