Starting /dee2/code/volunteer_pipeline.sh SRR13259386 current disk space = 3088086253568 free memory = 1576211564 SRR13259386 SRAfilesize db38ee41d897c84f90016acc5923b0e1 SRR13259386.sra SRR13259386.sra file validated SRR13259386 is paired end SRR13259386 is conventional basespace SRR13259386 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259386_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6385 37.0 37.0 37.0 37.0 37.0 2 36.589 37.0 37.0 37.0 37.0 37.0 3 36.718 37.0 37.0 37.0 37.0 37.0 4 36.64 37.0 37.0 37.0 37.0 37.0 5 36.6675 37.0 37.0 37.0 37.0 37.0 6 36.573 37.0 37.0 37.0 37.0 37.0 7 36.7035 37.0 37.0 37.0 37.0 37.0 8 36.6975 37.0 37.0 37.0 37.0 37.0 9 36.6525 37.0 37.0 37.0 37.0 37.0 10-14 36.6242 37.0 37.0 37.0 37.0 37.0 15-19 36.6243 37.0 37.0 37.0 37.0 37.0 20-24 36.5594 37.0 37.0 37.0 37.0 37.0 25-29 36.549400000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.475100000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.444900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3798 37.0 37.0 37.0 37.0 37.0 45-49 36.403999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4086 37.0 37.0 37.0 37.0 37.0 55-59 36.3123 37.0 37.0 37.0 37.0 37.0 60-64 36.2949 37.0 37.0 37.0 37.0 37.0 65-69 36.214 37.0 37.0 37.0 37.0 37.0 70-74 36.2145 37.0 37.0 37.0 37.0 37.0 75-79 36.144 37.0 37.0 37.0 37.0 37.0 80-84 36.177800000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.164500000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0732 37.0 37.0 37.0 37.0 37.0 95-99 36.060199999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.9658 37.0 37.0 37.0 37.0 37.0 105-109 35.98610000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.973200000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.8286 37.0 37.0 37.0 37.0 37.0 120-124 35.89489999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.732600000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.5827 37.0 37.0 37.0 37.0 37.0 135-139 35.664 37.0 37.0 37.0 37.0 37.0 140-144 35.7726 37.0 37.0 37.0 37.0 37.0 145-149 35.56869999999999 37.0 37.0 37.0 37.0 37.0 150 35.452 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 0.0 21 3.0 22 4.0 23 5.0 24 1.0 25 2.0 26 3.0 27 11.0 28 22.0 29 23.0 30 21.0 31 32.0 32 49.0 33 53.0 34 102.0 35 285.0 36 3176.0 37 205.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.624999999999996 14.799999999999999 20.599999999999998 32.975 2 20.95 24.175 37.7 17.175 3 21.6 30.15 26.8 21.45 4 23.575 35.199999999999996 21.85 19.375 5 23.724999999999998 35.375 23.200000000000003 17.7 6 17.775 38.05 23.125 21.05 7 17.65 17.2 41.025 24.125 8 20.375 21.95 29.675 28.000000000000004 9 21.15 22.375 28.799999999999997 27.675 10-14 21.185000000000002 28.985 27.47 22.36 15-19 21.555 28.349999999999998 28.055000000000003 22.040000000000003 20-24 21.83 28.994999999999997 27.310000000000002 21.865000000000002 25-29 20.915 28.625 27.975 22.485 30-34 20.915 28.794999999999998 28.065 22.225 35-39 21.715 28.384999999999998 27.85 22.05 40-44 21.125 29.21 27.775 21.89 45-49 21.65 28.549999999999997 27.32 22.48 50-54 21.775 28.044999999999998 27.55 22.63 55-59 21.897189718971894 28.137813781378142 27.802780278027804 22.162216221622163 60-64 21.132113211321133 28.38283828382838 28.032803280328032 22.452245224522454 65-69 21.560000000000002 28.335 27.775 22.33 70-74 21.995 28.084999999999997 27.034999999999997 22.884999999999998 75-79 21.64 28.285 27.93 22.145 80-84 21.975 27.800000000000004 27.55 22.675 85-89 21.69 28.585 27.694999999999997 22.03 90-94 21.12 28.33 27.955000000000002 22.595000000000002 95-99 22.155 27.965 28.235 21.645 100-104 22.08 28.12 27.785 22.015 105-109 21.529999999999998 28.189999999999998 28.01 22.27 110-114 21.47 27.79 28.675 22.065 115-119 21.495 27.975 28.22 22.31 120-124 21.54 28.33 27.96 22.17 125-129 21.545 28.299999999999997 28.075 22.08 130-134 22.055 27.72 28.215 22.009999999999998 135-139 21.78 27.68 28.59 21.95 140-144 21.98 27.68 27.925 22.415 145-149 22.175 27.29 28.565 21.97 150 21.425 29.349999999999998 28.875 20.