Starting /dee2/code/volunteer_pipeline.sh SRR13259387 current disk space = 3088039952384 free memory = 1579368020 SRR13259387 SRAfilesize 3b05789ae5f1250bcb49bcaacb977075 SRR13259387.sra SRR13259387.sra file validated SRR13259387 is paired end SRR13259387 is conventional basespace SRR13259387 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259387_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6045 37.0 37.0 37.0 37.0 37.0 2 36.59 37.0 37.0 37.0 37.0 37.0 3 36.6245 37.0 37.0 37.0 37.0 37.0 4 36.587 37.0 37.0 37.0 37.0 37.0 5 36.7695 37.0 37.0 37.0 37.0 37.0 6 36.632 37.0 37.0 37.0 37.0 37.0 7 36.6135 37.0 37.0 37.0 37.0 37.0 8 36.695 37.0 37.0 37.0 37.0 37.0 9 36.73 37.0 37.0 37.0 37.0 37.0 10-14 36.6262 37.0 37.0 37.0 37.0 37.0 15-19 36.60880000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.546299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.546499999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.495 37.0 37.0 37.0 37.0 37.0 35-39 36.4444 37.0 37.0 37.0 37.0 37.0 40-44 36.45440000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.416000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3992 37.0 37.0 37.0 37.0 37.0 55-59 36.31125 37.0 37.0 37.0 37.0 37.0 60-64 36.34015 37.0 37.0 37.0 37.0 37.0 65-69 36.2552 37.0 37.0 37.0 37.0 37.0 70-74 36.2784 37.0 37.0 37.0 37.0 37.0 75-79 36.2448 37.0 37.0 37.0 37.0 37.0 80-84 36.2192 37.0 37.0 37.0 37.0 37.0 85-89 36.244 37.0 37.0 37.0 37.0 37.0 90-94 36.1798 37.0 37.0 37.0 37.0 37.0 95-99 36.1674 37.0 37.0 37.0 37.0 37.0 100-104 36.0322 37.0 37.0 37.0 37.0 37.0 105-109 36.0972 37.0 37.0 37.0 37.0 37.0 110-114 36.0894 37.0 37.0 37.0 37.0 37.0 115-119 35.9448 37.0 37.0 37.0 37.0 37.0 120-124 35.9242 37.0 37.0 37.0 37.0 37.0 125-129 35.861200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.6103 37.0 37.0 37.0 37.0 37.0 135-139 35.674800000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7866 37.0 37.0 37.0 37.0 37.0 145-149 35.59910000000001 37.0 37.0 37.0 37.0 37.0 150 35.637 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 2.0 25 6.0 26 8.0 27 10.0 28 15.0 29 23.0 30 17.0 31 37.0 32 38.0 33 55.0 34 100.0 35 271.0 36 3218.0 37 195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.925 15.7 19.225 37.15 2 21.825 24.6 35.6 17.974999999999998 3 20.525 30.15 27.125 22.2 4 23.200000000000003 35.875 20.7 20.225 5 22.75 37.35 21.85 18.05 6 17.95 39.425 22.2 20.424999999999997 7 17.5 16.775000000000002 42.575 23.150000000000002 8 21.15 21.05 29.175 28.625 9 20.575 21.224999999999998 29.875 28.325 10-14 21.08 29.095 27.205000000000002 22.62 15-19 21.709999999999997 27.62 28.249999999999996 22.42 20-24 21.605 28.794999999999998 27.785 21.815 25-29 21.65 29.099999999999998 27.200000000000003 22.05 30-34 21.615000000000002 28.955 27.250000000000004 22.18 35-39 21.060000000000002 28.28 28.194999999999997 22.465 40-44 21.23 29.345 27.400000000000002 22.025 45-49 21.725 28.535 27.98 21.759999999999998 50-54 21.875 28.744999999999997 26.790000000000003 22.59 55-59 21.626081304065202 28.531426571328566 28.491424571228563 21.35106755337767 60-64 22.06110305515276 28.891444572228615 27.301365068253414 21.74608730436522 65-69 21.39 28.860000000000003 27.91 21.84 70-74 21.89 28.255000000000003 28.115000000000002 21.740000000000002 75-79 21.605 28.105000000000004 27.87 22.42 80-84 21.834999999999997 29.195 27.235 21.735 85-89 22.535 28.345 27.229999999999997 21.89 90-94 21.645 28.87 27.450000000000003 22.035 95-99 22.325 28.310000000000002 27.515 21.85 100-104 21.884999999999998 28.73 27.365000000000002 22.02 105-109 21.685 28.939999999999998 27.26 22.115000000000002 110-114 21.965 28.59 28.43 21.015 115-119 22.93 27.51 27.875 21.685 120-124 22.54 28.060000000000002 27.395000000000003 22.005 125-129 22.005 28.78 27.51 21.705 130-134 21.895 27.725 27.915 22.465 135-139 22.54 27.92 27.900000000000002 21.64 140-144 22.305 28.16 27.985 21.55 145-149 22.84 27.029999999999998 28.48 21.65 150 22.725 27.825 27.0 22.