Starting /dee2/code/volunteer_pipeline.sh SRR13259388 current disk space = 3088033058816 free memory = 1450172944 SRR13259388 SRAfilesize 46715f68bebb91f82fc6a0f2a7b50793 SRR13259388.sra SRR13259388.sra file validated SRR13259388 is paired end SRR13259388 is conventional basespace SRR13259388 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259388_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.66575 37.0 37.0 37.0 37.0 37.0 2 36.5965 37.0 37.0 37.0 37.0 37.0 3 36.659 37.0 37.0 37.0 37.0 37.0 4 36.6705 37.0 37.0 37.0 37.0 37.0 5 36.679 37.0 37.0 37.0 37.0 37.0 6 36.54 37.0 37.0 37.0 37.0 37.0 7 36.5965 37.0 37.0 37.0 37.0 37.0 8 36.716 37.0 37.0 37.0 37.0 37.0 9 36.6765 37.0 37.0 37.0 37.0 37.0 10-14 36.6179 37.0 37.0 37.0 37.0 37.0 15-19 36.6633 37.0 37.0 37.0 37.0 37.0 20-24 36.5826 37.0 37.0 37.0 37.0 37.0 25-29 36.5084 37.0 37.0 37.0 37.0 37.0 30-34 36.466 37.0 37.0 37.0 37.0 37.0 35-39 36.4524 37.0 37.0 37.0 37.0 37.0 40-44 36.4109 37.0 37.0 37.0 37.0 37.0 45-49 36.36919999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.433 37.0 37.0 37.0 37.0 37.0 55-59 36.39295 37.0 37.0 37.0 37.0 37.0 60-64 36.37835 37.0 37.0 37.0 37.0 37.0 65-69 36.2283 37.0 37.0 37.0 37.0 37.0 70-74 36.2956 37.0 37.0 37.0 37.0 37.0 75-79 36.2519 37.0 37.0 37.0 37.0 37.0 80-84 36.2966 37.0 37.0 37.0 37.0 37.0 85-89 36.2728 37.0 37.0 37.0 37.0 37.0 90-94 36.209500000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.1845 37.0 37.0 37.0 37.0 37.0 100-104 36.033699999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1289 37.0 37.0 37.0 37.0 37.0 110-114 36.1063 37.0 37.0 37.0 37.0 37.0 115-119 36.0048 37.0 37.0 37.0 37.0 37.0 120-124 35.9812 37.0 37.0 37.0 37.0 37.0 125-129 35.872800000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.698600000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.710100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8266 37.0 37.0 37.0 37.0 37.0 145-149 35.721700000000006 37.0 37.0 37.0 37.0 37.0 150 35.5495 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 2.0 23 1.0 24 3.0 25 3.0 26 6.0 27 11.0 28 13.0 29 14.0 30 16.0 31 25.0 32 48.0 33 68.0 34 86.0 35 270.0 36 3220.0 37 211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.556889222305575 17.504376094023506 20.980245061265315 33.9584896224056 2 22.225 24.95 35.75 17.075000000000003 3 20.849999999999998 30.425 28.825 19.900000000000002 4 23.375 34.65 20.65 21.325 5 22.125 35.725 23.1 19.05 6 15.15 37.8 25.05 22.0 7 15.475 16.150000000000002 43.925 24.45 8 20.45 21.95 27.625 29.975 9 20.849999999999998 21.55 30.175 27.425 10-14 20.86 28.645 27.605 22.89 15-19 20.974999999999998 28.015 28.515 22.495 20-24 21.5 28.37 28.235 21.895 25-29 21.25 28.895 27.474999999999998 22.38 30-34 20.995 28.975 28.084999999999997 21.945 35-39 21.51 29.225 27.224999999999998 22.040000000000003 40-44 21.7 28.305000000000003 27.735 22.259999999999998 45-49 21.375 28.675 28.075 21.875 50-54 21.63 28.01 28.249999999999996 22.11 55-59 21.66108305415271 28.221411070553525 27.706385319265962 22.411120556027804 60-64 20.46602330116506 28.371418570928547 27.946397319865994 23.2161608080404 65-69 21.385 28.665000000000003 27.63 22.32 70-74 21.9 28.475 27.88 21.745 75-79 21.91 28.225 27.705000000000002 22.16 80-84 22.525000000000002 27.99 27.400000000000002 22.085 85-89 21.675 28.515 27.82 21.990000000000002 90-94 21.915000000000003 28.050000000000004 27.705000000000002 22.33 95-99 21.855 28.765 27.525 21.855 100-104 21.27 28.499999999999996 28.084999999999997 22.145 105-109 21.325 28.110000000000003 27.500000000000004 23.064999999999998 110-114 22.384999999999998 27.48 28.060000000000002 22.075 115-119 22.105 28.205000000000002 27.644999999999996 22.045 120-124 21.995 28.43 27.439999999999998 22.134999999999998 125-129 22.29 27.834999999999997 27.775 22.1 130-134 22.255 27.16 28.92 21.665 135-139 22.17 27.889999999999997 28.499999999999996 21.44 140-144 22.225 28.265 28.22 21.29 145-149 22.585 27.905 27.71 21.8 150 22.1 26.474999999999998 29.475 21.