Starting /dee2/code/volunteer_pipeline.sh SRR13259389 current disk space = 3087890100224 free memory = 1575436428 SRR13259389 SRAfilesize f0547bfb36a902b0d649465eda29e0d3 SRR13259389.sra SRR13259389.sra file validated SRR13259389 is paired end SRR13259389 is conventional basespace SRR13259389 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259389_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6535 37.0 37.0 37.0 37.0 37.0 2 36.6375 37.0 37.0 37.0 37.0 37.0 3 36.6275 37.0 37.0 37.0 37.0 37.0 4 36.645 37.0 37.0 37.0 37.0 37.0 5 36.7265 37.0 37.0 37.0 37.0 37.0 6 36.636 37.0 37.0 37.0 37.0 37.0 7 36.6685 37.0 37.0 37.0 37.0 37.0 8 36.67 37.0 37.0 37.0 37.0 37.0 9 36.6765 37.0 37.0 37.0 37.0 37.0 10-14 36.6192 37.0 37.0 37.0 37.0 37.0 15-19 36.6385 37.0 37.0 37.0 37.0 37.0 20-24 36.5928 37.0 37.0 37.0 37.0 37.0 25-29 36.5689 37.0 37.0 37.0 37.0 37.0 30-34 36.4988 37.0 37.0 37.0 37.0 37.0 35-39 36.5192 37.0 37.0 37.0 37.0 37.0 40-44 36.4788 37.0 37.0 37.0 37.0 37.0 45-49 36.4043 37.0 37.0 37.0 37.0 37.0 50-54 36.4364 37.0 37.0 37.0 37.0 37.0 55-59 36.39725 37.0 37.0 37.0 37.0 37.0 60-64 36.37425 37.0 37.0 37.0 37.0 37.0 65-69 36.2785 37.0 37.0 37.0 37.0 37.0 70-74 36.298 37.0 37.0 37.0 37.0 37.0 75-79 36.232899999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.2633 37.0 37.0 37.0 37.0 37.0 85-89 36.266799999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1447 37.0 37.0 37.0 37.0 37.0 95-99 36.1456 37.0 37.0 37.0 37.0 37.0 100-104 36.0589 37.0 37.0 37.0 37.0 37.0 105-109 36.051 37.0 37.0 37.0 37.0 37.0 110-114 36.042 37.0 37.0 37.0 37.0 37.0 115-119 35.933099999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.890499999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.8148 37.0 37.0 37.0 37.0 37.0 130-134 35.7034 37.0 37.0 37.0 37.0 37.0 135-139 35.71939999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7892 37.0 37.0 37.0 37.0 37.0 145-149 35.6219 37.0 37.0 37.0 37.0 37.0 150 35.69 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 2.0 20 1.0 21 1.0 22 3.0 23 0.0 24 4.0 25 4.0 26 3.0 27 7.0 28 12.0 29 22.0 30 26.0 31 30.0 32 36.0 33 57.0 34 99.0 35 274.0 36 3198.0 37 219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.325 16.5 18.35 30.825000000000003 2 22.325 24.224999999999998 35.199999999999996 18.25 3 22.25 26.875 29.025000000000002 21.85 4 23.375 34.2 22.6 19.825 5 24.275 35.8 22.525000000000002 17.4 6 18.125 38.175 22.925 20.775 7 17.7 16.625 42.449999999999996 23.225 8 19.8 22.825 28.725 28.65 9 20.65 23.175 29.475 26.700000000000003 10-14 22.39 27.83 26.334999999999997 23.445 15-19 22.400000000000002 27.944999999999997 27.21 22.445 20-24 22.065 28.17 27.21 22.555 25-29 22.07 28.53 27.375 22.025 30-34 22.07 28.439999999999998 27.034999999999997 22.455 35-39 22.445 28.515 27.065 21.975 40-44 22.16 28.439999999999998 26.855 22.545 45-49 21.9 28.349999999999998 27.36 22.39 50-54 22.0 28.025 26.665 23.31 55-59 22.591129556477824 28.276413820691033 26.521326066303313 22.611130556527826 60-64 22.001100055002752 28.546427321366068 27.476373818690934 21.976098804940246 65-69 22.42 28.175 26.665 22.74 70-74 22.225 28.59 26.490000000000002 