Starting /dee2/code/volunteer_pipeline.sh SRR13259385 current disk space = 3088267452416 free memory = 1578296424 SRR13259385 SRAfilesize a7b46f05bb4d81819531e05dfc6e2cf8 SRR13259385.sra SRR13259385.sra file validated SRR13259385 is paired end SRR13259385 is conventional basespace SRR13259385 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259385_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7045 37.0 37.0 37.0 37.0 37.0 2 36.631 37.0 37.0 37.0 37.0 37.0 3 36.59 37.0 37.0 37.0 37.0 37.0 4 36.588 37.0 37.0 37.0 37.0 37.0 5 36.6635 37.0 37.0 37.0 37.0 37.0 6 36.6115 37.0 37.0 37.0 37.0 37.0 7 36.654 37.0 37.0 37.0 37.0 37.0 8 36.6675 37.0 37.0 37.0 37.0 37.0 9 36.7225 37.0 37.0 37.0 37.0 37.0 10-14 36.6251 37.0 37.0 37.0 37.0 37.0 15-19 36.6383 37.0 37.0 37.0 37.0 37.0 20-24 36.6135 37.0 37.0 37.0 37.0 37.0 25-29 36.514300000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4533 37.0 37.0 37.0 37.0 37.0 35-39 36.419500000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4093 37.0 37.0 37.0 37.0 37.0 45-49 36.4006 37.0 37.0 37.0 37.0 37.0 50-54 36.4146 37.0 37.0 37.0 37.0 37.0 55-59 36.2817 37.0 37.0 37.0 37.0 37.0 60-64 36.3017 37.0 37.0 37.0 37.0 37.0 65-69 36.2103 37.0 37.0 37.0 37.0 37.0 70-74 36.2337 37.0 37.0 37.0 37.0 37.0 75-79 36.2265 37.0 37.0 37.0 37.0 37.0 80-84 36.2173 37.0 37.0 37.0 37.0 37.0 85-89 36.2072 37.0 37.0 37.0 37.0 37.0 90-94 36.1828 37.0 37.0 37.0 37.0 37.0 95-99 36.1976 37.0 37.0 37.0 37.0 37.0 100-104 35.987700000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.029599999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.9901 37.0 37.0 37.0 37.0 37.0 115-119 35.9243 37.0 37.0 37.0 37.0 37.0 120-124 35.854200000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.8264 37.0 37.0 37.0 37.0 37.0 130-134 35.5485 37.0 37.0 37.0 37.0 37.0 135-139 35.6278 37.0 37.0 37.0 37.0 37.0 140-144 35.76 37.0 37.0 37.0 37.0 37.0 145-149 35.537600000000005 37.0 37.0 37.0 37.0 37.0 150 35.4315 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 1.0 25 0.0 26 3.0 27 11.0 28 21.0 29 17.0 30 32.0 31 43.0 32 48.0 33 51.0 34 93.0 35 307.0 36 3142.0 37 224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.125 15.375 17.7 33.800000000000004 2 23.25 21.525 35.125 20.1 3 21.975 27.400000000000002 28.15 22.475 4 24.15 31.175000000000004 22.05 22.625 5 22.825 34.425 23.05 19.7 6 18.15 37.35 23.75 20.75 7 18.05 19.0 40.550000000000004 22.400000000000002 8 20.424999999999997 22.575 28.1 28.9 9 21.625 22.7 29.325000000000003 26.35 10-14 22.515 27.525 26.755000000000003 23.205000000000002 15-19 23.0 27.83 27.02 22.15 20-24 21.975 28.060000000000002 26.779999999999998 23.185 25-29 22.564999999999998 27.57 26.905 22.96 30-34 22.759999999999998 27.334999999999997 27.534999999999997 22.37 35-39 22.13 27.785 27.315 22.770000000000003 40-44 22.305 27.955000000000002 26.724999999999998 23.015 45-49 22.34 27.57 27.595 22.495 50-54 22.055 28.285 27.150000000000002 22.509999999999998 55-59 23.025000000000002 27.169999999999998 26.96 22.845 60-64 22.58 27.21 27.139999999999997 23.07 65-69 22.2 27.794999999999998 27.389999999999997 22.615 70-74 22.25 27.779999999999998 27.02 22.95 75-79 22.985 26.77 26.810000000000002 23.435 80-84 22.91 27.715 26.790000000000003 22.585 85-89 23.25 27.425 26.490000000000002 22.835 90-94 22.68 27.915 26.625 22.78 95-99 22.71 26.955000000000002 27.35 22.985 100-104 22.509999999999998 27.725 27.060000000000002 22.705000000000002 105-109 23.345 26.740000000000002 27.35 22.564999999999998 110-114 22.935 27.384999999999998 26.82 22.86 115-119 23.29 27.29 27.055 22.365 120-124 22.985 27.24 26.46 23.315 125-129 23.125 27.1 27.125 22.650000000000002 130-134 22.965 27.310000000000002 27.02 22.705000000000002 135-139 22.55 26.674999999999997 27.965 22.81 140-144 22.685 26.625 27.095000000000002 23.595 145-149 22.869999999999997 27.525 27.334999999999997 22.27 150 21.725 26.200000000000003 28.349999999999998 23.724999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 2.5 26 4.5 27 5.5 28 8.0 29 10.0 30 14.0 31 23.0 32 33.5 33 42.0 34 50.0 35 66.5 36 75.5 37 87.5 38 103.0 39 142.0 40 193.5 41 203.0 42 208.0 43 222.0 44 238.0 45 245.5 46 236.5 47 214.0 48 197.0 49 191.0 50 172.5 51 165.5 52 145.0 53 119.5 54 104.5 55 85.5 56 63.5 57 53.5 58 61.0 59 45.0 60 30.0 61 29.0 62 24.5 63 24.0 64 21.5 65 10.5 66 6.5 67 6.5 68 4.