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 3.5 25 3.5 26 4.0 27 6.0 28 10.0 29 15.5 30 21.5 31 24.0 32 28.5 33 46.5 34 67.0 35 76.0 36 93.0 37 109.0 38 138.0 39 170.0 40 188.5 41 224.5 42 238.5 43 270.5 44 289.5 45 270.5 46 259.0 47 237.5 48 220.0 49 198.0 50 177.0 51 148.5 52 104.0 53 81.0 54 68.0 55 50.5 56 42.5 57 32.5 58 23.0 59 16.0 60 10.5 61 7.0 62 7.5 63 7.0 64 4.5 65 2.0 66 1.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.3 #Duplication Level Percentage of deduplicated Percentage of total 1 83.28331332533013 69.375 2 13.985594237695079 23.3 3 2.250900360144058 5.625 4 0.42016806722689076 1.4000000000000001 5 0.0 0.0 6 0.060024009603841535 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCATCCTTTCCATGTCCTGCGAATCAACAAGATGCTTTCATGTGCTGG 6 0.15 No Hit AGTGAACTTGCAGAAGCTGATGGCTTTGTGTTTGGATTCCCAACAAGATT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13259387 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259387_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4125 37.0 37.0 37.0 37.0 37.0 2 36.2125 37.0 37.0 37.0 37.0 37.0 3 36.2605 37.0 37.0 37.0 37.0 37.0 4 36.3205 37.0 37.0 37.0 37.0 37.0 5 36.358 37.0 37.0 37.0 37.0 37.0 6 36.244 37.0 37.0 37.0 37.0 37.0 7 36.266 37.0 37.0 37.0 37.0 37.0 8 36.407 37.0 37.0 37.0 37.0 37.0 9 36.402 37.0 37.0 37.0 37.0 37.0 10-14 36.4074 37.0 37.0 37.0 37.0 37.0 15-19 36.3938 37.0 37.0 37.0 37.0 37.0 20-24 36.325100000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.305499999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.274 37.0 37.0 37.0 37.0 37.0 35-39 36.2749 37.0 37.0 37.0 37.0 37.0 40-44 36.205799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.165200000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.049099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0393 37.0 37.0 37.0 37.0 37.0 60-64 35.982600000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.919900000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9708 37.0 37.0 37.0 37.0 37.0 75-79 35.8618 37.0 37.0 37.0 37.0 37.0 80-84 35.8123 37.0 37.0 37.0 37.0 37.0 85-89 35.5313 37.0 37.0 37.0 37.0 37.0 90-94 35.6164 37.0 37.0 37.0 37.0 37.0 95-99 35.534 37.0 37.0 37.0 37.0 37.0 100-104 35.5935 37.0 37.0 37.0 37.0 37.0 105-109 35.5841 37.0 37.0 37.0 37.0 37.0 110-114 35.5033 37.0 37.0 37.0 34.6 37.0 115-119 35.5424 37.0 37.0 37.0 37.0 37.0 120-124 35.2922 37.0 37.0 37.0 32.2 37.0 125-129 35.359300000000005 37.0 37.0 37.0 32.2 37.0 130-134 35.2113 37.0 37.0 37.0 27.4 37.0 135-139 35.036500000000004 37.0 37.0 37.0 25.0 37.0 140-144 35.179 37.0 37.0 37.0 27.4 37.0 145-149 35.0055 37.0 37.0 37.0 25.0 37.0 150 34.979 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 5.0 24 5.0 25 9.0 26 11.0 27 15.0 28 12.0 29 23.0 30 31.0 31 34.0 32 42.0 33 69.0 34 181.0 35 921.0 36 2571.0 37 68.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.049999999999997 16.975 18.125 35.85 2 21.425 25.0 34.849999999999994 18.725 3 19.175 30.3 28.7 21.825 4 23.925 33.25 22.1 20.724999999999998 5 23.575 35.8 21.125 19.5 6 17.275 38.7 23.200000000000003 20.825 7 15.45 17.675 43.824999999999996 23.05 8 19.3 22.725 28.999999999999996 28.975 9 21.0 22.275 31.324999999999996 25.4 10-14 21.39 28.935 27.05 22.625 15-19 21.365000000000002 28.494999999999997 27.29 22.85 20-24 21.085 28.720000000000002 28.215 21.98 25-29 21.875 28.694999999999997 27.43 22.0 30-34 21.125 29.185 27.73 21.959999999999997 35-39 21.485000000000003 27.965 28.52 22.03 40-44 22.225 27.88 27.62 22.275 45-49 21.48 28.305000000000003 27.845 22.37 50-54 