22.695 75-79 21.875 27.284999999999997 27.18 23.66 80-84 22.770000000000003 27.82 26.895000000000003 22.515 85-89 22.6 27.93 27.029999999999998 22.439999999999998 90-94 21.39 27.93 26.93 23.75 95-99 22.465 28.305000000000003 27.27 21.959999999999997 100-104 22.5 27.005000000000003 27.779999999999998 22.715 105-109 22.355 27.465 27.034999999999997 23.145 110-114 21.9 27.905 27.32 22.875 115-119 22.814999999999998 26.775 28.34 22.07 120-124 22.985 27.284999999999997 27.500000000000004 22.23 125-129 22.634999999999998 27.169999999999998 27.665 22.53 130-134 22.585 27.529999999999998 27.625 22.259999999999998 135-139 22.625 28.22 27.015 22.14 140-144 22.785 27.935 26.745 22.535 145-149 23.095 27.279999999999998 27.46 22.165000000000003 150 23.974999999999998 27.3 27.175 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.5 26 6.0 27 7.5 28 8.5 29 13.5 30 14.0 31 15.5 32 24.5 33 42.5 34 53.0 35 59.5 36 77.0 37 96.0 38 129.0 39 158.5 40 164.5 41 212.5 42 256.5 43 236.5 44 241.0 45 252.5 46 254.5 47 247.5 48 227.0 49 199.0 50 167.0 51 146.0 52 123.5 53 114.0 54 94.5 55 67.0 56 58.5 57 46.0 58 36.0 59 29.5 60 22.0 61 19.5 62 18.0 63 18.0 64 12.5 65 5.5 66 4.5 67 5.0 68 2.0 69 2.0 70 3.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.175 #Duplication Level Percentage of deduplicated Percentage of total 1 84.70448470448471 71.3 2 12.563112563112563 21.15 3 2.1384021384021383 5.4 4 0.47520047520047515 1.6 5 0.0891000891000891 0.375 6 0.0 0.0 7 0.029700029700029697 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTGACATGATATTGTTTTGAATTGTTTGCTGATTAGAAGATGTTGAAG 7 0.17500000000000002 No Hit ATCTTGAATGAGAATGAGGATTCTGCACAAGAGCAAAGGCCCACTCAAAC 5 0.125 No Hit AGAATAGGTACTGCATATTGCCCAATAAGGCCTTGCATGAAACCACATAG 5 0.125 No Hit AAGAGAAACAGACCATCACAAGACAGTAAACATCCTAACGATGGGCTCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGAA 10 0.006973645 144.0 4 AGGATGA 10 0.006973645 144.0 3 AAGAGAG 10 0.006973645 144.0 9 GTTTAAA 10 0.006973645 144.0 1 TAAAGCA 10 0.006973645 144.0 4 TTAAAGC 10 0.006973645 144.0 3 TTTAAAG 10 0.006973645 144.0 2 >>END_MODULE SRR13259389 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259389_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4215 37.0 37.0 37.0 37.0 37.0 2 36.3155 37.0 37.0 37.0 37.0 37.0 3 36.348 37.0 37.0 37.0 37.0 37.0 4 36.383 37.0 37.0 37.0 37.0 37.0 5 36.412 37.0 37.0 37.0 37.0 37.0 6 36.4135 37.0 37.0 37.0 37.0 37.0 7 36.4185 37.0 37.0 37.0 37.0 37.0 8 36.4935 37.0 37.0 37.0 37.0 37.0 9 36.4885 37.0 37.0 37.0 37.0 37.0 10-14 36.4203 37.0 37.0 37.0 37.0 37.0 15-19 36.4086 37.0 37.0 37.0 37.0 37.0 20-24 36.3641 37.0 37.0 37.0 37.0 37.0 25-29 36.358200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.289699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2958 37.0 37.0 37.0 37.0 37.0 40-44 36.2455 37.0 37.0 37.0 37.0 37.0 45-49 36.180400000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.1298 37.0 37.0 37.0 37.0 37.0 55-59 36.144499999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.0108 37.0 37.0 37.0 37.0 37.0 65-69 36.087 37.0 37.0 37.0 37.0 37.0 70-74 36.055099999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.916 