Starting /dee2/code/volunteer_pipeline.sh SRR13259390 current disk space = 3088137957376 free memory = 1427033140 SRR13259390 SRAfilesize cb3900361e92e7bbc8c3de5d52b4141f SRR13259390.sra SRR13259390.sra file validated SRR13259390 is paired end SRR13259390 is conventional basespace SRR13259390 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259390_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.65725 37.0 37.0 37.0 37.0 37.0 2 36.5935 37.0 37.0 37.0 37.0 37.0 3 36.65 37.0 37.0 37.0 37.0 37.0 4 36.6535 37.0 37.0 37.0 37.0 37.0 5 36.6525 37.0 37.0 37.0 37.0 37.0 6 36.547 37.0 37.0 37.0 37.0 37.0 7 36.602 37.0 37.0 37.0 37.0 37.0 8 36.699 37.0 37.0 37.0 37.0 37.0 9 36.6965 37.0 37.0 37.0 37.0 37.0 10-14 36.6352 37.0 37.0 37.0 37.0 37.0 15-19 36.6651 37.0 37.0 37.0 37.0 37.0 20-24 36.5976 37.0 37.0 37.0 37.0 37.0 25-29 36.5458 37.0 37.0 37.0 37.0 37.0 30-34 36.492900000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.495999999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4721 37.0 37.0 37.0 37.0 37.0 45-49 36.428799999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.383 37.0 37.0 37.0 37.0 37.0 55-59 36.383799999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.326100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.28 37.0 37.0 37.0 37.0 37.0 70-74 36.248000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.1738 37.0 37.0 37.0 37.0 37.0 80-84 36.2127 37.0 37.0 37.0 37.0 37.0 85-89 36.1869 37.0 37.0 37.0 37.0 37.0 90-94 36.1138 37.0 37.0 37.0 37.0 37.0 95-99 36.1552 37.0 37.0 37.0 37.0 37.0 100-104 35.979 37.0 37.0 37.0 37.0 37.0 105-109 36.0405 37.0 37.0 37.0 37.0 37.0 110-114 36.0552 37.0 37.0 37.0 37.0 37.0 115-119 35.941500000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.9384 37.0 37.0 37.0 37.0 37.0 125-129 35.7949 37.0 37.0 37.0 37.0 37.0 130-134 35.6441 37.0 37.0 37.0 37.0 37.0 135-139 35.703700000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7583 37.0 37.0 37.0 37.0 37.0 145-149 35.5707 37.0 37.0 37.0 37.0 37.0 150 35.3435 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 2.0 22 0.0 23 0.0 24 5.0 25 3.0 26 5.0 27 8.0 28 19.0 29 20.0 30 21.0 31 33.0 32 40.0 33 67.0 34 95.0 35 267.0 36 3184.0 37 226.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.58314578644661 16.779194798699677 18.479619904976243 32.15803950987747 2 22.8 23.3 34.875 19.025 3 23.175 28.925 27.275 20.625 4 24.675 34.75 19.25 21.325 5 23.35 35.8 21.775 19.075 6 18.325 36.225 24.85 20.599999999999998 7 16.7 16.075 42.55 24.675 8 20.5 21.2 27.875 30.425 9 19.825 22.3 30.0 27.875 10-14 21.92 29.04 25.569999999999997 23.47 15-19 22.15 27.51 27.084999999999997 23.255 20-24 22.220000000000002 27.700000000000003 27.63 22.45 25-29 21.995 27.584999999999997 27.025 23.395 30-34 22.06 27.950000000000003 27.505000000000003 22.485 35-39 21.935 28.65 26.095000000000002 23.32 40-44 22.085 27.505000000000003 27.07 23.34 45-49 21.725 28.015 27.034999999999997 23.225 50-54 22.555 27.860000000000003 27.12 22.465 55-59 22.257225722572258 27.547754775477546 26.472647264726472 23.72237223722372 60-64 21.4971497149715 28.212821282128214 26.552655265526553 23.737373737373737 65-69 22.52 27.505000000000003 26.91 23.064999999999998 70-74 22.3 27.450000000000003 26.955000000000002 23.294999999999998 75-79 22.59 27.615000000000002 26.775 23.02 80-84 22.31 27.284999999999997 27.095000000000002 23.31 85-89 22.29 28.015 26.729999999999997 22.965 90-94 22.585 27.375 26.740000000000002 23.3 95-99 22.925 26.784999999999997 26.96 23.330000000000002 100-104 23.165 27.85 26.655 22.33 105-109 22.225 27.38 26.979999999999997 23.415 110-114 22.25 27.495000000000005 27.88 22.375 115-119 23.255 26.950000000000003 27.16 22.634999999999998 120-124 22.650000000000002 27.060000000000002 26.85 23.44 125-129 22.71 26.87 27.165 23.255 130-134 22.705000000000002 26.135 27.639999999999997 