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.625 #Duplication Level Percentage of deduplicated Percentage of total 1 84.75627769571639 71.72500000000001 2 13.028064992614475 22.05 3 1.6838995568685375 4.275 4 0.38404726735598227 1.3 5 0.11816838995568685 0.5 6 0.029542097488921712 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAATACAAAATCTGGCAAAACCTTCCTCCCATCCTCCGTAAACCCATTA 6 0.15 No Hit TCGGAACTGGAAGAAAATTTTCGTGAATTCCTCCCGTATATTATGACTAC 5 0.125 No Hit CATCTCACAAAGACTTGAGCTGACAAAATAAGAGAGCTTCGGAACAACAT 5 0.125 No Hit CCCAACTACTGTAACTGGAAACCTTTCTGGTCTTAAGCCAGGCCTTCATG 5 0.125 No Hit AAGAAATAAAGGCAAATATGGCAGTTCTCGGTAAAGAAGCGGCGGCTGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0125 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTTTC 10 0.006973645 144.0 3 GGGGGGG 35 0.0036813593 20.571428 10-14 AAAAAAA 40 0.007966741 18.0 25-29 >>END_MODULE SRR13259385 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259385_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46 37.0 37.0 37.0 37.0 37.0 2 36.442 37.0 37.0 37.0 37.0 37.0 3 36.5985 37.0 37.0 37.0 37.0 37.0 4 36.4625 37.0 37.0 37.0 37.0 37.0 5 36.5575 37.0 37.0 37.0 37.0 37.0 6 36.54 37.0 37.0 37.0 37.0 37.0 7 36.521 37.0 37.0 37.0 37.0 37.0 8 36.6475 37.0 37.0 37.0 37.0 37.0 9 36.577 37.0 37.0 37.0 37.0 37.0 10-14 36.493700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5073 37.0 37.0 37.0 37.0 37.0 20-24 36.489700000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.421 37.0 37.0 37.0 37.0 37.0 30-34 36.4423 37.0 37.0 37.0 37.0 37.0 35-39 36.3939 37.0 37.0 37.0 37.0 37.0 40-44 36.35809999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.2904 37.0 37.0 37.0 37.0 37.0 50-54 36.272000000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.2876 37.0 37.0 37.0 37.0 37.0 60-64 36.1709 37.0 37.0 37.0 37.0 37.0 65-69 36.2051 37.0 37.0 37.0 37.0 37.0 70-74 36.18920000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.052099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0669 37.0 37.0 37.0 37.0 37.0 85-89 35.9326 37.0 37.0 37.0 37.0 37.0 90-94 35.912099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9076 37.0 37.0 37.0 37.0 37.0 100-104 35.9219 37.0 37.0 37.0 37.0 37.0 105-109 35.932900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.813 37.0 37.0 37.0 37.0 37.0 115-119 35.8047 37.0 37.0 37.0 37.0 37.0 120-124 35.5991 37.0 37.0 37.0 37.0 37.0 125-129 35.54259999999999 37.0 37.0 37.0 34.6 37.0 130-134 35.5143 37.0 37.0 37.0 37.0 37.0 135-139 35.4448 37.0 37.0 37.0 34.6 37.0 140-144 35.5075 37.0 37.0 37.0 37.0 37.0 145-149 35.342600000000004 37.0 37.0 37.0 29.8 37.0 150 35.466 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 0.0 21 1.0 22 3.0 23 3.0 24 4.0 25 3.0 26 3.0 27 7.0 28 20.0 29 17.0 30 20.0 31 23.0 32 39.0 33 46.0 34 129.0 35 591.0 36 2982.0 37 106.