37.0 37.0 37.0 37.0 37.0 80-84 35.9294 37.0 37.0 37.0 37.0 37.0 85-89 35.7471 37.0 37.0 37.0 37.0 37.0 90-94 35.7112 37.0 37.0 37.0 37.0 37.0 95-99 35.7462 37.0 37.0 37.0 37.0 37.0 100-104 35.7341 37.0 37.0 37.0 37.0 37.0 105-109 35.6845 37.0 37.0 37.0 37.0 37.0 110-114 35.5904 37.0 37.0 37.0 37.0 37.0 115-119 35.6428 37.0 37.0 37.0 37.0 37.0 120-124 35.319100000000006 37.0 37.0 37.0 32.2 37.0 125-129 35.459399999999995 37.0 37.0 37.0 34.6 37.0 130-134 35.2907 37.0 37.0 37.0 29.8 37.0 135-139 35.259299999999996 37.0 37.0 37.0 29.8 37.0 140-144 35.2988 37.0 37.0 37.0 29.8 37.0 145-149 35.1826 37.0 37.0 37.0 27.4 37.0 150 35.2905 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 2.0 18 0.0 19 1.0 20 1.0 21 3.0 22 3.0 23 3.0 24 5.0 25 5.0 26 4.0 27 7.0 28 18.0 29 13.0 30 21.0 31 24.0 32 41.0 33 69.0 34 159.0 35 850.0 36 2695.0 37 74.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.675 16.400000000000002 17.125 32.800000000000004 2 23.65 23.974999999999998 33.25 19.125 3 23.400000000000002 29.65 26.375 20.575 4 24.75 34.275 21.2 19.775000000000002 5 24.55 34.025 21.55 19.875 6 19.475 36.3 24.6 19.625 7 17.275 17.474999999999998 41.625 23.625 8 20.849999999999998 21.15 27.450000000000003 30.55 9 22.2 21.349999999999998 28.599999999999998 27.85 10-14 21.93 28.34 26.484999999999996 23.244999999999997 15-19 22.3 27.375 27.515 22.81 20-24 21.8 27.894999999999996 27.525 22.78 25-29 21.825 27.665 28.02 22.49 30-34 22.215 28.075 27.375 22.335 35-39 21.77 28.38 27.339999999999996 22.509999999999998 40-44 22.845 28.7 26.3 22.155 45-49 22.425 27.779999999999998 27.315 22.48 50-54 22.14 27.87 27.66 22.33 55-59 22.295 27.439999999999998 27.215 23.05 60-64 22.435 28.285 27.150000000000002 22.13 65-69 22.75 27.800000000000004 26.705000000000002 22.745 70-74 22.905 27.975 26.834999999999997 22.285 75-79 22.48 27.82 26.97 22.73 80-84 22.985 27.224999999999998 27.76 22.03 85-89 22.67 27.96 26.83 22.54 90-94 22.220000000000002 27.595 27.515 22.67 95-99 22.545 27.215 27.685 22.555 100-104 22.545 27.77 27.134999999999998 22.55 105-109 22.695 26.565 27.74 23.0 110-114 21.69 27.785 27.229999999999997 23.294999999999998 115-119 21.95 26.974999999999998 28.165000000000003 22.91 120-124 22.134999999999998 27.689999999999998 27.6 22.575 125-129 22.6 27.58 27.325 22.495 130-134 22.439999999999998 28.134999999999998 26.935 22.49 135-139 22.925 27.834999999999997 27.175 22.065 140-144 22.91 27.08 27.63 22.38 145-149 22.345000000000002 28.244999999999997 26.995 22.415 150 21.275 26.35 28.9 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.5 24 1.5 25 4.5 26 4.5 27 5.0 28 10.5 29 11.0 30 14.5 31 28.0 32 27.5 33 32.5 34 50.5 35 58.5 36 84.0 37 105.0 38 109.5 39 143.5 40 173.5 41 190.5 42 219.0 43 241.5 44 250.0 45 260.0 46 260.5 47 250.0 48 222.0 49 188.5 50 165.0 51 137.0 52 132.5 53 123.0 54 95.5 55 81.0 56 70.5 57 58.0 58 40.5 59 28.0 60 25.0 61 16.0 62 15.0 63 16.5 64 13.0 65 8.5 66 10.0 67 8.0 68 1.0 69 1.0 70 2.