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 1.0 25 3.0 26 8.0 27 7.0 28 4.0 29 6.5 30 17.0 31 25.0 32 32.5 33 43.0 34 55.0 35 73.5 36 94.0 37 109.0 38 130.5 39 183.5 40 217.5 41 238.0 42 247.5 43 261.5 44 286.0 45 278.0 46 268.0 47 257.0 48 227.0 49 195.5 50 162.5 51 127.5 52 118.0 53 95.5 54 57.0 55 37.0 56 32.0 57 26.5 58 19.5 59 14.0 60 10.0 61 6.5 62 2.0 63 2.5 64 5.0 65 4.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 1.0 74 1.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.375 #Duplication Level Percentage of deduplicated Percentage of total 1 83.74812593703147 69.825 2 13.403298350824588 22.35 3 2.188905547226387 5.475 4 0.5097451274362819 1.7000000000000002 5 0.11994002998500748 0.5 6 0.02998500749625187 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCACAACTCGTTCTTCTCATCATTCCATTTATACTGATACTTGTTCTT 6 0.15 No Hit ACCAGGAAACCCTAAAAAAAATTGGTGAAGTACCAGCTATCGAAGAGTTT 5 0.125 No Hit ATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGG 5 0.125 No Hit AGTCCATCCCCAAATGGCCACAGAGGTTGCATGTTACACCTGAACGCATT 5 0.125 No Hit TTCTTCTTAATGGCATAGCTGTTTGAGGAACCCTTGGCTGCATTGATAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCGTT 10 0.006973645 144.0 8 CAACTCG 10 0.006973645 144.0 6 CACAACT 10 0.006973645 144.0 4 AACTCGT 10 0.006973645 144.0 7 CTCGTTC 10 0.006973645 144.0 9 >>END_MODULE SRR13259388 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259388_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4895 37.0 37.0 37.0 37.0 37.0 2 36.448 37.0 37.0 37.0 37.0 37.0 3 36.553 37.0 37.0 37.0 37.0 37.0 4 36.505 37.0 37.0 37.0 37.0 37.0 5 36.444 37.0 37.0 37.0 37.0 37.0 6 36.4095 37.0 37.0 37.0 37.0 37.0 7 36.5165 37.0 37.0 37.0 37.0 37.0 8 36.5525 37.0 37.0 37.0 37.0 37.0 9 36.5775 37.0 37.0 37.0 37.0 37.0 10-14 36.5077 37.0 37.0 37.0 37.0 37.0 15-19 36.549899999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4114 37.0 37.0 37.0 37.0 37.0 25-29 36.4153 37.0 37.0 37.0 37.0 37.0 30-34 36.36579999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.3618 37.0 37.0 37.0 37.0 37.0 40-44 36.349900000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2808 37.0 37.0 37.0 37.0 37.0 50-54 36.2436 37.0 37.0 37.0 37.0 37.0 55-59 36.276300000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.1595 37.0 37.0 37.0 37.0 37.0 65-69 36.1604 37.0 37.0 37.0 37.0 37.0 70-74 36.163399999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0274 37.0 37.0 37.0 37.0 37.0 80-84 36.0462 37.0 37.0 37.0 37.0 37.0 85-89 35.912800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.845 37.0 37.0 37.0 37.0 37.0 95-99 35.838499999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8314 37.0 37.0 37.0 37.0 37.0 105-109 35.81519999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.831300000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.758500000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.5664 37.0 37.0 37.0 37.0 37.0 125-129 35.6831 37.0 37.0 37.0 37.0 37.0 130-134 35.5471 37.0 37.0 37.0 37.0 37.0 135-139 35.432 37.0 37.0 37.0 32.2 37.0 140-144 35.5349 37.0 37.0 37.0 37.0 37.0 145-149 35.4139 37.0 37.0 37.0 34.6 37.0 150 35.412 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 3.0 23 2.0 24 4.0 25 4.0 26 7.0 27 7.0 28 4.0 29 17.0 30 21.0 31 22.0 32 37.0 33 62.0 34 143.0 35 640.0 36 2903.0 37 119.