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 5.0 25 9.0 26 10.5 27 9.0 28 10.0 29 16.0 30 23.5 31 27.0 32 32.0 33 36.0 34 43.0 35 61.5 36 95.5 37 124.0 38 140.5 39 162.0 40 191.0 41 225.0 42 251.5 43 259.0 44 273.0 45 282.0 46 269.0 47 237.5 48 216.0 49 210.0 50 168.5 51 119.0 52 95.0 53 81.5 54 64.0 55 59.0 56 56.0 57 34.0 58 20.5 59 19.5 60 16.5 61 12.5 62 6.5 63 4.5 64 5.5 65 5.0 66 2.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 1.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.05 #Duplication Level Percentage of deduplicated Percentage of total 1 84.20582986317669 70.775 2 13.295657346817372 22.35 3 1.9333729922665082 4.875 4 0.446162998215348 1.5 5 0.1189767995240928 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGTTGAACTGTCTCAAAGTGATGACTCTGAAGACGCATCTAATAGTGAAT 5 0.125 No Hit GCAATTGGTATACCCTGAAGTTGAGGAACTGACCAAAGCCAAAGAGGGGC 5 0.125 No Hit CTTTTTATCTGCTTCATCATGAGAGAAACCATCCAAGCATGTTTCTTGGT 5 0.125 No Hit CTTTAAGGCCGCTTCAATGGATCTTACCCAATCCGGTTCAGTCCACTGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAACA 30 0.0018473949 72.0 6 >>END_MODULE SRR13259386 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259386_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4715 37.0 37.0 37.0 37.0 37.0 2 36.517 37.0 37.0 37.0 37.0 37.0 3 36.5195 37.0 37.0 37.0 37.0 37.0 4 36.4745 37.0 37.0 37.0 37.0 37.0 5 36.517 37.0 37.0 37.0 37.0 37.0 6 36.444 37.0 37.0 37.0 37.0 37.0 7 36.446 37.0 37.0 37.0 37.0 37.0 8 36.529 37.0 37.0 37.0 37.0 37.0 9 36.5095 37.0 37.0 37.0 37.0 37.0 10-14 36.5065 37.0 37.0 37.0 37.0 37.0 15-19 36.50359999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4777 37.0 37.0 37.0 37.0 37.0 25-29 36.450700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4274 37.0 37.0 37.0 37.0 37.0 35-39 36.4053 37.0 37.0 37.0 37.0 37.0 40-44 36.367599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2813 37.0 37.0 37.0 37.0 37.0 50-54 36.2312 37.0 37.0 37.0 37.0 37.0 55-59 36.2341 37.0 37.0 37.0 37.0 37.0 60-64 36.15820000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.153200000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.1973 37.0 37.0 37.0 37.0 37.0 75-79 36.0851 37.0 37.0 37.0 37.0 37.0 80-84 36.077200000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.868900000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9096 37.0 37.0 37.0 37.0 37.0 95-99 35.8849 37.0 37.0 37.0 37.0 37.0 100-104 35.8856 37.0 37.0 37.0 37.0 37.0 105-109 35.857099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7996 37.0 37.0 37.0 37.0 37.0 115-119 35.7598 37.0 37.0 37.0 37.0 37.0 120-124 35.5747 37.0 37.0 37.0 37.0 37.0 125-129 35.671 37.0 37.0 37.0 37.0 37.0 130-134 35.51649999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.4418 37.0 37.0 37.0 34.6 37.0 140-144 35.467600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.3119 37.0 37.0 37.0 29.8 37.0 150 35.3875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 4.0 21 2.0 22 3.0 23 6.0 24 2.0 25 7.0 26 7.0 27 9.0 28 6.0 29 13.0 30 13.0 31 28.0 32 34.0 33 46.0 34 154.0 35 628.0 36 2911.0 37 127.