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.425 #Duplication Level Percentage of deduplicated Percentage of total 1 85.04589872668049 71.8 2 12.170565590761031 20.549999999999997 3 2.220906129700918 5.625 4 0.47379330766952915 1.6 5 0.059224163458691144 0.25 6 0.0 0.0 7 0.029612081729345572 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAATTTTGGCTTCCATCCAGGCCAGAAACTTGGAAGAAACTCACTTTCAA 7 0.17500000000000002 No Hit AAAATGTTAAATTTTGCTCTTGGCCTCATCTAATCTCTCTGTTCTATTTA 5 0.125 No Hit TGGTTTTCAATTGCTTTCTGTTTTATGGATCTTGTATATGTATTTGACAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0125 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAGC 10 0.006973645 144.0 5 AAGGGAG 10 0.006973645 144.0 2 AGGGAGA 10 0.006973645 144.0 3 ATTAATC 10 0.006973645 144.0 8 CCATTAA 10 0.006973645 144.0 6 AGCATTC 10 0.006973645 144.0 3 CAAGGGA 10 0.006973645 144.0 1 GACCATT 10 0.006973645 144.0 4 >>END_MODULE Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra Read 1158018 spots for SRR13259389.sra Written 1158018 spots for SRR13259389.sra Read 1158015 spots for SRR13259389.sra Written 1158015 spots for SRR13259389.sra SRR ids: ['SRR13259389.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t7zp36tf SRR13259389.sra spots: 23160303 blocks: [[1, 1158015], [1158016, 2316030], [2316031, 3474045], [3474046, 4632060], [4632061, 5790075], [5790076, 6948090], [6948091, 8106105], [8106106, 9264120], [9264121, 10422135], [10422136, 11580150], [11580151, 12738165], [12738166, 13896180], [13896181, 15054195], [15054196, 16212210], [16212211, 17370225], [17370226, 18528240], [18528241, 19686255], [19686256, 20844270], [20844271, 22002285], [22002286, 23160303]] SRR13259389 file size 7803948 SRR13259389 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259389 SRR13259389_1.fastq SRR13259389_2.fastq Input file: SRR13259389_1.fastq Paired file: SRR13259389_2.fastq trimmed: SRR13259389-trimmed-pair1.fastq, SRR13259389-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:53:32 2025 >> started Fri Feb 14 03:53:58 2025 >> done (25.982s) 23160303 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 108 ( 0.00%) empty read pairs filtered out after trimming by size control 23160195 (100.00%) read pairs available; of these: 8632 ( 0.04%) trimmed read pairs available after processing 23151563 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 0 0.00% 40 2 0.00% 41 0 0.00% 42 2 0.00% 43 0 0.00% 44 3 0.00% 45 2 0.00% 46 3 0.00% 47 1 0.00% 48 0 0.00% 49 2 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 1 0.00% 62 0 0.00% 63 0 0.00% 64 1 0.00% 65 0 0.00% 66 2 0.00% 67 0 0.00% 68 1 0.00% 69 0 0.00% 70 4 0.00% 71 5 0.00% 72 3 0.00% 73 1 0.00% 74 3 0.00% 75 4 0.00% 76 8 0.00% 77 4 0.00% 78 2 0.00% 79 2 0.00% 80 5 0.00% 81 5 0.00% 82 5 0.00% 83 7 0.00% 84 9 0.00% 85 5 0.00% 86 4 0.00% 87 9 0.00% 88 6 0.00% 89 13 0.00% 90 11 0.00% 91 14 0.00% 92 18 0.00% 93 16 0.00% 94 24 0.00% 95 20 0.00% 96 25 0.00% 97 31 0.00% 98 31 0.00% 99 24 0.00% 100 24 0.00% 101 32 0.00% 102 37 0.00% 103 38 0.00% 104 42 0.00% 105 42 0.00% 106 47 0.00% 107 57 0.00% 108 42 0.00% 109 55 0.00% 110 54 0.00% 111 52 0.00% 112 59 0.00% 113 83 0.00% 114 71 0.00% 115 59 0.00% 116 80 0.00% 117 77 0.00% 118 96 0.00% 119 104 0.00% 120 99 0.00% 121 104 0.00% 122 127 0.00% 123 116 0.00% 124 131 