23.52 135-139 23.0 26.44 27.62 22.939999999999998 140-144 23.3 26.619999999999997 27.435 22.645 145-149 23.49 27.169999999999998 26.715 22.625 150 24.224999999999998 26.05 27.650000000000002 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 3.0 24 2.5 25 2.0 26 5.5 27 8.5 28 8.0 29 9.5 30 16.0 31 24.5 32 32.0 33 41.0 34 54.0 35 68.0 36 80.5 37 88.0 38 105.5 39 134.5 40 153.0 41 178.0 42 202.0 43 206.0 44 227.0 45 256.5 46 258.5 47 242.0 48 225.5 49 214.5 50 183.5 51 149.0 52 134.0 53 115.5 54 107.5 55 93.0 56 64.0 57 53.0 58 48.5 59 42.0 60 43.0 61 32.0 62 17.0 63 14.5 64 9.5 65 9.5 66 11.0 67 10.0 68 6.0 69 2.5 70 3.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.47852207870231 69.475 2 13.547611895464104 22.55 3 2.373085010513668 5.925 4 0.5407029137879243 1.7999999999999998 5 0.06007810153199159 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAGAAAGTCAACACAGTTGGTTCCTAACATACAAAATTTCTTTCTTCTCT 5 0.125 No Hit GCACGTCCTACCACCTTGAGCAAAACTTTCAATTATCGAATGATCCACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCGCAA 10 0.006973645 144.0 4 TTGCGCA 10 0.006973645 144.0 3 TCATTGT 10 0.006973645 144.0 3 >>END_MODULE SRR13259390 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13259390_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4545 37.0 37.0 37.0 37.0 37.0 2 36.3475 37.0 37.0 37.0 37.0 37.0 3 36.475 37.0 37.0 37.0 37.0 37.0 4 36.4455 37.0 37.0 37.0 37.0 37.0 5 36.469 37.0 37.0 37.0 37.0 37.0 6 36.4145 37.0 37.0 37.0 37.0 37.0 7 36.467 37.0 37.0 37.0 37.0 37.0 8 36.5945 37.0 37.0 37.0 37.0 37.0 9 36.6115 37.0 37.0 37.0 37.0 37.0 10-14 36.50599999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5139 37.0 37.0 37.0 37.0 37.0 20-24 36.443400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3939 37.0 37.0 37.0 37.0 37.0 30-34 36.43730000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4072 37.0 37.0 37.0 37.0 37.0 40-44 36.3232 37.0 37.0 37.0 37.0 37.0 45-49 36.3433 37.0 37.0 37.0 37.0 37.0 50-54 36.248000000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.1903 37.0 37.0 37.0 37.0 37.0 60-64 36.1361 37.0 37.0 37.0 37.0 37.0 65-69 36.090700000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.0888 37.0 37.0 37.0 37.0 37.0 75-79 35.9568 37.0 37.0 37.0 37.0 37.0 80-84 35.9809 37.0 37.0 37.0 37.0 37.0 85-89 35.826499999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.847 37.0 37.0 37.0 37.0 37.0 95-99 35.834900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8476 37.0 37.0 37.0 37.0 37.0 105-109 35.8136 37.0 37.0 37.0 37.0 37.0 110-114 35.796400000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.807599999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.6079 37.0 37.0 37.0 37.0 37.0 125-129 35.6289 37.0 37.0 37.0 34.6 37.0 130-134 35.4664 37.0 37.0 37.0 34.6 37.0 135-139 35.3942 37.0 37.0 37.0 32.2 37.0 140-144 35.4744 37.0 37.0 37.0 34.6 37.0 145-149 35.346900000000005 37.0 37.0 37.0 34.6 37.0 150 35.4175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 2.0 23 2.0 24 7.0 25 7.0 26 4.0 27 10.0 28 6.0 29 15.0 30 24.0 31 29.0 32 41.0 33 51.0 34 143.0 35 673.0 36 2883.0 37 101.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.15 15.950000000000001 18.625 30.275000000000002 2 22.675 22.325 34.925 20.075000000000003 3 21.975 29.125 26.35 22.55 4 23.674999999999997 34.175 21.075 21.075 5 23.400000000000002 35.725 20.674999999999997 20.200000000000003 6 18.975 35.35 24.275 21.4 7 18.099999999999998 17.474999999999998 42.35 22.075 8 20.625 21.099999999999998 27.55 30.725 9 22.400000000000002 23.275000000000002 27.800000000000004 26.525 10-14 22.55 28.075 26.39 22.985 15-19 22.345000000000002 26.965 27.375 23.315 20-24 22.215 27.905 27.1 22.78 25-29 22.425 27.250000000000004 27.46 22.865 30-34 22.255 28.015 26.995 22.735 35-39 22.535 28.38 26.46 22.625 40-44 22.545 27.689999999999998 27.029999999999998 22.735 45-49 22.195 