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.849999999999994 14.899999999999999 17.075000000000003 33.175 2 21.775 22.95 34.925 20.349999999999998 3 23.549999999999997 28.575 26.85 21.025 4 27.275 32.15 19.025 21.55 5 24.05 35.75 21.9 18.3 6 20.75 37.45 22.325 19.475 7 18.8 18.55 42.0 20.65 8 20.75 21.15 29.475 28.625 9 22.45 23.150000000000002 28.199999999999996 26.200000000000003 10-14 22.025 28.345 26.66 22.97 15-19 22.53 27.755000000000003 26.784999999999997 22.93 20-24 22.235 28.485 26.700000000000003 22.58 25-29 22.805 27.08 27.439999999999998 22.675 30-34 22.400000000000002 28.1 27.034999999999997 22.465 35-39 22.365 27.785 27.01 22.84 40-44 22.035 28.38 26.71 22.875 45-49 22.53 27.455000000000002 27.175 22.84 50-54 22.29 27.500000000000004 27.250000000000004 22.96 55-59 22.814999999999998 27.265 27.055 22.865 60-64 22.495 26.83 27.42 23.255 65-69 22.74 27.860000000000003 26.779999999999998 22.62 70-74 22.495 27.229999999999997 27.515 22.759999999999998 75-79 23.44 27.18 26.655 22.725 80-84 22.57 27.400000000000002 27.21 22.82 85-89 23.04 27.445000000000004 26.365 23.150000000000002 90-94 23.04 26.875 27.450000000000003 22.634999999999998 95-99 22.98 27.355 26.935 22.73 100-104 22.59 27.055 26.76 23.595 105-109 22.515 27.384999999999998 27.345000000000002 22.755 110-114 22.985 27.305 26.540000000000003 23.169999999999998 115-119 22.355 27.105 27.965 22.575 120-124 22.814999999999998 27.515 27.034999999999997 22.634999999999998 125-129 22.57 27.175 27.229999999999997 23.025000000000002 130-134 22.255 27.38 27.450000000000003 22.915 135-139 22.5 26.825 28.13 22.545 140-144 22.495 27.52 27.48 22.505 145-149 22.8 26.72 26.91 23.57 150 23.1 26.05 27.0 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.5 25 3.0 26 2.5 27 5.0 28 8.5 29 12.0 30 12.5 31 21.0 32 29.5 33 29.0 34 43.5 35 62.0 36 72.0 37 96.5 38 132.5 39 142.5 40 174.5 41 206.5 42 211.5 43 222.0 44 239.0 45 248.5 46 235.0 47 197.5 48 194.5 49 205.0 50 168.0 51 151.5 52 153.0 53 129.0 54 95.0 55 83.5 56 79.0 57 59.0 58 54.5 59 54.5 60 37.0 61 31.5 62 22.0 63 18.0 64 18.5 65 10.0 66 8.0 67 7.5 68 4.0 69 3.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.75 #Duplication Level Percentage of deduplicated Percentage of total 1 84.89675516224189 71.95 2 12.890855457227138 21.85 3 1.6814159292035398 4.275 4 0.41297935103244837 1.4000000000000001 5 0.08849557522123894 0.375 6 0.029498525073746312 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACGTGTTCCGTTTCATATTTGCCATTCTACGCATTCCGTTTCCTTCGC 6 0.15 No Hit GCAGAAGCCATTTCCACACTTTTCAGGTTTATATTACCCGAATTATATAA 5 0.125 No Hit TTAGCAGAAGCTGTTGCTCTAATTGCTGCTGGCACTGTGCATCGTGTTTG 5 0.125 No Hit GCCATCATCACCAACAGTGACATTTCCCAGATCACCAGCATGACGATTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040685 spots for SRR13259385.sra Written 1040685 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra Read 1040674 spots for SRR13259385.sra Written 1040674 spots for SRR13259385.sra SRR ids: ['SRR13259385.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_91z_ydop SRR13259385.sra spots: 20813491 blocks: [[1, 1040674], [1040675, 2081348], [2081349, 3122022], [3122023, 4162696], [4162697, 5203370], [5203371, 6244044], [6244045, 7284718], [7284719, 8325392], [8325393, 9366066], [9366067, 10406740], [10406741, 11447414], [11447415, 12488088], [12488089, 13528762], [13528763, 14569436], [14569437, 15610110], [15610111, 16650784], [16650785, 17691458], [17691459, 18732132], [18732133, 19772806], [19772807, 20813491]] SRR13259385 file size 7010983 SRR13259385 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259385 SRR13259385_1.fastq SRR13259385_2.fastq Input file: SRR13259385_1.fastq Paired file: SRR13259385_2.fastq trimmed: SRR13259385-trimmed-pair1.fastq, SRR13259385-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:35:25 2025 >> started Fri Feb 14 03:35:49 2025 >> done (23.867s) 20813491 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 85 ( 0.00%) empty read pairs filtered out after trimming by size control 20813406 (100.00%) read pairs available; of these: 8077 ( 0.04%) trimmed read pairs available after processing 20805329 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 1 0.00% 39 1 0.00% 40 0 0.00% 41 1 0.00% 42 3 0.00% 43 2 0.00% 44 3 0.00% 45 1 0.00% 