21.36 28.799999999999997 27.395000000000003 22.445 55-59 22.009999999999998 28.865000000000002 27.29 21.834999999999997 60-64 21.295 28.225 28.115000000000002 22.365 65-69 21.965 28.595 27.025 22.415 70-74 21.815 28.294999999999998 28.084999999999997 21.805 75-79 21.790000000000003 28.139999999999997 27.015 23.055 80-84 21.915000000000003 27.985 27.91 22.189999999999998 85-89 21.75 28.65 27.615000000000002 21.985 90-94 21.36 28.000000000000004 27.994999999999997 22.645 95-99 22.189999999999998 27.425 28.32 22.065 100-104 22.095000000000002 28.04 27.810000000000002 22.055 105-109 21.775 27.779999999999998 27.96 22.485 110-114 21.97 28.415000000000003 27.779999999999998 21.834999999999997 115-119 21.88 27.529999999999998 28.48 22.11 120-124 21.69 28.09 27.985 22.235 125-129 22.085 27.405 27.744999999999997 22.765 130-134 22.025 28.439999999999998 27.92 21.615000000000002 135-139 21.815 27.815 28.27 22.1 140-144 21.66 28.29 28.335 21.715 145-149 22.14 27.61 28.110000000000003 22.14 150 19.975 27.625 29.75 22.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 6.0 26 5.0 27 2.5 28 7.0 29 11.0 30 18.5 31 26.0 32 36.0 33 44.0 34 56.5 35 76.5 36 94.0 37 121.5 38 144.0 39 160.5 40 206.0 41 234.0 42 245.5 43 253.5 44 247.5 45 252.5 46 247.5 47 237.0 48 229.0 49 204.5 50 173.5 51 144.0 52 116.5 53 106.0 54 84.0 55 51.5 56 38.5 57 31.5 58 22.0 59 15.0 60 12.5 61 10.5 62 6.0 63 5.0 64 3.5 65 2.5 66 1.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.78056052474658 70.25 2 13.714967203339295 23.0 3 2.0572450805008944 5.175 4 0.3875968992248062 1.3 5 0.02981514609421586 0.125 6 0.02981514609421586 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGACTTCCACCTTTAACCTTCTCCATCTCAAACATGCCAGCACCGAATG 6 0.15 No Hit CCCCACTTCCTGCTGACAATAATCTTTTGGCGACCAGGGAACTTGAATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACATA 10 0.006973645 144.0 4 TGACCAC 10 0.006973645 144.0 3 TCATGTC 10 0.006973645 144.0 7 >>END_MODULE Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178139 spots for SRR13259387.sra Written 1178139 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra Read 1178132 spots for SRR13259387.sra Written 1178132 spots for SRR13259387.sra SRR ids: ['SRR13259387.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_41dctjwe SRR13259387.sra spots: 23562647 blocks: [[1, 1178132], [1178133, 2356264], [2356265, 3534396], [3534397, 4712528], [4712529, 5890660], [5890661, 7068792], [7068793, 8246924], [8246925, 9425056], [9425057, 10603188], [10603189, 11781320], [11781321, 12959452], [12959453, 14137584], [14137585, 15315716], [15315717, 16493848], [16493849, 17671980], [17671981, 18850112], [18850113, 20028244], [20028245, 21206376], [21206377, 22384508], [22384509, 23562647]] SRR13259387 file size 7939897 SRR13259387 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259387 SRR13259387_1.fastq SRR13259387_2.fastq Input file: SRR13259387_1.fastq Paired file: SRR13259387_2.fastq trimmed: SRR13259387-trimmed-pair1.fastq, SRR13259387-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:54:17 2025 >> started Fri Feb 14 03:54:44 2025 >> done (26.951s) 23562647 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 30 ( 0.00%) empty read pairs filtered out after trimming by size control 23562617 (100.00%) read pairs available; of these: 9276 ( 0.04%) trimmed read pairs available after processing 23553341 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 25 2 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 1 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 0 0.00% 41 0 0.00% 42 1 0.00% 43 0 0.00% 44 1 0.00% 45 3 0.00% 46 0 0.00% 47 2 0.00% 48 2 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 3 0.00% 69 0 0.00% 70 1 0.00% 71 2 0.00% 72 4 0.00% 73 2 0.00% 