28.005000000000003 26.845000000000002 22.955000000000002 50-54 21.8 27.625 26.825 23.75 55-59 23.04 28.29 25.835 22.835 60-64 23.025000000000002 27.48 26.465 23.03 65-69 22.905 27.41 26.825 22.86 70-74 22.765 28.065 26.685 22.485 75-79 22.915 27.655 26.640000000000004 22.79 80-84 22.66 28.02 26.490000000000002 22.830000000000002 85-89 22.564999999999998 27.705000000000002 26.790000000000003 22.939999999999998 90-94 23.59 27.169999999999998 25.855 23.385 95-99 23.369999999999997 27.13 26.815 22.685 100-104 23.125 26.700000000000003 27.235 22.939999999999998 105-109 22.66 27.3 26.845000000000002 23.195 110-114 22.6 26.825 27.51 23.064999999999998 115-119 22.935 27.389999999999997 26.83 22.845 120-124 22.845 27.384999999999998 27.485 22.285 125-129 22.27 27.584999999999997 26.515 23.630000000000003 130-134 23.075000000000003 27.139999999999997 27.235 22.55 135-139 22.88 26.99 27.045 23.085 140-144 23.044999999999998 26.724999999999998 27.565 22.665 145-149 23.005 26.6 27.400000000000002 22.994999999999997 150 22.75 27.625 27.650000000000002 21.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 2.5 26 2.0 27 3.5 28 4.5 29 7.5 30 11.0 31 17.5 32 26.5 33 33.5 34 43.0 35 52.5 36 73.0 37 94.0 38 124.5 39 140.0 40 144.5 41 197.0 42 223.0 43 217.0 44 235.0 45 246.0 46 245.0 47 227.5 48 222.5 49 222.5 50 189.5 51 156.0 52 138.0 53 120.0 54 95.5 55 89.5 56 86.0 57 63.0 58 51.0 59 44.0 60 34.0 61 29.5 62 21.0 63 17.5 64 13.5 65 10.5 66 7.5 67 3.5 68 3.5 69 2.5 70 1.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.62327534493102 69.69999999999999 2 13.467306538692261 22.45 3 2.2795440911817635 5.7 4 0.5698860227954409 1.9 5 0.05998800239952009 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTCCTTCCTTGGACTCAAGCTTGGCAGCCAATCGGTTGTTCCGTTCAT 5 0.125 No Hit TTGAGTTAGACAGGAAGGCTATAGAGAGAACAGCCGAATCCAATGTGGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAAAC 10 0.006973645 144.0 7 CTAAACT 10 0.006973645 144.0 8 >>END_MODULE Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223097 spots for SRR13259390.sra Written 1223097 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra Read 1223088 spots for SRR13259390.sra Written 1223088 spots for SRR13259390.sra SRR ids: ['SRR13259390.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l8hsjdpy SRR13259390.sra spots: 24461769 blocks: [[1, 1223088], [1223089, 2446176], [2446177, 3669264], [3669265, 4892352], [4892353, 6115440], [6115441, 7338528], [7338529, 8561616], [8561617, 9784704], [9784705, 11007792], [11007793, 12230880], [12230881, 13453968], [13453969, 14677056], [14677057, 15900144], [15900145, 17123232], [17123233, 18346320], [18346321, 19569408], [19569409, 20792496], [20792497, 22015584], [22015585, 23238672], [23238673, 24461769]] SRR13259390 file size 8243702 SRR13259390 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13259390 SRR13259390_1.fastq SRR13259390_2.fastq Input file: SRR13259390_1.fastq Paired file: SRR13259390_2.fastq trimmed: SRR13259390-trimmed-pair1.fastq, SRR13259390-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:19:51 2025 >> started Fri Feb 14 03:20:26 2025 >> done (34.707s) 24461769 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 56 ( 0.00%) empty read pairs filtered out after trimming by size control 24461713 (100.00%) read pairs available; of these: 9136 ( 0.04%) trimmed read pairs available after processing 24452577 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 29 1 0.00% 30 2 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 2 0.00% 35 1 0.00% 36 0 0.00% 37 3 0.00% 38 0 0.00% 39 1 0.00% 40 1 0.00% 41 1 0.00% 42 1 0.00% 43 0 0.00% 44 1 0.00% 45 3 0.00% 46 0 0.00% 47 2 0.00% 48 1 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 1 0.00% 60 1 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 1 0.00% 66 2 0.00% 67 0 0.00% 68 2 0.00% 69 0 0.00% 70 3 0.00% 