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.425 15.15 21.05 34.375 2 22.625 24.675 36.199999999999996 16.5 3 22.35 29.675 27.175 20.8 4 22.625 34.150000000000006 21.975 21.25 5 23.849999999999998 36.25 21.15 18.75 6 18.775 37.824999999999996 22.075 21.325 7 16.925 16.400000000000002 43.25 23.425 8 20.1 22.900000000000002 28.000000000000004 28.999999999999996 9 20.05 22.975 30.275000000000002 26.700000000000003 10-14 21.22 29.125 26.865 22.79 15-19 21.654999999999998 27.92 28.249999999999996 22.175 20-24 21.665 28.705000000000002 27.77 21.86 25-29 21.7 28.59 28.465 21.245 30-34 21.515 29.360000000000003 27.57 21.555 35-39 21.12 28.38 28.095 22.405 40-44 21.565 28.375 27.54 22.52 45-49 21.4 28.549999999999997 27.6 22.45 50-54 21.365000000000002 28.835 27.375 22.425 55-59 22.015 29.099999999999998 27.589999999999996 21.295 60-64 21.645 28.494999999999997 27.694999999999997 22.165000000000003 65-69 21.68 28.655 27.334999999999997 22.33 70-74 21.445 28.815 27.634999999999998 22.105 75-79 22.06 28.32 27.43 22.189999999999998 80-84 21.985 27.584999999999997 27.83 22.6 85-89 21.55 28.945 27.325 22.18 90-94 22.035 28.345 27.445000000000004 22.175 95-99 21.959999999999997 27.92 28.000000000000004 22.12 100-104 21.97 28.055000000000003 27.855 22.12 105-109 21.595 28.544999999999998 27.505000000000003 22.355 110-114 21.54 28.560000000000002 27.77 22.13 115-119 21.775 28.349999999999998 27.705000000000002 22.17 120-124 22.07 27.150000000000002 29.020000000000003 21.759999999999998 125-129 22.64 28.189999999999998 27.395000000000003 21.775 130-134 22.075 27.72 28.07 22.134999999999998 135-139 22.23 27.85 27.76 22.16 140-144 21.92 27.76 28.405 21.915000000000003 145-149 21.32 28.83 27.93 21.92 150 22.675 27.150000000000002 28.925 21.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 0.5 23 1.0 24 3.5 25 5.5 26 6.0 27 7.5 28 8.0 29 13.0 30 20.5 31 27.0 32 36.0 33 42.5 34 55.0 35 70.0 36 79.0 37 97.0 38 127.5 39 164.0 40 199.0 41 236.5 42 264.0 43 264.0 44 268.5 45 286.0 46 276.5 47 259.5 48 227.5 49 190.0 50 166.5 51 132.5 52 91.0 53 81.0 54 82.5 55 55.0 56 41.5 57 33.0 58 24.0 59 14.5 60 8.0 61 8.5 62 4.0 63 2.5 64 2.5 65 1.0 66 2.5 67 2.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 83.72302158273382 69.825 2 13.519184652278177 22.55 3 2.038369304556355 5.1 4 0.5995203836930456 2.0 5 0.08992805755395684 0.375 6 0.029976019184652276 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGATGCCAAAAAATTACCTCCTTGGGTTGGCGATACAGTGCGACCTTC 6 0.15 No Hit AGTTGAGAAAGCTTCACACCAATCATGAAAAGTTCCGATGAGGCCACGGT 5 0.125 No Hit GAAAAAATTGAAGGCTGTGACCATTGTCAAACATGCCATGGAGATCATTC 5 0.125 No Hit CGGAAACAGTAACGCTGGATTCCAAACAGAGCAGTTGTGTTAGATTTCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAAAA 10 0.006973645 144.0 8 >>END_MODULE Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra Read 1307465 spots for SRR13259388.sra Written 1307465 spots for SRR13259388.sra SRR ids: ['SRR13259388.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rjd_ubbj SRR13259388.sra spots: 26149300 blocks: [[1, 1307465], [1307466, 2614930], [2614931, 3922395], [3922396, 5229860], [5229861, 6537325], [6537326, 7844790], [7844791, 9152255], [9152256, 10459720], [10459721, 11767185], [11767186, 13074650], [13074651, 14382115], [14382116, 15689580], [15689581, 16997045], [16997046, 18304510], [18304511, 19611975], [19611976, 20919440], [20919441, 22226905], [22226906, 23534370], [23534371, 24841835], [24841836, 26149300]] SRR13259388 file size 8813902 SRR13259388 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259388 SRR13259388_1.fastq SRR13259388_2.fastq Input file: SRR13259388_1.fastq Paired file: SRR13259388_2.fastq trimmed: SRR13259388-trimmed-pair1.fastq, SRR13259388-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:50:29 2025 >> started Fri Feb 14 02:50:57 2025 >> done (28.907s) 26149300 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 28 ( 0.00%) empty read pairs filtered out after trimming by size control 26149272 (100.00%) read pairs available; of these: 8878 ( 0.03%) trimmed read pairs available after processing 26140394 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 1 0.00% 39 0 0.00% 40 2 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 1 0.00% 47 0 0.00% 48 1 