74 1 0.00% 75 6 0.00% 76 5 0.00% 77 5 0.00% 78 5 0.00% 79 7 0.00% 80 8 0.00% 81 5 0.00% 82 8 0.00% 83 6 0.00% 84 14 0.00% 85 13 0.00% 86 10 0.00% 87 10 0.00% 88 6 0.00% 89 13 0.00% 90 15 0.00% 91 19 0.00% 92 18 0.00% 93 30 0.00% 94 27 0.00% 95 35 0.00% 96 27 0.00% 97 35 0.00% 98 40 0.00% 99 31 0.00% 100 46 0.00% 101 41 0.00% 102 47 0.00% 103 41 0.00% 104 63 0.00% 105 57 0.00% 106 50 0.00% 107 55 0.00% 108 46 0.00% 109 76 0.00% 110 59 0.00% 111 64 0.00% 112 81 0.00% 113 90 0.00% 114 66 0.00% 115 88 0.00% 116 74 0.00% 117 86 0.00% 118 98 0.00% 119 97 0.00% 120 92 0.00% 121 122 0.00% 122 125 0.00% 123 141 0.00% 124 130 0.00% 125 163 0.00% 126 177 0.00% 127 145 0.00% 128 165 0.00% 129 155 0.00% 130 168 0.00% 131 212 0.00% 132 211 0.00% 133 210 0.00% 134 186 0.00% 135 216 0.00% 136 236 0.00% 137 287 0.00% 138 253 0.00% 139 273 0.00% 140 255 0.00% 141 275 0.00% 142 298 0.00% 143 348 0.00% 144 376 0.00% 145 358 0.00% 146 422 0.00% 147 467 0.00% 148 506 0.00% 149 551 0.00% 150 23553341 99.96% 23562617 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=10.78 fanout-score-rank=6 prefix-density=0.30 prefix-fanout=4.3 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=256.23 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=19.6 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=27 prefix-density=0.17 prefix-fanout=2.6 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=180.84 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=22.7 sequence=GCAGCAGCAACAA SRR13259387 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:55:24 Started mapping on | Feb 14 03:55:24 Finished on | Feb 14 03:57:27 Mapping speed, Million of reads per hour | 689.64 Number of input reads | 23562617 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22333247 Uniquely mapped reads % | 94.78% Average mapped length | 298.19 Number of splices: Total | 22242339 Number of splices: Annotated (sjdb) | 21835046 Number of splices: GT/AG | 21852755 Number of splices: GC/AG | 326994 Number of splices: AT/AC | 16721 Number of splices: Non-canonical | 45869 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.59 Insertion rate per base | 0.01% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 518410 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 109730 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.45% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 710960 710960 710960 N_multimapping 518410 518410 518410 N_noFeature 717465 11437558 11437763 N_ambiguous 303043 63905 64222 UnstrandedReadsAssigned:21312739 PositiveStrandReadsAssigned:10831784 NegativeStrandReadsAssigned:10831262 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259387 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259387-trimmed-pair1.fastq SRR13259387-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,562,617 reads, 21,842,564 reads pseudoaligned [quant] estimated average fragment length: 242.774 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52401 SRR13259387.ke.tsv 34699 SRR13259387.se.tsv 87100 total ==> SRR13259387.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.23 1195 27.6394 Potri.005G024800.1.v4.1 1035 793.226 745 38.5849 Potri.004G059700.1.v4.1 961 719.232 20 1.1424 Potri.007G009000.2.v4.1 1416 1174.23 0 0 Potri.003G141000.2.v4.1 2943 2701.23 911.568 13.8639 Potri.016G087400.1.v4.1 270 51.4736 845 674.42 Potri.015G069301.1.v4.1 564 322.322 0 0 Potri.010G195200.1.v4.1 1773 1531.23 343 9.20265 Potri.012G127500.1.v4.1 977 735.232 2429 135.725 ==> SRR13259387.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 51 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 316 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 34 SRR13259387 completed mapping pipeline successfully