71 3 0.00% 72 4 0.00% 73 0 0.00% 74 9 0.00% 75 2 0.00% 76 6 0.00% 77 3 0.00% 78 5 0.00% 79 9 0.00% 80 8 0.00% 81 14 0.00% 82 7 0.00% 83 7 0.00% 84 6 0.00% 85 6 0.00% 86 5 0.00% 87 9 0.00% 88 7 0.00% 89 14 0.00% 90 12 0.00% 91 15 0.00% 92 21 0.00% 93 19 0.00% 94 21 0.00% 95 24 0.00% 96 29 0.00% 97 28 0.00% 98 35 0.00% 99 23 0.00% 100 37 0.00% 101 37 0.00% 102 38 0.00% 103 30 0.00% 104 45 0.00% 105 41 0.00% 106 45 0.00% 107 51 0.00% 108 50 0.00% 109 50 0.00% 110 54 0.00% 111 55 0.00% 112 71 0.00% 113 81 0.00% 114 72 0.00% 115 74 0.00% 116 83 0.00% 117 88 0.00% 118 93 0.00% 119 87 0.00% 120 111 0.00% 121 92 0.00% 122 141 0.00% 123 107 0.00% 124 129 0.00% 125 142 0.00% 126 151 0.00% 127 141 0.00% 128 149 0.00% 129 169 0.00% 130 166 0.00% 131 184 0.00% 132 203 0.00% 133 224 0.00% 134 233 0.00% 135 233 0.00% 136 255 0.00% 137 246 0.00% 138 264 0.00% 139 249 0.00% 140 299 0.00% 141 289 0.00% 142 324 0.00% 143 324 0.00% 144 329 0.00% 145 371 0.00% 146 418 0.00% 147 473 0.00% 148 530 0.00% 149 627 0.00% 150 24452577 99.96% 24461713 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=6.34 fanout-score-rank=7 prefix-density=0.42 prefix-fanout=2.2 sequence=CTGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=18.60 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.5 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=21 prefix-density=0.26 prefix-fanout=2.0 sequence=TGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGTGTTGCACCAGTTAAGATGTTCTATGAGAGGTCTGAGATG criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=14.46 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=4.2 sequence=AACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAACAAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATGTCCATGTGTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACC SRR13259390 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:21:32 Started mapping on | Feb 14 03:21:32 Finished on | Feb 14 03:36:08 Mapping speed, Million of reads per hour | 100.53 Number of input reads | 24461713 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17963194 Uniquely mapped reads % | 73.43% Average mapped length | 298.04 Number of splices: Total | 17758164 Number of splices: Annotated (sjdb) | 17402912 Number of splices: GT/AG | 17470336 Number of splices: GC/AG | 233766 Number of splices: AT/AC | 15898 Number of splices: Non-canonical | 38164 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485858 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 77696 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 24.11% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6012661 6012661 6012661 N_multimapping 485858 485858 485858 N_noFeature 527007 9188999 9207574 N_ambiguous 187657 47078 47434 UnstrandedReadsAssigned:17248530 PositiveStrandReadsAssigned:8727117 NegativeStrandReadsAssigned:8708186 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13259390 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13259390-trimmed-pair1.fastq SRR13259390-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,461,713 reads, 17,804,755 reads pseudoaligned [quant] estimated average fragment length: 242.318 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR13259390.ke.tsv 34699 SRR13259390.se.tsv 87100 total ==> SRR13259390.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.68 2432 65.6584 Potri.005G024800.1.v4.1 1035 793.682 789 47.6833 Potri.004G059700.1.v4.1 961 719.702 5 0.333237 Potri.007G009000.2.v4.1 1416 1174.68 0 0 Potri.003G141000.2.v4.1 2943 2701.68 930 16.5114 Potri.016G087400.1.v4.1 270 52.0013 1000 922.406 Potri.015G069301.1.v4.1 564 322.827 0 0 Potri.010G195200.1.v4.1 1773 1531.68 924.92 28.9649 Potri.012G127500.1.v4.1 977 735.696 3634 236.932 ==> SRR13259390.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 449 SRR13259390 completed mapping pipeline successfully