0.00% 125 137 0.00% 126 144 0.00% 127 146 0.00% 128 172 0.00% 129 148 0.00% 130 155 0.00% 131 152 0.00% 132 190 0.00% 133 178 0.00% 134 215 0.00% 135 204 0.00% 136 234 0.00% 137 232 0.00% 138 248 0.00% 139 253 0.00% 140 287 0.00% 141 271 0.00% 142 287 0.00% 143 305 0.00% 144 330 0.00% 145 350 0.00% 146 373 0.00% 147 463 0.00% 148 488 0.00% 149 602 0.00% 150 23151563 99.96% 23160195 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=26 prefix-density=0.35 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=20.66 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=7.0 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=27 prefix-density=0.35 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATGGACTTCGGTGCTGAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=18.17 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=5.0 sequence=AACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAACAAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATGTCCATGTGTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACC SRR13259389 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:54:57 Started mapping on | Feb 14 03:54:58 Finished on | Feb 14 04:03:56 Mapping speed, Million of reads per hour | 154.98 Number of input reads | 23160195 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18512361 Uniquely mapped reads % | 79.93% Average mapped length | 297.97 Number of splices: Total | 18354817 Number of splices: Annotated (sjdb) | 17988816 Number of splices: GT/AG | 18057302 Number of splices: GC/AG | 241521 Number of splices: AT/AC | 17067 Number of splices: Non-canonical | 38927 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 495914 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 106941 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.29% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4151920 4151920 4151920 N_multimapping 495914 495914 495914 N_noFeature 525308 9461018 9480065 N_ambiguous 195066 49326 49615 UnstrandedReadsAssigned:17791987 PositiveStrandReadsAssigned:9002017 NegativeStrandReadsAssigned:8982681 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259389 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259389-trimmed-pair1.fastq SRR13259389-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,160,195 reads, 18,337,448 reads pseudoaligned [quant] estimated average fragment length: 242.196 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR13259389.ke.tsv 34699 SRR13259389.se.tsv 87100 total ==> SRR13259389.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.8 2039 50.6912 Potri.005G024800.1.v4.1 1035 793.804 793 44.1281 Potri.004G059700.1.v4.1 961 719.804 7 0.429575 Potri.007G009000.2.v4.1 1416 1174.8 0 0 Potri.003G141000.2.v4.1 2943 2701.8 1054.24 17.2362 Potri.016G087400.1.v4.1 270 51.9093 1197 1018.6 Potri.015G069301.1.v4.1 564 322.905 0 0 Potri.010G195200.1.v4.1 1773 1531.8 1300.96 37.5159 Potri.012G127500.1.v4.1 977 735.804 3503 210.297 ==> SRR13259389.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 327 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 755 SRR13259389 completed mapping pipeline successfully