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 1 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 1 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 1 0.00% 71 3 0.00% 72 2 0.00% 73 2 0.00% 74 2 0.00% 75 3 0.00% 76 3 0.00% 77 2 0.00% 78 1 0.00% 79 5 0.00% 80 2 0.00% 81 6 0.00% 82 2 0.00% 83 5 0.00% 84 7 0.00% 85 7 0.00% 86 8 0.00% 87 7 0.00% 88 4 0.00% 89 14 0.00% 90 12 0.00% 91 14 0.00% 92 16 0.00% 93 14 0.00% 94 20 0.00% 95 20 0.00% 96 18 0.00% 97 23 0.00% 98 30 0.00% 99 26 0.00% 100 39 0.00% 101 34 0.00% 102 44 0.00% 103 33 0.00% 104 40 0.00% 105 44 0.00% 106 42 0.00% 107 48 0.00% 108 53 0.00% 109 69 0.00% 110 68 0.00% 111 63 0.00% 112 61 0.00% 113 59 0.00% 114 83 0.00% 115 97 0.00% 116 81 0.00% 117 108 0.00% 118 99 0.00% 119 93 0.00% 120 97 0.00% 121 123 0.00% 122 109 0.00% 123 119 0.00% 124 123 0.00% 125 118 0.00% 126 127 0.00% 127 173 0.00% 128 151 0.00% 129 159 0.00% 130 170 0.00% 131 169 0.00% 132 188 0.00% 133 203 0.00% 134 202 0.00% 135 235 0.00% 136 249 0.00% 137 235 0.00% 138 267 0.00% 139 237 0.00% 140 304 0.00% 141 285 0.00% 142 280 0.00% 143 357 0.00% 144 337 0.00% 145 347 0.00% 146 431 0.00% 147 432 0.00% 148 529 0.00% 149 574 0.00% 150 26140394 99.97% 26149272 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=11.59 fanout-score-rank=10 prefix-density=0.22 prefix-fanout=4.9 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=339.91 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=21.3 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATT criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=12.74 fanout-score-rank=10 prefix-density=0.23 prefix-fanout=5.1 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=387.71 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=22.9 sequence=TTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATT SRR13259388 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:51:41 Started mapping on | Feb 14 02:51:41 Finished on | Feb 14 02:53:48 Mapping speed, Million of reads per hour | 741.24 Number of input reads | 26149272 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 24749012 Uniquely mapped reads % | 94.65% Average mapped length | 298.10 Number of splices: Total | 24326598 Number of splices: Annotated (sjdb) | 23865203 Number of splices: GT/AG | 23899906 Number of splices: GC/AG | 354317 Number of splices: AT/AC | 19914 Number of splices: Non-canonical | 52461 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 586829 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 107075 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 813431 813431 813431 N_multimapping 586829 586829 586829 N_noFeature 831694 12679362 12730379 N_ambiguous 314148 71962 71778 UnstrandedReadsAssigned:23603170 PositiveStrandReadsAssigned:11997688 NegativeStrandReadsAssigned:11946855 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259388 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259388-trimmed-pair1.fastq SRR13259388-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,149,272 reads, 24,192,845 reads pseudoaligned [quant] estimated average fragment length: 242.136 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52401 SRR13259388.ke.tsv 34699 SRR13259388.se.tsv 87100 total ==> SRR13259388.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.86 1604 34.786 Potri.005G024800.1.v4.1 1035 793.864 1134 55.0454 Potri.004G059700.1.v4.1 961 719.864 13 0.6959 Potri.007G009000.2.v4.1 1416 1174.86 0 0 Potri.003G141000.2.v4.1 2943 2701.86 878 12.5223 Potri.016G087400.1.v4.1 270 52.0899 906 670.237 Potri.015G069301.1.v4.1 564 323.004 0 0 Potri.010G195200.1.v4.1 1773 1531.86 448 11.2697 Potri.012G127500.1.v4.1 977 735.864 2934 153.644 ==> SRR13259388.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 52 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 29 SRR13259388 completed mapping pipeline successfully