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.275000000000002 15.975 20.325 34.425 2 22.0 25.85 33.35 18.8 3 21.7 31.15 26.875 20.275000000000002 4 24.9 34.449999999999996 19.775000000000002 20.875 5 23.225 37.4 21.025 18.35 6 17.5 39.725 23.1 19.675 7 18.6 16.35 42.449999999999996 22.6 8 18.9 22.225 29.549999999999997 29.325000000000003 9 21.675 21.575 29.975 26.775 10-14 21.165 29.205 27.265 22.365 15-19 21.959999999999997 27.88 27.939999999999998 22.220000000000002 20-24 21.625 28.945 27.205000000000002 22.225 25-29 22.095000000000002 28.335 27.689999999999998 21.88 30-34 21.59 29.005 27.47 21.935 35-39 21.36 28.415000000000003 27.52 22.705000000000002 40-44 20.96 28.53 27.85 22.66 45-49 21.73 28.799999999999997 27.38 22.09 50-54 22.085 28.305000000000003 27.775 21.834999999999997 55-59 22.55 27.994999999999997 27.715 21.740000000000002 60-64 21.815 28.115000000000002 27.875 22.195 65-69 22.08 28.494999999999997 27.57 21.855 70-74 22.02 28.49 27.47 22.02 75-79 22.134999999999998 28.689999999999998 27.32 21.855 80-84 21.925 28.675 27.165 22.235 85-89 22.39 28.015 27.67 21.925 90-94 21.895 29.01 27.49 21.605 95-99 21.8 28.744999999999997 27.48 21.975 100-104 22.39 28.185 27.845 21.58 105-109 21.85 28.12 28.09 21.94 110-114 22.384999999999998 28.605000000000004 27.200000000000003 21.81 115-119 21.905 27.655 28.355000000000004 22.085 120-124 22.134999999999998 27.85 27.73 22.285 125-129 22.625 27.915 27.605 21.855 130-134 21.82 28.08 27.99 22.11 135-139 22.36 28.355000000000004 28.17 21.115000000000002 140-144 21.04 28.02 29.25 21.69 145-149 21.925 28.000000000000004 28.17 21.905 150 22.650000000000002 28.999999999999996 27.575 20.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 3.5 23 4.0 24 2.5 25 2.5 26 5.5 27 7.0 28 11.5 29 16.0 30 18.5 31 24.5 32 31.0 33 44.0 34 48.5 35 68.5 36 97.5 37 103.5 38 127.0 39 158.0 40 195.0 41 224.5 42 233.0 43 244.0 44 267.5 45 289.0 46 273.5 47 246.0 48 230.0 49 197.5 50 143.0 51 127.5 52 130.0 53 113.0 54 87.5 55 56.5 56 37.5 57 29.0 58 23.0 59 20.5 60 15.0 61 9.5 62 9.5 63 4.5 64 2.0 65 3.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.98926654740609 70.42500000000001 2 13.446630888491354 22.55 3 1.9976147883124629 5.025 4 0.4472271914132379 1.5 5 0.11926058437686345 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACTACCAAAGCTGTTCAACACAATTTCTTCACCGTAGAAAAGCTCATAG 5 0.125 No Hit CAAGATCTTTAGCAGCTTTCCGAATCCCAAGTTCAAGTGGTGAAAGAGCA 5 0.125 No Hit GGGCAATCCCACCCAACTTCTCTAGAGTCTCATCAAAGCAACCACTAGAA 5 0.125 No Hit GAAAGACAAGAACCCATCAAAGGTTATGTCTCATGTTTCACATTTCCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142201 spots for SRR13259386.sra Written 1142201 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra Read 1142190 spots for SRR13259386.sra Written 1142190 spots for SRR13259386.sra SRR ids: ['SRR13259386.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ewge9nmj SRR13259386.sra spots: 22843811 blocks: [[1, 1142190], [1142191, 2284380], [2284381, 3426570], [3426571, 4568760], [4568761, 5710950], [5710951, 6853140], [6853141, 7995330], [7995331, 9137520], [9137521, 10279710], [10279711, 11421900], [11421901, 12564090], [12564091, 13706280], [13706281, 14848470], [14848471, 15990660], [15990661, 17132850], [17132851, 18275040], [18275041, 19417230], [19417231, 20559420], [20559421, 21701610], [21701611, 22843811]] SRR13259386 file size 7697009 SRR13259386 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259386 SRR13259386_1.fastq SRR13259386_2.fastq Input file: SRR13259386_1.fastq Paired file: SRR13259386_2.fastq trimmed: SRR13259386-trimmed-pair1.fastq, SRR13259386-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:46:27 2025 >> started Fri Feb 14 03:46:52 2025 >> done (24.598s) 22843811 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 21 ( 0.00%) empty read pairs filtered out after trimming by size control 22843790 (100.00%) read pairs available; of these: 8447 ( 0.04%) trimmed read pairs available after processing 22835343 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 26 2 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 2 0.00% 31 0 0.00% 32 0 0.00% 33 1 0.00% 34 1 0.00% 35 1 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 2 0.00% 42 2 0.00% 43 0 0.00% 44 1 0.00% 45 0 0.00% 