46 1 0.00% 47 0 0.00% 48 1 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 1 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 0 0.00% 65 2 0.00% 66 2 0.00% 67 2 0.00% 68 2 0.00% 69 2 0.00% 70 1 0.00% 71 5 0.00% 72 3 0.00% 73 2 0.00% 74 3 0.00% 75 2 0.00% 76 1 0.00% 77 3 0.00% 78 1 0.00% 79 1 0.00% 80 0 0.00% 81 2 0.00% 82 2 0.00% 83 4 0.00% 84 5 0.00% 85 5 0.00% 86 5 0.00% 87 5 0.00% 88 2 0.00% 89 7 0.00% 90 11 0.00% 91 8 0.00% 92 8 0.00% 93 11 0.00% 94 12 0.00% 95 19 0.00% 96 7 0.00% 97 15 0.00% 98 22 0.00% 99 18 0.00% 100 28 0.00% 101 31 0.00% 102 25 0.00% 103 33 0.00% 104 33 0.00% 105 39 0.00% 106 53 0.00% 107 36 0.00% 108 38 0.00% 109 52 0.00% 110 43 0.00% 111 60 0.00% 112 55 0.00% 113 56 0.00% 114 78 0.00% 115 67 0.00% 116 70 0.00% 117 78 0.00% 118 76 0.00% 119 93 0.00% 120 85 0.00% 121 114 0.00% 122 95 0.00% 123 106 0.00% 124 135 0.00% 125 140 0.00% 126 121 0.00% 127 136 0.00% 128 147 0.00% 129 153 0.00% 130 189 0.00% 131 165 0.00% 132 187 0.00% 133 199 0.00% 134 201 0.00% 135 204 0.00% 136 212 0.00% 137 208 0.00% 138 237 0.00% 139 224 0.00% 140 220 0.00% 141 268 0.00% 142 278 0.00% 143 313 0.00% 144 298 0.00% 145 337 0.00% 146 393 0.00% 147 434 0.00% 148 457 0.00% 149 556 0.00% 150 20805329 99.96% 20813406 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=31 prefix-density=0.31 prefix-fanout=2.1 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=153.43 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=20.9 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=29 prefix-density=0.31 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=145.33 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=23.7 sequence=GAAGAAGATGAAG SRR13259385 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:36:51 Started mapping on | Feb 14 03:36:51 Finished on | Feb 14 03:47:09 Mapping speed, Million of reads per hour | 121.24 Number of input reads | 20813406 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15591500 Uniquely mapped reads % | 74.91% Average mapped length | 297.94 Number of splices: Total | 15027579 Number of splices: Annotated (sjdb) | 14721946 Number of splices: GT/AG | 14774263 Number of splices: GC/AG | 203770 Number of splices: AT/AC | 17202 Number of splices: Non-canonical | 32344 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 3.18 Insertion rate per base | 0.02% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395074 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 93149 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 22.55% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4826832 4826832 4826832 N_multimapping 395074 395074 395074 N_noFeature 446874 7973879 7985229 N_ambiguous 163094 41929 42270 UnstrandedReadsAssigned:14981532 PositiveStrandReadsAssigned:7575692 NegativeStrandReadsAssigned:7564001 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259385 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259385-trimmed-pair1.fastq SRR13259385-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,813,406 reads, 15,482,449 reads pseudoaligned [quant] estimated average fragment length: 238.491 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR13259385.ke.tsv 34699 SRR13259385.se.tsv 87100 total ==> SRR13259385.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.51 2027 62.0424 Potri.005G024800.1.v4.1 1035 797.509 565 38.6093 Potri.004G059700.1.v4.1 961 723.509 0 0 Potri.007G009000.2.v4.1 1416 1178.51 0 0 Potri.003G141000.2.v4.1 2943 2705.51 754.297 15.194 Potri.016G087400.1.v4.1 270 53.4774 584 595.143 Potri.015G069301.1.v4.1 564 326.691 0 0 Potri.010G195200.1.v4.1 1773 1535.51 737.894 26.1891 Potri.012G127500.1.v4.1 977 739.509 3604 265.595 ==> SRR13259385.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 686 SRR13259385 completed mapping pipeline successfully