46 1 0.00% 47 0 0.00% 48 1 0.00% 49 3 0.00% 50 2 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 1 0.00% 65 0 0.00% 66 0 0.00% 67 2 0.00% 68 1 0.00% 69 3 0.00% 70 3 0.00% 71 0 0.00% 72 6 0.00% 73 0 0.00% 74 2 0.00% 75 6 0.00% 76 7 0.00% 77 5 0.00% 78 9 0.00% 79 4 0.00% 80 6 0.00% 81 6 0.00% 82 9 0.00% 83 7 0.00% 84 9 0.00% 85 9 0.00% 86 7 0.00% 87 16 0.00% 88 11 0.00% 89 10 0.00% 90 21 0.00% 91 14 0.00% 92 25 0.00% 93 25 0.00% 94 23 0.00% 95 32 0.00% 96 30 0.00% 97 33 0.00% 98 37 0.00% 99 37 0.00% 100 42 0.00% 101 29 0.00% 102 38 0.00% 103 53 0.00% 104 44 0.00% 105 44 0.00% 106 58 0.00% 107 54 0.00% 108 52 0.00% 109 52 0.00% 110 60 0.00% 111 58 0.00% 112 81 0.00% 113 78 0.00% 114 84 0.00% 115 85 0.00% 116 89 0.00% 117 97 0.00% 118 84 0.00% 119 114 0.00% 120 100 0.00% 121 128 0.00% 122 120 0.00% 123 117 0.00% 124 105 0.00% 125 122 0.00% 126 137 0.00% 127 149 0.00% 128 133 0.00% 129 176 0.00% 130 161 0.00% 131 163 0.00% 132 175 0.00% 133 170 0.00% 134 213 0.00% 135 220 0.00% 136 232 0.00% 137 228 0.00% 138 225 0.00% 139 220 0.00% 140 220 0.00% 141 257 0.00% 142 309 0.00% 143 311 0.00% 144 283 0.00% 145 317 0.00% 146 356 0.00% 147 400 0.00% 148 450 0.00% 149 519 0.00% 150 22835343 99.96% 22843790 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=10.58 fanout-score-rank=9 prefix-density=0.24 prefix-fanout=4.6 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=289.75 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=29.4 sequence=AGCAGCAGCAGC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=10.42 fanout-score-rank=11 prefix-density=0.24 prefix-fanout=4.7 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=280.07 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=28.9 sequence=AGCAGCAGCAGC SRR13259386 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:47:34 Started mapping on | Feb 14 03:47:34 Finished on | Feb 14 03:49:21 Mapping speed, Million of reads per hour | 768.58 Number of input reads | 22843790 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21583782 Uniquely mapped reads % | 94.48% Average mapped length | 298.08 Number of splices: Total | 21202112 Number of splices: Annotated (sjdb) | 20832916 Number of splices: GT/AG | 20828473 Number of splices: GC/AG | 309718 Number of splices: AT/AC | 15707 Number of splices: Non-canonical | 48214 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 521435 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 86696 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 738573 738573 738573 N_multimapping 521435 521435 521435 N_noFeature 678372 11033001 11076198 N_ambiguous 277086 62345 62292 UnstrandedReadsAssigned:20628324 PositiveStrandReadsAssigned:10488436 NegativeStrandReadsAssigned:10445292 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259386 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259386-trimmed-pair1.fastq SRR13259386-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,843,790 reads, 21,134,867 reads pseudoaligned [quant] estimated average fragment length: 244.16 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR13259386.ke.tsv 34699 SRR13259386.se.tsv 87100 total ==> SRR13259386.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.84 1340 32.9876 Potri.005G024800.1.v4.1 1035 791.84 755 41.6596 Potri.004G059700.1.v4.1 961 717.845 17 1.03472 Potri.007G009000.2.v4.1 1416 1172.84 0 0 Potri.003G141000.2.v4.1 2943 2699.84 856.267 13.8572 Potri.016G087400.1.v4.1 270 51.5935 877 742.694 Potri.015G069301.1.v4.1 564 320.972 0 0 Potri.010G195200.1.v4.1 1773 1529.84 318 9.08211 Potri.012G127500.1.v4.1 977 733.84 3850 229.227 ==> SRR13259386.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 271 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 21 SRR13259386 completed mapping pipeline successfully